ID: 1034885268

View in Genome Browser
Species Human (GRCh38)
Location 7:154794163-154794185
Sequence TGGTGGCGTCGCAGAGGGTG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 168}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885268_1034885283 12 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885283 7:154794198-154794220 CGAAGGTACGCGGGGCTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1034885268_1034885290 28 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885290 7:154794214-154794236 TGTGGGGGTGGAGGGGAGACGGG 0: 1
1: 2
2: 18
3: 158
4: 1390
1034885268_1034885289 27 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811
1034885268_1034885281 10 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885281 7:154794196-154794218 CACGAAGGTACGCGGGGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 68
1034885268_1034885287 20 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885287 7:154794206-154794228 CGCGGGGCTGTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 60
4: 695
1034885268_1034885285 16 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885285 7:154794202-154794224 GGTACGCGGGGCTGTGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 429
1034885268_1034885276 -5 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885276 7:154794181-154794203 CACCACGGGGGTCTGCACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 55
1034885268_1034885278 2 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885278 7:154794188-154794210 GGGGTCTGCACGAAGGTACGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034885268_1034885284 13 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885284 7:154794199-154794221 GAAGGTACGCGGGGCTGTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1034885268_1034885280 4 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885280 7:154794190-154794212 GGTCTGCACGAAGGTACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1034885268_1034885282 11 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885282 7:154794197-154794219 ACGAAGGTACGCGGGGCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 43
1034885268_1034885279 3 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885279 7:154794189-154794211 GGGTCTGCACGAAGGTACGCGGG 0: 1
1: 0
2: 0
3: 0
4: 38
1034885268_1034885286 19 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885286 7:154794205-154794227 ACGCGGGGCTGTGGGGGTGGAGG 0: 1
1: 0
2: 7
3: 79
4: 866
1034885268_1034885288 21 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885288 7:154794207-154794229 GCGGGGCTGTGGGGGTGGAGGGG 0: 1
1: 0
2: 14
3: 181
4: 1484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885268 Original CRISPR TGGTGGCGTCGCAGAGGGTG AGG (reversed) Exonic
901010984 1:6201972-6201994 TGGGGGCGGGGCAGGGGGTGTGG - Intronic
901133779 1:6979786-6979808 TGGTGGCGTAGCTGGGGGAGAGG + Intronic
901939544 1:12651589-12651611 TGGGGCTGTCGCAGAGGCTGTGG + Intronic
902101289 1:13991971-13991993 TGGTGGGGTAGTAGAGAGTGAGG - Intergenic
904921548 1:34012121-34012143 TGGTGGAATCGGAGAGGCTGTGG - Intronic
905523149 1:38615476-38615498 TGGTGGGGTGGCGGGGGGTGGGG - Intergenic
906935753 1:50212768-50212790 GGGTGGAGTTGCAGAAGGTGAGG - Intergenic
908173039 1:61526864-61526886 GGGTGGAGTCCCAGAGGGTAGGG - Intergenic
909260739 1:73486448-73486470 TGGGGGCCTCTCAGGGGGTGGGG - Intergenic
915462909 1:156080653-156080675 TGCTGGAGCAGCAGAGGGTGTGG + Intronic
917222659 1:172748473-172748495 TGGAGGCCTCGAAGAAGGTGAGG - Intergenic
923770817 1:236936251-236936273 GGGTGGAGTAGCAGAGGCTGAGG + Intergenic
1062844794 10:695811-695833 AGATGGCGTCTCAGAGGGTGAGG + Intergenic
1062844821 10:695928-695950 GGATGGCATCTCAGAGGGTGAGG + Intergenic
1063502511 10:6567990-6568012 TGGTGGTGGCGCAGGGGGTTGGG + Intronic
1064825279 10:19391888-19391910 TGGTGGCCTCCCAGAGGTTGTGG + Intronic
1065020271 10:21496744-21496766 GGGTGGCGCTGCAGAGGGTACGG - Exonic
1067111459 10:43404124-43404146 TGGTGGAGTGGCAGGGGGTGGGG - Intronic
1069631709 10:69901264-69901286 AAGTGGCTTCTCAGAGGGTGTGG + Intronic
1072884443 10:99261294-99261316 GGGTGGCGGAGCAGAGGCTGAGG - Intergenic
1072915422 10:99534881-99534903 TGGTGGCTGCGCAGAGCGTGCGG - Intronic
1075518615 10:123130047-123130069 TGGTGGCTGGGCAGGGGGTGAGG - Intergenic
1075847673 10:125558312-125558334 TTCTGGCATCGCAGAGGGAGAGG - Intergenic
1076729258 10:132430042-132430064 TGGTGGCTTTGCAGAGCCTGGGG - Intergenic
1081573388 11:44304854-44304876 TGCCGGCGTCGCAGCGCGTGCGG + Intronic
1083332034 11:61903196-61903218 TGGTGACCAAGCAGAGGGTGAGG - Intronic
1084542088 11:69793105-69793127 TGGTGGCATCAGAGAAGGTGGGG - Intergenic
1087314603 11:96589639-96589661 GGGTGGAGTAGCAGAGGCTGAGG - Intergenic
1090778525 11:129986040-129986062 TGGTGGTGTGGCAGAGTCTGGGG + Intronic
1090848834 11:130553206-130553228 TGTTGTCATAGCAGAGGGTGGGG - Intergenic
1090979856 11:131710084-131710106 TGGTGGGGTCAAAGAGGGGGTGG + Intronic
1091408986 12:226830-226852 TGGTGGCGTCCCATGCGGTGTGG - Intronic
1091750864 12:3020559-3020581 TGGGGTCCTTGCAGAGGGTGCGG + Intronic
1101589228 12:106111420-106111442 TGGGGGCGTGGCAGAGAGTCTGG + Intronic
1101817111 12:108153698-108153720 TGGTGGCTGCACAGAGGGAGAGG + Intronic
1101858423 12:108463191-108463213 TGGTGTCTTCGCAGAGGGAAGGG - Intergenic
1101910556 12:108857628-108857650 CGGTGGCGACGCCGAGGGGGAGG - Intergenic
1102473668 12:113174959-113174981 TGGGGGAGTCGCAGAGGGACTGG + Intronic
1103779405 12:123389128-123389150 TGGTGGCGGCGGCGAGGGCGCGG + Intronic
1105472922 13:20707838-20707860 TGGTGGAGTGTCTGAGGGTGGGG + Intronic
1105830574 13:24160591-24160613 TGGGGGCGTGGCCGAGGGTGTGG + Intronic
1107075504 13:36318156-36318178 GGGTGGAGTAGCAGAGGCTGAGG - Intronic
1107823066 13:44303886-44303908 TGGTGACCTCCCAGAGGCTGTGG - Intergenic
1112450336 13:99501869-99501891 AGGGGGCGTAGCAGCGGGTGGGG + Intronic
1114221593 14:20702252-20702274 GGGTGGGGGAGCAGAGGGTGAGG - Intergenic
1114572844 14:23686174-23686196 TGGTGGCTTGGAGGAGGGTGAGG + Intergenic
1117022759 14:51588678-51588700 TGGTGGCATATCAGAGTGTGAGG - Intronic
1117606038 14:57430344-57430366 TGGTGTCCTTGCAGAGGGGGTGG - Intergenic
1119769682 14:77212719-77212741 TGGTGAGGTGGGAGAGGGTGAGG + Intronic
1120759205 14:88270958-88270980 TGGGGGCGTGGCAGTGGGTGAGG - Intronic
1122924256 14:104892468-104892490 TGGGGGCTGGGCAGAGGGTGGGG - Intronic
1124630713 15:31335478-31335500 TGGTGGCGGGGCAGGGGGCGGGG + Intronic
1125707197 15:41749144-41749166 TGGCGGAGTCTCAGAGGGTTTGG - Exonic
1125721536 15:41847432-41847454 AGGTGGGGTCGGAGAAGGTGTGG - Exonic
1129016602 15:72474451-72474473 TGGTGGCGGCGGGGAGGGCGCGG - Exonic
1130053712 15:80504911-80504933 TGGTGGGATGGCATAGGGTGAGG + Intronic
1130212404 15:81936762-81936784 TGGTAGGGTCTCAGAGGCTGGGG - Intergenic
1131072292 15:89473413-89473435 AGGTGGCTTCTCAGAGGATGGGG - Intronic
1132684363 16:1156146-1156168 TGCTGGCGGCGAGGAGGGTGGGG - Intronic
1136022519 16:27449076-27449098 TGGAGGGGTCTCAGAGAGTGAGG + Exonic
1138375168 16:56558436-56558458 TGCAGGCTTCGGAGAGGGTGAGG - Intergenic
1138786062 16:59847937-59847959 TGGTGCCATGGGAGAGGGTGGGG + Intergenic
1142069394 16:88082679-88082701 TGGTGGGGTGGAAGACGGTGCGG + Intronic
1142369381 16:89669874-89669896 CGGTGGCTTCTCACAGGGTGGGG - Exonic
1143313530 17:6013618-6013640 TGCTGGTGTGGCACAGGGTGAGG + Intronic
1143699370 17:8646832-8646854 TGGTGTCTTGGCAGAGCGTGTGG + Intergenic
1147197873 17:38779722-38779744 TGTTGGCATGGCAGAGGGAGAGG + Intronic
1147590029 17:41676763-41676785 TGGAGGAGACGCACAGGGTGAGG - Intergenic
1148905656 17:50910224-50910246 CCGTGGCGTCCCAGAGGGCGAGG + Intergenic
1149550625 17:57536897-57536919 TTGTTGGGTGGCAGAGGGTGGGG + Intronic
1149585383 17:57782824-57782846 TGGTGTCCTCGCAGAAGGGGCGG + Intergenic
1151490714 17:74431152-74431174 TGCTGGCCTCGCGGGGGGTGGGG - Exonic
1152297770 17:79478288-79478310 TGGGTGCGTCCCTGAGGGTGGGG + Intronic
1152630742 17:81409738-81409760 TGGAGACGTCGCAGAGGGTGAGG - Intronic
1158319815 18:56250339-56250361 TGGTGGAGACACAGAGAGTGGGG - Intergenic
1159923599 18:74247589-74247611 TGGTGGCTCCTCAGCGGGTGAGG - Intergenic
1160082496 18:75742239-75742261 TGGTGGCATGGCAGGGGTTGGGG + Intergenic
1160498288 18:79388018-79388040 TGGTGGAGTGGCAGGGGGAGGGG - Intergenic
1160822972 19:1066922-1066944 TGGTGGCGTCTGAGCGCGTGTGG + Intronic
1161342577 19:3751290-3751312 TGGTGGCATCGCCGAGCGTGGGG - Exonic
1162381627 19:10335003-10335025 TGGGGGCGTGGCAGAGGGGGCGG - Intronic
1162740329 19:12770311-12770333 TTGTGGGGACACAGAGGGTGGGG + Intronic
1163830442 19:19544924-19544946 TGTCGGCGTCGCAGAAGGCGGGG - Exonic
1166718972 19:44986728-44986750 TGGTGGTGTGGGAGAGGGAGAGG - Intronic
1167485810 19:49762310-49762332 GGGTGGAGTCACAGGGGGTGAGG - Intronic
1167638079 19:50666826-50666848 TGGTGGCAGCGCAGGGGGTGGGG - Exonic
925139001 2:1537288-1537310 TGGGGACGTTGCAGAGGGTGGGG - Intronic
927102777 2:19800575-19800597 TGGTGGCTTGGCTCAGGGTGTGG - Intergenic
928292178 2:30049101-30049123 TGAGGGCCTTGCAGAGGGTGTGG - Intergenic
932144237 2:69304911-69304933 TGGGGCTGTCGCTGAGGGTGGGG + Intergenic
932495183 2:72142645-72142667 TGGTGGAGTCGCAAAGGCTGAGG + Intronic
933698910 2:85240351-85240373 GGCTGTCATCGCAGAGGGTGTGG + Intronic
934161293 2:89252280-89252302 TGGTGGAGTGGCAGTGGGTTCGG - Intergenic
934205986 2:89930135-89930157 TGGTGGAGTGGCAGTGGGTTCGG + Intergenic
935023925 2:99258054-99258076 AGGTGGGGACGCAGAGGGCGAGG - Intronic
935726020 2:106024618-106024640 AGGTGGCTTGGCTGAGGGTGTGG + Intergenic
940847456 2:158657027-158657049 TTGTGGCCTTGCAGAGGGAGGGG - Intronic
941709038 2:168692001-168692023 TAGTGTCATGGCAGAGGGTGGGG + Intronic
1171113281 20:22503146-22503168 TGGTGGGGTGGGTGAGGGTGTGG + Intergenic
1172435920 20:34928857-34928879 TGGTGGTGTGGCAGCGGGAGTGG - Exonic
1172483257 20:35284282-35284304 TGGTGGCGGGGCAGAGGGGCCGG + Intronic
1174444743 20:50582973-50582995 TGCTGGCGGCGCAGAGGGAAGGG + Exonic
1174504479 20:51008284-51008306 TGGTGGCGGGGCAGGGGGAGGGG + Intronic
1175825850 20:61936316-61936338 TGGAGGTGTGGGAGAGGGTGGGG - Intronic
1176055179 20:63141447-63141469 AGCTGGGGTTGCAGAGGGTGCGG + Intergenic
1176116201 20:63432692-63432714 TGGGGCCTTCCCAGAGGGTGGGG - Intronic
1180724780 22:17938687-17938709 CGGAAGCGTGGCAGAGGGTGAGG + Intronic
1180857863 22:19059605-19059627 TGCTGGGGTGGCAGGGGGTGAGG - Intronic
1182143000 22:27978880-27978902 TGATGGAGTAGCAGAGGGTGGGG + Exonic
1183510062 22:38229528-38229550 TGGTGGGGTCGCTCAGTGTGTGG - Intronic
1184846457 22:47090725-47090747 GAGTGGCCTCGCAGAGGGGGTGG + Intronic
1184846511 22:47090984-47091006 GAGTGGCCTCGCAGAGGGGGTGG + Intronic
1184846524 22:47091050-47091072 GAGTGGCCTCGCAGAGGGGGTGG + Intronic
1184846562 22:47091245-47091267 GAGTGGCCTCGCAGAGGTTGTGG + Intronic
1184864229 22:47193354-47193376 GCGTGGCATCGCAGGGGGTGTGG + Intergenic
1184892420 22:47388155-47388177 TGGGTGCATGGCAGAGGGTGCGG + Intergenic
949543508 3:5052898-5052920 TGGTGGTGTTGGTGAGGGTGAGG + Intergenic
953319613 3:41960497-41960519 TGGTGGTGTGCCAGAGGCTGAGG - Intronic
954149558 3:48650636-48650658 TGGTGGAGGGGCAGTGGGTGTGG - Intronic
955408467 3:58640806-58640828 TGGAGGCGTTGCAGAGGGGATGG + Intronic
961495255 3:127286948-127286970 TGGGGGAGGGGCAGAGGGTGTGG + Intergenic
963098739 3:141576383-141576405 TGGTGGTGAAGCAGATGGTGAGG - Intronic
969029833 4:4203035-4203057 AGGTGGCATGGCAGAGGGTGTGG - Intronic
969179831 4:5430953-5430975 TGCTGATGTGGCAGAGGGTGGGG + Intronic
969586594 4:8097586-8097608 TGGCGGGGTCACAGAGGCTGGGG - Intronic
975098136 4:70481253-70481275 TGGTGTAGTTGCAGAAGGTGTGG - Exonic
975098175 4:70481460-70481482 TGGTGTAGTTGCAGAAGGTGTGG - Exonic
975098201 4:70481598-70481620 TGGTGTAGTTGCAGAAGGTGTGG - Exonic
982067983 4:151671576-151671598 TTGTGGCGTCGCAGAGGGGAGGG - Intronic
985761506 5:1751520-1751542 AGGTGGGGTGGCAGAGGGAGGGG - Intergenic
985878576 5:2619850-2619872 TGGGGGAGAAGCAGAGGGTGGGG - Intergenic
988603325 5:32659038-32659060 TGGGGGCCTGTCAGAGGGTGAGG - Intergenic
989523257 5:42424736-42424758 CGCTGGCGGCGCAGAGGGTGCGG + Intronic
995047856 5:107670907-107670929 TGGTGGCGGCGGCGAGGGCGGGG + Intergenic
996611092 5:125381554-125381576 TGGTGACGTCTCAGAAGGAGAGG + Intergenic
996864257 5:128101852-128101874 TGTTGGCTTGGCAGATGGTGTGG + Intronic
997698475 5:135879909-135879931 TGGTGGCCCTGCAGAGAGTGTGG + Intronic
1000633005 5:163612519-163612541 TGGGGGGGTCGCGGAGGCTGTGG - Intergenic
1001950894 5:175815726-175815748 TGGTGGCAAGGCAGAGGGAGGGG - Intronic
1006154160 6:32005349-32005371 CGGTGGGGTGGCAGAGGGAGAGG + Intergenic
1006160467 6:32038084-32038106 CGGTGGGGTGGCAGAGGGAGAGG + Intergenic
1007261927 6:40569931-40569953 TGGAGGGAACGCAGAGGGTGAGG - Intronic
1010076584 6:71804961-71804983 TGGTGGCATGGAAGAGAGTGTGG - Intergenic
1010387744 6:75302039-75302061 TGGGGGAGTCGGAAAGGGTGAGG + Intronic
1011018409 6:82783778-82783800 GGGTGGCAACGCAGAGGGGGTGG + Intergenic
1012908581 6:105094529-105094551 TGGTGGCCGTGCAGAGAGTGCGG + Intergenic
1016427342 6:143948627-143948649 TTTTGGCTTCTCAGAGGGTGAGG + Intronic
1016899628 6:149088752-149088774 TGTTGCCCTCACAGAGGGTGTGG - Intergenic
1018443535 6:163834672-163834694 TGGTGGCTGGGGAGAGGGTGTGG - Intergenic
1018974851 6:168556439-168556461 TCGTGGCCTCGCAGACTGTGCGG + Intronic
1019412535 7:912477-912499 GGGAGGCGGCGCAGAGGGTGGGG + Intronic
1020073583 7:5243234-5243256 GGGTGGGGTGGCTGAGGGTGGGG - Intergenic
1023298283 7:38739726-38739748 GGGTGGCTTCTCAGAGGGTGAGG - Intronic
1023864918 7:44234008-44234030 TGGTGGAGGAGCTGAGGGTGGGG + Intronic
1026382990 7:69817844-69817866 AGGTAGCTTTGCAGAGGGTGGGG - Intronic
1028985946 7:97008044-97008066 GGGTGGGGTCGCCGAGGGTTGGG - Intronic
1030348924 7:108461704-108461726 TGGCGGTGTGGCAGATGGTGAGG - Intergenic
1032127156 7:129203481-129203503 GGGTGGCCTGGCAGAGGGTACGG - Exonic
1032395747 7:131588523-131588545 AGGTGGCAGGGCAGAGGGTGTGG - Intergenic
1034407711 7:150916309-150916331 AAGTGGAGTGGCAGAGGGTGGGG + Intergenic
1034885268 7:154794163-154794185 TGGTGGCGTCGCAGAGGGTGAGG - Exonic
1037329385 8:17728782-17728804 TGGGGGGGTCGGGGAGGGTGAGG + Intronic
1038041388 8:23726937-23726959 GGGTGGCGCCGCAGGGGGTGGGG + Intergenic
1038412367 8:27368371-27368393 TGGTGGCGGGGTAGGGGGTGAGG - Intronic
1040464092 8:47678596-47678618 TGGAGGGGGTGCAGAGGGTGGGG + Intronic
1044599617 8:93990868-93990890 TTGTGGAGTAGCAGTGGGTGAGG + Intergenic
1044852526 8:96442967-96442989 TGGTGGGGTGGCAGCGGGTGGGG - Intergenic
1045242770 8:100416895-100416917 GGGTGGCAGAGCAGAGGGTGGGG + Intergenic
1048575306 8:135685420-135685442 TGGTGGCATCTCAGAGTGTCAGG + Intergenic
1049260617 8:141637056-141637078 TGCTGGCCTCCGAGAGGGTGAGG + Intergenic
1049371803 8:142271480-142271502 TGCTGGCGCCGAAGAGGGCGGGG + Intronic
1049377934 8:142297941-142297963 TGGGGGTGACGCAGAGGATGTGG - Intronic
1049443795 8:142620906-142620928 GGGTGGTGTGGCAGAGGGTGAGG + Intergenic
1049660304 8:143816869-143816891 TGGTGGCGGGGGAGAGGGTAGGG - Intronic
1049774064 8:144396660-144396682 AGGTGGCGGCGCAGAGGAGGGGG - Exonic
1051371408 9:16362353-16362375 TGGTGAGGTGGCAGAGAGTGGGG - Intergenic
1051626319 9:19102858-19102880 TGGTGGCTTCGCTGAGGCAGTGG - Exonic
1051731391 9:20146888-20146910 TAGTGGAGTCGCAGTGGGAGTGG - Intergenic
1056072934 9:83007674-83007696 TTGTGGAGTCGCAGAAGGAGAGG - Intronic
1057131560 9:92657734-92657756 TGGTGGGGCCACAGTGGGTGTGG - Intronic
1060279623 9:122207035-122207057 TTGTGGCTTAGCACAGGGTGTGG - Intronic
1186575351 X:10759633-10759655 TGGGGGAGTGGCGGAGGGTGGGG - Intronic
1189014190 X:37078341-37078363 TGGCGGCCTCGCAGTTGGTGTGG + Intergenic
1190366034 X:49695690-49695712 TGGCGGCGTCGCAGCCTGTGAGG + Intronic
1190883487 X:54510490-54510512 TGGTGGCTTCACAGAGGGGAGGG - Intergenic
1191083254 X:56536984-56537006 TGGTGTCCTTGCATAGGGTGGGG - Intergenic
1194982603 X:100455438-100455460 TGGTTGCGTCGCAGAGATTCTGG - Intergenic
1195927457 X:110039915-110039937 TGGGGGTGGCTCAGAGGGTGAGG + Intronic
1196214644 X:113036106-113036128 TGGTGTCTTTGCAGGGGGTGAGG + Intergenic
1199400200 X:147389891-147389913 TGGTGGCGTCGTGAAGGGTATGG - Intergenic