ID: 1034885277

View in Genome Browser
Species Human (GRCh38)
Location 7:154794183-154794205
Sequence TACCTTCGTGCAGACCCCCG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885277_1034885281 -10 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885281 7:154794196-154794218 CACGAAGGTACGCGGGGCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 68
1034885277_1034885283 -8 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885283 7:154794198-154794220 CGAAGGTACGCGGGGCTGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 78
1034885277_1034885291 22 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885291 7:154794228-154794250 GGAGACGGGTGAAGAACCGATGG 0: 1
1: 0
2: 0
3: 7
4: 103
1034885277_1034885290 8 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885290 7:154794214-154794236 TGTGGGGGTGGAGGGGAGACGGG 0: 1
1: 2
2: 18
3: 158
4: 1390
1034885277_1034885288 1 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885288 7:154794207-154794229 GCGGGGCTGTGGGGGTGGAGGGG 0: 1
1: 0
2: 14
3: 181
4: 1484
1034885277_1034885287 0 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885287 7:154794206-154794228 CGCGGGGCTGTGGGGGTGGAGGG 0: 1
1: 0
2: 4
3: 60
4: 695
1034885277_1034885284 -7 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885284 7:154794199-154794221 GAAGGTACGCGGGGCTGTGGGGG 0: 1
1: 0
2: 0
3: 11
4: 145
1034885277_1034885285 -4 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885285 7:154794202-154794224 GGTACGCGGGGCTGTGGGGGTGG 0: 1
1: 0
2: 2
3: 37
4: 429
1034885277_1034885282 -9 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885282 7:154794197-154794219 ACGAAGGTACGCGGGGCTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 43
1034885277_1034885286 -1 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885286 7:154794205-154794227 ACGCGGGGCTGTGGGGGTGGAGG 0: 1
1: 0
2: 7
3: 79
4: 866
1034885277_1034885289 7 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885277 Original CRISPR TACCTTCGTGCAGACCCCCG TGG (reversed) Exonic
900612750 1:3551272-3551294 CTCCTGCGTGCAGACCCCAGGGG + Intronic
901192653 1:7421828-7421850 TACCCTCCTGCAGGCCCACGGGG + Intronic
901646881 1:10721623-10721645 CACCCTCGTCCAGCCCCCCGTGG - Intronic
912804411 1:112744061-112744083 TTCCTTCGTGGAGTCGCCCGGGG - Intergenic
918419631 1:184351479-184351501 TACTTTCATGCAGACCCATGTGG + Intergenic
1071283745 10:84125593-84125615 TACCTTGGTCCAGACCACCAAGG + Intergenic
1074455586 10:113592823-113592845 TCCCTTCGTGCAGGCACCAGGGG - Intronic
1075849127 10:125573473-125573495 TACTTCCCTGCAGACCCCCAGGG + Intergenic
1075894068 10:125979146-125979168 TGGCTCCGTGCTGACCCCCGGGG + Intronic
1076855659 10:133114531-133114553 TACCTTCCTCCCGACACCCGCGG + Intronic
1081853634 11:46290603-46290625 TCCCCTCCTGCAGACCCCAGGGG - Intronic
1082002949 11:47403752-47403774 TATCTTCCTGCTGACCCCCACGG + Intergenic
1101604390 12:106237005-106237027 TTCCTTCTTACAGTCCCCCGAGG - Intergenic
1101969103 12:109300351-109300373 TACCTTCCTGCCAACCCCCTAGG + Intronic
1118321235 14:64754522-64754544 TACCAATGTGCCGACCCCCGGGG - Intronic
1119938411 14:78615013-78615035 TACCTTCGTCAAGATCCCGGTGG - Intronic
1122857296 14:104565979-104566001 TACTTTCGCACAGACCCCTGTGG - Intronic
1141903192 16:87006177-87006199 TACCTCCCTGCAGGACCCCGGGG - Intergenic
1144573813 17:16416587-16416609 TCCCTTCGTGAAGCCCCCAGAGG + Intronic
1162647403 19:12059833-12059855 AACCTTAGTGCAGATCCCCTGGG + Intergenic
1163552668 19:17974271-17974293 TACCTTGGTGTACACCCCCCAGG - Exonic
1167689501 19:50976128-50976150 TTACTTCTGGCAGACCCCCGTGG + Intergenic
1168405626 19:56108793-56108815 TCCCCTCGGACAGACCCCCGTGG + Intronic
929907633 2:46060393-46060415 TACCTTCGTGATGACACCGGAGG + Intronic
1172165591 20:32897101-32897123 TACCTTAGGGGAGAGCCCCGCGG - Intronic
1184717155 22:46288753-46288775 TCCCCTGGTGCAGACCCCCAAGG + Intronic
986789978 5:11150072-11150094 TGCCTTCCTGCACAGCCCCGTGG - Intronic
1022624874 7:32025084-32025106 TCCCTTCATGCCGACCCCCAGGG + Intronic
1025198387 7:56948540-56948562 CCCCTTCCTGCAGCCCCCCGGGG + Intergenic
1025673563 7:63628393-63628415 CCCCTTCCTGCAGCCCCCCGGGG - Intergenic
1026482356 7:70790039-70790061 TCCCTACGTGCGGACCCCGGTGG + Exonic
1034885277 7:154794183-154794205 TACCTTCGTGCAGACCCCCGTGG - Exonic
1036793129 8:11736578-11736600 GACCTTCGTCAAGACCCCGGGGG + Intronic
1040947058 8:52894841-52894863 TCCCTTCCTTCAGAACCCCGTGG - Intergenic
1041140081 8:54808294-54808316 CACCTTCGTGCAGAGCCGCGGGG - Intergenic
1196045371 X:111250916-111250938 TACCTTCCTGCAGAATCCCCAGG - Exonic