ID: 1034885289

View in Genome Browser
Species Human (GRCh38)
Location 7:154794213-154794235
Sequence CTGTGGGGGTGGAGGGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2058
Summary {0: 1, 1: 0, 2: 19, 3: 227, 4: 1811}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885268_1034885289 27 Left 1034885268 7:154794163-154794185 CCTCACCCTCTGCGACGCCACCA 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811
1034885277_1034885289 7 Left 1034885277 7:154794183-154794205 CCACGGGGGTCTGCACGAAGGTA 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811
1034885273_1034885289 21 Left 1034885273 7:154794169-154794191 CCTCTGCGACGCCACCACGGGGG 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811
1034885275_1034885289 10 Left 1034885275 7:154794180-154794202 CCACCACGGGGGTCTGCACGAAG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811
1034885271_1034885289 22 Left 1034885271 7:154794168-154794190 CCCTCTGCGACGCCACCACGGGG 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG 0: 1
1: 0
2: 19
3: 227
4: 1811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885289 Original CRISPR CTGTGGGGGTGGAGGGGAGA CGG Intronic
Too many off-targets to display for this crispr