ID: 1034885275

View in Genome Browser
Species Human (GRCh38)
Location 7:154794180-154794202
Sequence CTTCGTGCAGACCCCCGTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 46}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885275_1034885291 25 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885291 7:154794228-154794250 GGAGACGGGTGAAGAACCGATGG 0: 1
1: 0
2: 0
3: 7
4: 103
1034885275_1034885289 10 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811
1034885275_1034885284 -4 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885284 7:154794199-154794221 GAAGGTACGCGGGGCTGTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1034885275_1034885282 -6 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885282 7:154794197-154794219 ACGAAGGTACGCGGGGCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 43
1034885275_1034885290 11 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885290 7:154794214-154794236 TGTGGGGGTGGAGGGGAGACGGG 0: 1
1: 2
2: 18
3: 158
4: 1390
1034885275_1034885286 2 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885286 7:154794205-154794227 ACGCGGGGCTGTGGGGGTGGAGG 0: 1
1: 0
2: 7
3: 79
4: 866
1034885275_1034885288 4 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885288 7:154794207-154794229 GCGGGGCTGTGGGGGTGGAGGGG 0: 1
1: 0
2: 14
3: 181
4: 1484
1034885275_1034885283 -5 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885283 7:154794198-154794220 CGAAGGTACGCGGGGCTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1034885275_1034885287 3 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885287 7:154794206-154794228 CGCGGGGCTGTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 60
4: 695
1034885275_1034885285 -1 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885285 7:154794202-154794224 GGTACGCGGGGCTGTGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 429
1034885275_1034885281 -7 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885281 7:154794196-154794218 CACGAAGGTACGCGGGGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885275 Original CRISPR CTTCGTGCAGACCCCCGTGG TGG (reversed) Exonic
902715639 1:18270711-18270733 CTTCGTGCAGACCCCACCAGTGG + Intronic
904767116 1:32858647-32858669 CTTTGTCAAGACCCCCATGGTGG - Exonic
919712315 1:200739748-200739770 CTCCCTCCCGACCCCCGTGGTGG + Exonic
919823903 1:201490331-201490353 CTTCTTGCAGACCACTGTGGAGG + Exonic
924038048 1:239955683-239955705 CTGAGTGCAGACCCCCGGGCTGG - Intergenic
1069794041 10:71041164-71041186 CTGCCTGCAGACCCCCGAGCTGG + Intergenic
1071528315 10:86371287-86371309 CATGGTGCAGACACCCATGGTGG + Intergenic
1072662412 10:97370979-97371001 CTTCGTGCAGAGCCACCTGGAGG - Exonic
1072788429 10:98300653-98300675 CTCCCTGCAGACCCCCATGCTGG + Intergenic
1076221296 10:128735028-128735050 CTTCCTGCACACCCCAGAGGAGG + Intergenic
1077866012 11:6222597-6222619 TTTTGTGCAGACCTCTGTGGAGG - Exonic
1084272358 11:68036153-68036175 CTTCTGGCAGACCCCAGGGGTGG + Intronic
1104750150 12:131233175-131233197 CTGCGTGCAGACCCCCTTCGTGG - Intergenic
1104782566 12:131431286-131431308 CTGCGTGCAGACCCCCTTCGTGG + Intergenic
1114503623 14:23190957-23190979 CTTCCTGCAGACCGTCTTGGGGG + Intronic
1118845974 14:69548153-69548175 CTTCGTGCAGACCGCAGAGCTGG + Intergenic
1120113528 14:80586272-80586294 CCTTGGGCAGACCCCTGTGGTGG + Intronic
1128233982 15:66054544-66054566 CTTCATCCAGACACCCCTGGAGG - Intronic
1131577062 15:93602806-93602828 CTACTTGCAGACTCCCTTGGTGG + Intergenic
1132462183 16:61128-61150 CTGCGTGCAGACCTCGGAGGAGG - Exonic
1132602591 16:780241-780263 CCTCAAGCAGACCCCCATGGTGG - Intronic
1132953441 16:2578107-2578129 CTTGGTGCTGCCCCCCGTCGGGG + Intronic
1132960910 16:2622061-2622083 CTTGGTGCTGTCCCCCGTCGGGG - Intergenic
1135078084 16:19411092-19411114 CTTCGTGCAGCCCGCCCTGCAGG + Exonic
1140808345 16:78553793-78553815 GGTCCTGCAGACCCCCCTGGTGG + Intronic
1161077216 19:2291662-2291684 CACCGTGCAGACCCGCGCGGTGG - Exonic
1162143847 19:8600999-8601021 CTACGTGGAGACCCTGGTGGTGG - Exonic
1163678587 19:18667970-18667992 CTTCCTGCAGATCGCCGAGGAGG + Exonic
1165791326 19:38494404-38494426 CTTCGTGCAGAGCCCCGAGCTGG + Exonic
1166857978 19:45792694-45792716 CTCCGCGCAGTCCCCCATGGCGG + Exonic
1166888000 19:45973283-45973305 CTTGGTGCAGACCACCTCGGGGG + Exonic
927283686 2:21334616-21334638 GGTCATGCAGACCTCCGTGGTGG - Intergenic
927295649 2:21449999-21450021 CTTCGTGCAAAGCACCGTGCTGG - Intergenic
935150189 2:100427102-100427124 CTTGGTGCAGATCCCTATGGGGG + Intergenic
938015726 2:127865490-127865512 CTTCATCCAGACCCCAGTAGCGG - Intronic
948873506 2:240815665-240815687 CACCGTGCTGGCCCCCGTGGGGG + Intronic
1171302370 20:24074868-24074890 CTTGGTTCAGACCCATGTGGTGG - Intergenic
1175822684 20:61918784-61918806 CTCCCTGCAGACCCTCCTGGAGG + Intronic
1176411213 21:6450522-6450544 CTTCGACCAGGCGCCCGTGGTGG - Intergenic
1179686706 21:43058844-43058866 CTTCGACCAGGCGCCCGTGGTGG - Exonic
1179716673 21:43292037-43292059 CTTCGGGCAGACCCCCTTCCCGG - Intergenic
960574754 3:119218606-119218628 CTGAGTGCAGAGCCCCGTGAAGG + Intronic
966474247 3:180325537-180325559 CTTGGTGCAGATCCCTGTGGGGG + Intergenic
985660828 5:1155833-1155855 CTTCGTGGTGACCCCCGCGGCGG - Intergenic
985965360 5:3335462-3335484 CCTCCTGCAGCCCCCCGTTGTGG - Intergenic
1006379770 6:33690778-33690800 CTAAGTGCAGACCTCCCTGGAGG + Intronic
1011179285 6:84601531-84601553 CTTCCTGCAGAGCCACATGGCGG - Intergenic
1012840405 6:104322533-104322555 CTGTGTGCAGTCCCCTGTGGCGG - Intergenic
1026092198 7:67309598-67309620 CTTCGTGCAGACTCAGTTGGAGG - Intergenic
1026482359 7:70790042-70790064 CTACGTGCGGACCCCGGTGGTGG + Exonic
1034885275 7:154794180-154794202 CTTCGTGCAGACCCCCGTGGTGG - Exonic
1056606471 9:88089853-88089875 CTTCGTGCAGACTCCCACAGTGG - Intergenic
1058055231 9:100442298-100442320 CTTCCTGCAGAGCCCCCCGGAGG + Exonic
1059476639 9:114552757-114552779 CTTCTTGCAGACACCCCAGGTGG - Intergenic
1059506553 9:114804476-114804498 CTTCCTTCAGACCCCAGTGCAGG + Intronic