ID: 1034885271

View in Genome Browser
Species Human (GRCh38)
Location 7:154794168-154794190
Sequence CCCCGTGGTGGCGTCGCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885271_1034885290 23 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885290 7:154794214-154794236 TGTGGGGGTGGAGGGGAGACGGG 0: 1
1: 2
2: 18
3: 158
4: 1390
1034885271_1034885289 22 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811
1034885271_1034885284 8 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885284 7:154794199-154794221 GAAGGTACGCGGGGCTGTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1034885271_1034885286 14 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885286 7:154794205-154794227 ACGCGGGGCTGTGGGGGTGGAGG 0: 1
1: 0
2: 7
3: 79
4: 866
1034885271_1034885285 11 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885285 7:154794202-154794224 GGTACGCGGGGCTGTGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 429
1034885271_1034885276 -10 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885276 7:154794181-154794203 CACCACGGGGGTCTGCACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 55
1034885271_1034885280 -1 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885280 7:154794190-154794212 GGTCTGCACGAAGGTACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 13
1034885271_1034885282 6 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885282 7:154794197-154794219 ACGAAGGTACGCGGGGCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 43
1034885271_1034885278 -3 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885278 7:154794188-154794210 GGGGTCTGCACGAAGGTACGCGG 0: 1
1: 0
2: 0
3: 1
4: 51
1034885271_1034885287 15 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885287 7:154794206-154794228 CGCGGGGCTGTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 60
4: 695
1034885271_1034885283 7 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885283 7:154794198-154794220 CGAAGGTACGCGGGGCTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1034885271_1034885279 -2 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885279 7:154794189-154794211 GGGTCTGCACGAAGGTACGCGGG 0: 1
1: 0
2: 0
3: 0
4: 38
1034885271_1034885288 16 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885288 7:154794207-154794229 GCGGGGCTGTGGGGGTGGAGGGG 0: 1
1: 0
2: 14
3: 181
4: 1484
1034885271_1034885281 5 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885281 7:154794196-154794218 CACGAAGGTACGCGGGGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885271 Original CRISPR CCCCGTGGTGGCGTCGCAGA GGG (reversed) Exonic
905399212 1:37689805-37689827 CCCCGTGGTGGAGGAGCAGCAGG - Exonic
905966615 1:42103922-42103944 CCCAGAGGTGGACTCGCAGAGGG - Intergenic
912361620 1:109100432-109100454 CCCCGAGGGGGCTTCGCAGGAGG - Intergenic
916761307 1:167820245-167820267 CCCTGTGGTGGCGACGACGATGG - Intronic
920182902 1:204143494-204143516 CCCCGTGGTGGCGGGACTGAAGG - Intronic
922481180 1:225940930-225940952 CCCCGTGGCTGCGCCGCAGCAGG + Exonic
923777166 1:236990151-236990173 CCCCATGGTGGCCTGCCAGAGGG + Intergenic
924707882 1:246513175-246513197 CCACATGGTGGGGTCACAGATGG - Intergenic
1069746391 10:70717543-70717565 CCCCGTGGTGGCATCCAAGGTGG + Intronic
1070986460 10:80693740-80693762 CACCCTGGTGGAGGCGCAGATGG + Intergenic
1071346948 10:84702063-84702085 CCCCAAGGTGGCTTCTCAGAGGG + Intergenic
1072503841 10:96044285-96044307 CCCCGGGGAGGGGGCGCAGAGGG + Intronic
1074535423 10:114325394-114325416 CCCTGTCGGGGCATCGCAGAGGG + Intronic
1076023808 10:127095629-127095651 CCACGTGGTTGTGTCACAGATGG - Intronic
1085310745 11:75515266-75515288 CCCCGTGGGGGCCTCCCACATGG + Intronic
1089975384 11:122727560-122727582 CCCCGTGGAGGCCTCCGAGATGG + Intronic
1100478154 12:94952975-94952997 CCCCATGGTGGCATCTAAGAAGG - Intronic
1100813388 12:98362428-98362450 CCCCATGGTGGAGTCGCCGGTGG + Intergenic
1103735476 12:123058224-123058246 CCCCATGGTGGCATTGGAGACGG - Intronic
1115610738 14:35046514-35046536 CCCTGTGGTGGCGACGACGATGG + Exonic
1121629922 14:95414433-95414455 CCCAGTGGTGGCGGGACAGAGGG - Intronic
1202905995 14_GL000194v1_random:72828-72850 CACCTGGGTGGCTTCGCAGATGG - Intergenic
1129887494 15:79048910-79048932 CCCTGTGGTGGTGTGGCAGAGGG - Intronic
1139853160 16:69962576-69962598 GCCCTTGGTGGCCTCGCAGCCGG - Intronic
1139882131 16:70185484-70185506 GCCCTTGGTGGCCTCGCAGCCGG - Intronic
1140370377 16:74410020-74410042 GCCCTTGGTGGCCTCGCAGCCGG + Intronic
1146034063 17:29390725-29390747 CCCCGAGGCGGCGACGGAGACGG + Exonic
1147242580 17:39100191-39100213 CCCCGTGATGGGGTGGCAGGTGG - Intronic
1149585379 17:57782819-57782841 GCCAGTGGTGTCCTCGCAGAAGG + Intergenic
1155216560 18:23648285-23648307 CCCCGTGGGGGCATCACAGTAGG - Intronic
1160576398 18:79856693-79856715 GCCCTTTGTGGCGTGGCAGACGG - Intergenic
1162410574 19:10502909-10502931 CGCCGTGGTGGCCGCGCAGCTGG - Intronic
1162911045 19:13847850-13847872 CCCCCTGCCGGCGGCGCAGACGG + Intergenic
1163407017 19:17129074-17129096 CCCAGAGGTGGTGTTGCAGAGGG + Intronic
1165105779 19:33469019-33469041 CCCCGGGCTGGCGTCATAGAGGG - Intronic
1166333323 19:42091162-42091184 GCCAGTGGTGGGGACGCAGAGGG - Exonic
931460125 2:62443214-62443236 CCCCGTGGTGTGATCTCAGAGGG + Intergenic
935922594 2:108031846-108031868 CCCCGTGGTGGGCTCCCACATGG + Intergenic
941644247 2:168023440-168023462 CCCAGTGGTGGAGGTGCAGAAGG + Intronic
944743705 2:202635505-202635527 CCCCACGGTGGCCACGCAGACGG + Exonic
949058725 2:241944147-241944169 CCCCGAGGTCGCTTCCCAGAGGG + Intergenic
1168814578 20:728131-728153 CCCCGCGGGGGCGGCGCAGGAGG + Intergenic
1169074398 20:2752231-2752253 CCCCGGGGTGGCGTCCCCGACGG - Exonic
1172483255 20:35284277-35284299 CTCGGTGGTGGCGGGGCAGAGGG + Intronic
1173810806 20:45953945-45953967 CCCCCTGGTGCCGTTGCAGGTGG - Exonic
1175914266 20:62418515-62418537 CCCCGTGGTGGGGACACTGAAGG - Intronic
1176625351 21:9087584-9087606 CACCTGGGTGGCTTCGCAGATGG - Intergenic
1178472674 21:32907384-32907406 CCCAGTGGTGGGCTTGCAGATGG + Intergenic
1181388870 22:22564735-22564757 CCCAGTGCTGGGGTCTCAGAAGG + Exonic
949238363 3:1838924-1838946 CCCTGTTGTGATGTCGCAGATGG - Intergenic
968659799 4:1794247-1794269 CCCCGTGGTGGCCTCGCACTTGG - Intronic
969293410 4:6254915-6254937 CCCAGTGGAGGAGTGGCAGAGGG + Intergenic
969548817 4:7850634-7850656 CCCTGTGCTGGCCTCGGAGATGG - Intronic
975410070 4:74038816-74038838 CCCCGGGGTGGAGTCGGATACGG + Intergenic
983219599 4:165031848-165031870 CTCCGTGGTGGGGTCCCTGATGG - Intergenic
985804696 5:2033972-2033994 CCCTGTGGTAGCCTCACAGAAGG - Intergenic
985962871 5:3316159-3316181 CCCAGTGGAGGTGTCACAGAAGG + Intergenic
995083210 5:108078157-108078179 CCATGTGGTGGCATTGCAGATGG - Intronic
995854253 5:116575844-116575866 CCCCAAGGGGGCTTCGCAGATGG + Intergenic
998286203 5:140863181-140863203 CACCGTGGTGGCGTCGCTGGCGG + Intronic
1002299348 5:178248578-178248600 CCCAGTGGTGGCGTAACAGCTGG + Intronic
1003603628 6:7541384-7541406 CCCCGCGGTGGCTTCGCCCAGGG + Intergenic
1006298308 6:33179751-33179773 CCCTGTGGTGGCGGCCCAGGAGG - Exonic
1006304529 6:33211309-33211331 CCCCGTGGAGGGGGCGCAGGGGG + Exonic
1008113186 6:47516157-47516179 CTCAGTGGTGGCGTAGCACAAGG + Intronic
1018195211 6:161349814-161349836 CCTGTTGGTGGTGTCGCAGATGG + Exonic
1019634416 7:2067820-2067842 CGCCGTGGTGGTGCCGCAGAAGG - Intronic
1032002371 7:128273748-128273770 CCTCGTGGTGGTGTCCCAGGAGG - Intergenic
1034443512 7:151100135-151100157 GCCCTTTGTGGCGTCTCAGATGG + Intronic
1034885271 7:154794168-154794190 CCCCGTGGTGGCGTCGCAGAGGG - Exonic
1050832998 9:10037331-10037353 CCCCTTGGTGGTGTTGCAGCAGG + Intronic
1055397654 9:75891651-75891673 CCCCGTGGTGGCTTCAGAGACGG + Intronic
1062399564 9:136366469-136366491 CCCCGTGGGGGCTGCCCAGAGGG + Intronic
1203748525 Un_GL000218v1:58045-58067 CACCTGGGTGGCTTCGCAGATGG - Intergenic