ID: 1034885370

View in Genome Browser
Species Human (GRCh38)
Location 7:154794581-154794603
Sequence AGCCCGCTGGGGGAGGCTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885370_1034885378 6 Left 1034885370 7:154794581-154794603 CCGACAGCCTCCCCCAGCGGGCT 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1034885378 7:154794610-154794632 GTGCGTCCCTCCCCACGTCCTGG 0: 1
1: 0
2: 3
3: 29
4: 119
1034885370_1034885379 11 Left 1034885370 7:154794581-154794603 CCGACAGCCTCCCCCAGCGGGCT 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1034885379 7:154794615-154794637 TCCCTCCCCACGTCCTGGTGAGG 0: 1
1: 0
2: 0
3: 23
4: 242
1034885370_1034885386 28 Left 1034885370 7:154794581-154794603 CCGACAGCCTCCCCCAGCGGGCT 0: 1
1: 0
2: 1
3: 23
4: 248
Right 1034885386 7:154794632-154794654 GTGAGGCCAGCCATGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885370 Original CRISPR AGCCCGCTGGGGGAGGCTGT CGG (reversed) Intronic
900117341 1:1034246-1034268 GGCCAGCCCGGGGAGGCTGTGGG + Intronic
900188996 1:1345434-1345456 AGCCAGATGGGGGAGGGTGCTGG + Intronic
900411378 1:2514237-2514259 AGCTCGCTGGGGGTGGGTGTGGG - Intronic
900431999 1:2606862-2606884 AGCCAGCTGGGGGTGGGGGTGGG + Intronic
900987287 1:6080512-6080534 AGCCCGGGGGTGGAGGCCGTCGG - Intronic
901857226 1:12052356-12052378 AGCTCGCTGAGGGTGGCTGGGGG - Intergenic
903665621 1:25005747-25005769 CTCCCGGTGAGGGAGGCTGTAGG + Intergenic
903739278 1:25549308-25549330 ACCAGGCTGGGGGAGGCTGGAGG + Intronic
903986978 1:27235175-27235197 GGGACGCGGGGGGAGGCTGTGGG + Intronic
904836216 1:33338829-33338851 AGGCCGATGGGAGAGGCTGGGGG + Intronic
905316396 1:37084228-37084250 GGCGCCCTGGGGGAGGCTGGGGG + Intergenic
905459493 1:38113430-38113452 AGCCAGCTGTGGAAGGCTGGCGG + Intergenic
905665720 1:39761860-39761882 TGCGCTCTAGGGGAGGCTGTCGG - Intronic
905934573 1:41813293-41813315 CTCCTGCTGGTGGAGGCTGTGGG - Intronic
906144440 1:43551494-43551516 AGCCAGCTCAGGGAGGCTGTAGG - Intronic
906169554 1:43712827-43712849 AGCCTGTTGGGGGAGTGTGTGGG + Intronic
906356476 1:45110328-45110350 AACTCACTGGGGGAGTCTGTAGG + Intronic
910993531 1:93079753-93079775 AGGTCGTTGGGGGAGTCTGTTGG + Intronic
914086865 1:144461613-144461635 AGCCAGCTGGCGCAGGCTATGGG - Intronic
914311744 1:146472600-146472622 AGCCAGCTGGCGCAGGCTATGGG + Intergenic
915534252 1:156525295-156525317 AGAGGGCTGGGGGAGGCTGCAGG + Intergenic
915911211 1:159916782-159916804 AGGCCTCTGGGTGAGGCTGATGG + Intergenic
916024019 1:160818706-160818728 AGCCCGCTGAGGGAAGGGGTGGG + Intronic
918515543 1:185358936-185358958 GGGCAGCTGGGGGAGGCTGCAGG - Intergenic
918852402 1:189708934-189708956 CGCCCGGTGGGGAAGACTGTGGG - Intergenic
919154795 1:193749858-193749880 GGCCTGTTGGGGGAGGCTGGTGG + Intergenic
920302493 1:204997472-204997494 TCCTCGCTGGGGGAGCCTGTGGG - Intronic
920914538 1:210249487-210249509 AGCCAGCTGAGAGAGGCAGTGGG + Intergenic
922055117 1:222034957-222034979 AGGCAGCTGGGGTAGGCTGGAGG - Intergenic
1063124571 10:3127304-3127326 AGCCCCCTGGGGCAGCCTGGCGG + Intronic
1066421139 10:35265895-35265917 AGGCCACCGGGAGAGGCTGTGGG + Intronic
1067436904 10:46284806-46284828 AGCCAGCTGGGGGTGGCTCCGGG - Intergenic
1067563886 10:47322783-47322805 AGCCCACTGGGGGTGCCTGGAGG + Exonic
1067761104 10:49047749-49047771 AGCCCTGTGGGGAAGCCTGTTGG - Intronic
1067901652 10:50247934-50247956 TGCCACCTGGGAGAGGCTGTAGG + Intronic
1069719300 10:70539531-70539553 AGGCCACTGGGGCAGGCTCTAGG - Intronic
1070812698 10:79306295-79306317 TGCCCCCTGGGGGAGGCGGGAGG - Exonic
1072537834 10:96376814-96376836 AGCCAGCTGGGGGTGGCAGGGGG + Exonic
1073146747 10:101286140-101286162 CGCCCGCTGGGGGTGGGGGTGGG + Intergenic
1073344937 10:102775982-102776004 AGCCCACTGTGGGAGGATGGTGG - Intronic
1074539673 10:114353987-114354009 AGCCCTCTGGGGTAGCCTGATGG + Intronic
1074556541 10:114496490-114496512 AGCCTGTTGGGGGAGGGTGGCGG + Intronic
1075465937 10:122650138-122650160 AGCCAGGTGGTGGAGGCTATGGG + Intergenic
1076017794 10:127042365-127042387 GGCCCCCTGGGGGAAGCAGTAGG + Intronic
1076239994 10:128897689-128897711 AGCCAAGTGGGGCAGGCTGTGGG - Intergenic
1076534205 10:131166562-131166584 AGCTCCCTGGGGGACTCTGTTGG - Intronic
1076717118 10:132371808-132371830 AGCCCTCAGGTGGAGGCCGTGGG + Intronic
1077199488 11:1298375-1298397 AGCCAGTCGGGGGAGGGTGTGGG + Intronic
1077252066 11:1565090-1565112 TGCGGGCTGGGGGAAGCTGTGGG + Intronic
1079092485 11:17490897-17490919 AGCCCCCTGGGGAAGGCAGGTGG - Intergenic
1080692823 11:34573235-34573257 AGACCACTGGAGGAGGCTGTAGG + Intergenic
1081756696 11:45549789-45549811 AGCCTGCTGGGGAAAGCTGGTGG + Intergenic
1081835393 11:46149445-46149467 GGTCAGCTGGGGCAGGCTGTGGG - Intergenic
1081909540 11:46692115-46692137 GGCCAGCTGGGGGTGGCTCTGGG + Intronic
1083230430 11:61314359-61314381 AGCCAGGTGGTGGTGGCTGTAGG - Exonic
1083796303 11:65018716-65018738 AGCCTGCTGGTGGAGGAGGTGGG + Exonic
1084490678 11:69476583-69476605 AGCCCGCTGGGGTGGGCCGCTGG + Intergenic
1084607481 11:70180990-70181012 ACCCCGATGGGGAAGGCTGAGGG - Intronic
1085258908 11:75193211-75193233 AGCACCCTGGGGAAGACTGTGGG - Exonic
1087319808 11:96644216-96644238 AGCCCGTGGTGGGAGCCTGTAGG + Intergenic
1088606752 11:111540603-111540625 ACCTCGCTGGAGGAGGCTGTCGG + Intronic
1089494327 11:118900759-118900781 AGCCTGCTGGGCGAGCCAGTGGG + Exonic
1089494726 11:118902358-118902380 AGCCCGCTGGGAGGGGCCGTGGG + Exonic
1089581714 11:119485461-119485483 AGGCCCCTGGGGGAGCCTGCGGG - Intergenic
1089767095 11:120775943-120775965 AGCCTGCCAGGGGAGGCTCTAGG - Intronic
1091291514 11:134442918-134442940 AGCCTGCTGTGGGAGGCAGCTGG + Intergenic
1091649681 12:2300819-2300841 AGGTGGCTGGGGGAGCCTGTTGG + Intronic
1092765159 12:11846440-11846462 AACCCCCTGGGAGAGGCTCTAGG + Intronic
1094207556 12:27856569-27856591 GGCCTGTTGGGGGAGGCTGGTGG - Intergenic
1094463327 12:30722420-30722442 AGTTCTCTGGTGGAGGCTGTGGG - Intronic
1096740079 12:53686784-53686806 AGCCCCCAGGAAGAGGCTGTGGG + Intergenic
1097176744 12:57147668-57147690 AGCCCGCTGGTGCAGGCAGAAGG + Intronic
1097234005 12:57527651-57527673 AGCCTGCTGGGTGAGTCTGAGGG + Exonic
1099477519 12:83125163-83125185 AGACCTCTGGGAGAGGCAGTGGG - Intronic
1102158920 12:110752998-110753020 AGCCAGCTGGGGGAAGCATTTGG + Intergenic
1103120656 12:118376874-118376896 GGACCGCTGGGGGAGGGGGTGGG + Intronic
1103556535 12:121770087-121770109 AGCCCGCTGGGTGTAGCTGTAGG + Intronic
1105370297 13:19796178-19796200 AGACCCCTGGGGGAGGGTGAAGG + Intergenic
1105701986 13:22940711-22940733 AGTCCCCTGGGGTAGGCTGAAGG + Intergenic
1109291174 13:60476943-60476965 AGCCTTCTGGTGGAGTCTGTGGG + Intronic
1112430472 13:99346328-99346350 AGATCACTGGTGGAGGCTGTGGG - Intronic
1113007403 13:105722650-105722672 AGTCCGTTGAGGGAGCCTGTAGG - Intergenic
1113104636 13:106759137-106759159 AGCCCTCTGGGACAGGCTGAGGG + Intergenic
1113104684 13:106759391-106759413 AGCCCTCTGGGACAGGCTGAGGG + Intergenic
1114474214 14:22982423-22982445 CTCCCGCTGGGGGATGCTGTGGG - Exonic
1114852840 14:26401362-26401384 ATCAGGCTGGGGGAGGCAGTTGG - Intergenic
1119618646 14:76115032-76115054 AGCCTGCTGGGTAAGGCTGCAGG + Intergenic
1119647306 14:76357010-76357032 CACCCCCTGGGGGAGGGTGTGGG + Intronic
1120834463 14:89027474-89027496 CGCCCGCTGGCGGAGACTGGGGG + Intergenic
1122126138 14:99579681-99579703 AGCTCCCTGGGGGAGGCAGCGGG + Intronic
1202848668 14_GL000225v1_random:1951-1973 AGCCCGGTGGAGGGGGCTGGGGG - Intergenic
1124890419 15:33727023-33727045 AACCCTCTGAGGGAGGCTGATGG + Intronic
1125722287 15:41851093-41851115 AGCCCGGTGTGAGAGGCTGCGGG - Exonic
1126877116 15:53055605-53055627 GGCCTGTTGGGGGAGGCTGGAGG + Intergenic
1130649982 15:85756974-85756996 AGCCAGGTGGAGGAGGCAGTTGG + Intergenic
1130803905 15:87298204-87298226 AGTCAGCAGGGGTAGGCTGTAGG - Intergenic
1131106240 15:89736759-89736781 TGGCAGCTGGAGGAGGCTGTTGG + Intronic
1131183759 15:90257979-90258001 AGGCCACTGGGCCAGGCTGTAGG - Intronic
1132547464 16:539966-539988 AGCCGCCTGGGGTAGGCTGAGGG - Intronic
1132668093 16:1090994-1091016 ACCCTCCTGGGGCAGGCTGTGGG + Intronic
1135949351 16:26898738-26898760 AGCCTGCTGGGTGATGGTGTTGG - Intergenic
1137282864 16:46992824-46992846 AGCTCGCTGGGTGCGGCTGCAGG - Intergenic
1137285279 16:47010579-47010601 AGGGCCCTGGGGGAGGCTGCAGG + Intergenic
1138341460 16:56292101-56292123 AGCCTGCTGGGGAACGCTGATGG - Intronic
1139513632 16:67440997-67441019 GCCCCACTGGGGCAGGCTGTGGG - Intronic
1141664103 16:85457068-85457090 TGCCTGCTCGGGGTGGCTGTGGG + Intergenic
1142009874 16:87708509-87708531 AGGCAGGTGGGGGAGGCTGCGGG + Intronic
1142263469 16:89053095-89053117 AGACCGTTGGGGGAGGCGGGGGG - Intergenic
1143425236 17:6831170-6831192 AGCCAGCTGGCAGAGGCTGTCGG + Intronic
1146469316 17:33111492-33111514 CGCCCACTGGGGGAAGCTGGAGG - Intronic
1147255018 17:39176228-39176250 AGCAAGCTGGGGAAGGCTGCTGG + Intronic
1147971236 17:44219918-44219940 AGCCCGCCCGGGCAGGCTGTGGG - Intronic
1148779532 17:50113521-50113543 AGTGGGCAGGGGGAGGCTGTAGG - Intronic
1151749178 17:76027107-76027129 TGCCTGCTGGGGGAGCCTTTGGG + Exonic
1151903726 17:77034532-77034554 GGCCAGCTGGGGGAGGCGCTGGG - Intergenic
1152011521 17:77721813-77721835 AGCCCTTCGGGGGAGGCAGTGGG + Intergenic
1152272902 17:79335615-79335637 AGCCAGATGGCGGAGGCTGGGGG - Intronic
1152797150 17:82314107-82314129 AGGCAGCTGGATGAGGCTGTGGG + Intergenic
1153675937 18:7455527-7455549 AGCCATCTGGGAGGGGCTGTGGG + Intergenic
1157189418 18:45568189-45568211 AGCCTGCTGGGGATGGCAGTGGG - Intronic
1160441920 18:78899546-78899568 AGCCCGCAGGGGGAGGGGGGTGG - Intergenic
1161062029 19:2219997-2220019 AGCTGGCTGGGGGAGGCCGCCGG - Intronic
1161522043 19:4730107-4730129 AGCCCGCTGGGGAGGGGTGTGGG - Intergenic
1161583002 19:5090917-5090939 AGCCCGGTGGGGGCAGCTGGAGG + Intronic
1161684584 19:5696501-5696523 AGCCTGCTGGGCGTGGCTGTGGG + Intronic
1162501301 19:11055529-11055551 AGCCTGATGGAGGTGGCTGTTGG + Intronic
1163695190 19:18760355-18760377 TGCCCGCTGGGTCAGCCTGTCGG - Intronic
1163785797 19:19274339-19274361 AGACAGCTGTGAGAGGCTGTGGG + Intergenic
1165928344 19:39341401-39341423 AGGCAGCTGGGGGAGGGGGTGGG - Intronic
1165928933 19:39343544-39343566 AGGCCTCTGGGGGAGACTTTTGG - Intronic
1166048327 19:40242633-40242655 GGCCCGCTGCTTGAGGCTGTTGG + Exonic
1166768470 19:45266160-45266182 AGTCCACTGAGGGAGGCTGAGGG + Intronic
1167593901 19:50417708-50417730 AGCCCGCTGCGGGAGGGGGCGGG + Intronic
1167608911 19:50496798-50496820 AGCCAGCTGGGGAGGCCTGTGGG - Intergenic
1167664100 19:50813266-50813288 TGCTGGCTGGTGGAGGCTGTTGG + Intergenic
1167687190 19:50963646-50963668 ACCCAGCTGGGGAAGACTGTGGG - Intronic
1168133824 19:54337551-54337573 AGGGCGCTGGGGGAGGCCATCGG + Exonic
1168207972 19:54866277-54866299 AACCCACAGGGGGAGGCTGTAGG - Intronic
1168221646 19:54964747-54964769 AGCCGGCAGGCGGAGGCTGCGGG + Intronic
1168221811 19:54965837-54965859 AGCCGGCAGGCGGAGGCTGCGGG + Intronic
1168249882 19:55135864-55135886 AGCCCTCTGGGGGGCGCTGTGGG - Intronic
1168350650 19:55674069-55674091 AGGCGGCTGGGGGAGGGTGGGGG + Exonic
1168691552 19:58380667-58380689 AGCCCGCGAGGGGAGGCTCCAGG - Intronic
925737456 2:6976247-6976269 AACCCTGTGGGGGAGGCTGTAGG - Intronic
925904938 2:8534799-8534821 ATCCCGCAGCGGGTGGCTGTGGG - Intergenic
925919544 2:8629474-8629496 AGCCTGCTGGGTGAGGCGGTGGG - Intergenic
926483702 2:13429873-13429895 AGCCTGTTGGGGGAGGATTTTGG + Intergenic
927459636 2:23286962-23286984 AGCAGGCTGGGTCAGGCTGTGGG - Intergenic
931441497 2:62293636-62293658 AGCAGGCTGGGGCAGGCTGAAGG + Intergenic
933807788 2:86012503-86012525 AGCCCCCTGGGGACGGCTGCAGG - Intergenic
934016911 2:87897625-87897647 GGCCAGTTGGGGGAGACTGTTGG - Intergenic
937069966 2:119055744-119055766 AGGCCACAGGTGGAGGCTGTGGG - Intergenic
940157145 2:150669512-150669534 AGCTTTCTGGGGGAGGCTTTAGG - Intergenic
940293333 2:152098688-152098710 CATCCGCTGGGGGAGGCTGCGGG + Intronic
942072731 2:172330054-172330076 AGCCTGCTTGGGGAGGCTTGGGG - Intergenic
942681021 2:178478653-178478675 AGCCCGCTGCGGGAGGCGGAGGG - Intergenic
945195227 2:207231339-207231361 GGCCTCCTTGGGGAGGCTGTAGG - Intergenic
947743868 2:232497654-232497676 AGGGCGCAGGGGGAGGCTGGGGG + Intergenic
947918645 2:233850908-233850930 TGGAGGCTGGGGGAGGCTGTGGG - Intronic
948634878 2:239328653-239328675 TGCTCGCTGGGGGAGGATGCCGG - Intronic
1171112261 20:22494933-22494955 AGCCCTCTGGGAGATGCTGAGGG + Intergenic
1172185997 20:33031428-33031450 AGCTAGCTGGGGGTGGCTGGAGG + Intergenic
1173069867 20:39753031-39753053 AGCCAGCAGGGGTAGGCTGGTGG - Intergenic
1174147830 20:48464438-48464460 AGGCCCCTTGAGGAGGCTGTTGG + Intergenic
1174321833 20:49748109-49748131 AGGCCGCTCTGTGAGGCTGTGGG - Intergenic
1174411476 20:50339470-50339492 AGGCAGCTGGGGGTGGCTGAGGG + Intergenic
1175268987 20:57720439-57720461 AGCCCGCGGGGGGGGGGTGGGGG + Intergenic
1175415353 20:58797223-58797245 GGGCCGCAGGGCGAGGCTGTGGG + Intergenic
1175513102 20:59547933-59547955 AAGCAGTTGGGGGAGGCTGTGGG - Intergenic
1175793514 20:61757239-61757261 AGCCCCCTGGAGGGGGCTGGGGG - Intronic
1175846921 20:62064543-62064565 ATCCCGCTGGTGGTGGCCGTGGG + Exonic
1175926935 20:62475755-62475777 AGCCCGGTCGGGGAGGAGGTGGG - Intronic
1175945116 20:62555085-62555107 AGGCCCCTGGGGTGGGCTGTGGG - Intronic
1175959251 20:62626674-62626696 TGCCCTCTGGGTGAGGCTGCTGG - Intergenic
1176285081 21:5015224-5015246 GGGCAGCTGGGAGAGGCTGTGGG - Intergenic
1176722042 21:10401227-10401249 AGCCAGCCTCGGGAGGCTGTCGG + Intergenic
1179591492 21:42412228-42412250 AGCCCCGTGGGCAAGGCTGTCGG + Intronic
1179872100 21:44248251-44248273 GGGCAGCTGGGAGAGGCTGTGGG + Intronic
1181100093 22:20533159-20533181 CACCCGCTGCGGGAGGCTGCAGG - Intronic
1182432583 22:30309010-30309032 AGTTCCCTGGGGAAGGCTGTGGG + Intronic
1182516267 22:30860783-30860805 TGCCGGCTGGAGGAAGCTGTGGG + Intronic
1183062653 22:35345563-35345585 GGCCCGCTGTGCCAGGCTGTGGG - Intronic
1183466814 22:37984210-37984232 ACCCCGTTGGGGCAGGCTGAGGG - Intronic
1184021771 22:41826074-41826096 AGACTGCTGGGGGAGGCAGGAGG + Exonic
1184718139 22:46293533-46293555 AGCCCCCTGGGGGGCTCTGTTGG + Exonic
1185318596 22:50189958-50189980 AGGCAGCTGGGAGAGGCTCTGGG + Intronic
949936262 3:9118648-9118670 AGCCCCCTGGGGGAGTCTGTTGG - Intronic
950187836 3:10956343-10956365 TGCATGCTGGGAGAGGCTGTGGG - Intergenic
950521786 3:13501794-13501816 AGCCAGCTGGGAGTTGCTGTAGG + Intronic
950548917 3:13654942-13654964 TGCCCACTGGGGCAGGATGTGGG + Intergenic
951606285 3:24438674-24438696 AGCCTGCTGGGGGATGCTCCTGG + Intronic
953363546 3:42322326-42322348 AGCCCGCTGTGGGAGGAAGCTGG + Intergenic
953908961 3:46882392-46882414 CGCTGGCTTGGGGAGGCTGTCGG + Intronic
954121111 3:48500727-48500749 AACCCGCTTGTGGAGCCTGTAGG - Intronic
954294545 3:49666881-49666903 AGCCCGCTGTGGGAGGGTGAAGG - Intronic
954656235 3:52195918-52195940 AGCCCTGTGGGGGTGGCGGTTGG - Intergenic
955977585 3:64492975-64492997 AGCTCTATGGGGGAGGCTTTGGG + Intergenic
956414432 3:69012610-69012632 AGGCGGCTGGGGGTGGCTGCTGG + Exonic
961201855 3:125051863-125051885 AGCCAGCTGGGCGGGGCTGCTGG + Intronic
961535302 3:127567039-127567061 AGCCGGCTCCGGGAGGCTCTGGG - Intergenic
962318018 3:134370870-134370892 GGCCAGCTGTGGGAAGCTGTGGG + Exonic
962435325 3:135361199-135361221 GTCCAGCTGTGGGAGGCTGTGGG + Intergenic
962520486 3:136194417-136194439 AGCGAGCCGGGGAAGGCTGTTGG - Intronic
969085768 4:4655296-4655318 AGCCTGCTTGGGGAGGTGGTTGG + Intergenic
969302102 4:6303138-6303160 AACCCTGTGGGGGCGGCTGTGGG + Exonic
971481608 4:27119677-27119699 ATCCCTCTGGGAGAGGCTGGAGG - Intergenic
978749645 4:112232178-112232200 AGCCCGCTGGGGGAGGGGCCCGG + Intronic
980022932 4:127730798-127730820 AGGGCGCCGGGAGAGGCTGTCGG - Intronic
985177147 4:187214248-187214270 TGCAAGCTGGGTGAGGCTGTAGG + Intergenic
985574833 5:669249-669271 CGCCCCCTGGGGGATGCTGCTGG - Intronic
985980231 5:3456577-3456599 TGCCAGCTGGGCGAGTCTGTGGG + Intergenic
986259928 5:6135059-6135081 AGCCCTCTGGGGTAGGGGGTGGG + Intergenic
986266031 5:6191116-6191138 AGCCTGCAGGGAGAGGCTGCAGG - Intergenic
986372831 5:7097933-7097955 AGCCAGCTGGGGGGGCCTGCTGG - Intergenic
987192848 5:15497036-15497058 AGCCAGGTGGGGGTGGGTGTTGG + Intergenic
988977546 5:36529883-36529905 GTCCAGCTGGGGGAGGCTGCAGG - Intergenic
990509976 5:56481161-56481183 AGCCAGCTGGTGGGGGCCGTGGG - Intronic
991020743 5:61977596-61977618 AGCTGGCTGGGGGAGAATGTGGG - Intergenic
991271702 5:64791070-64791092 AGGCAGCTGGGGAAGGCAGTTGG + Intronic
993161203 5:84293701-84293723 TGCCAGCTGTGGGAGGCTGGGGG + Intronic
993944148 5:94097763-94097785 AAGCAGTTGGGGGAGGCTGTGGG - Intronic
994511568 5:100710016-100710038 AACTGGCTGGGGGAGGTTGTTGG - Intergenic
995799530 5:115979060-115979082 AGCCACCTGGAGGAGGCTGGAGG - Intronic
999370568 5:151052564-151052586 AGTCAGCTGGGGGAGGCTGGTGG - Intronic
1001294715 5:170490843-170490865 AGCCCACTCTGTGAGGCTGTAGG + Intronic
1001426441 5:171625677-171625699 AGCCCAGTGAGGAAGGCTGTGGG + Intergenic
1001650928 5:173315863-173315885 AGCCCGGTGGCGGGGGCTGGAGG + Exonic
1006151375 6:31991960-31991982 AGCCCTCTGGGTGGGGCTGGGGG + Intronic
1006157676 6:32024698-32024720 AGCCCTCTGGGTGGGGCTGGGGG + Intronic
1006217728 6:32459728-32459750 AGCACCCTGTGGGAGGGTGTAGG - Intergenic
1006521067 6:34571579-34571601 ACCCCCCTGGGGCAGGCTGTTGG - Intergenic
1012977848 6:105799278-105799300 AGACCTCTGTGGGAGGATGTGGG - Intergenic
1016996935 6:149967353-149967375 GGCTCTCTGGGGGAGGCTGAGGG + Intronic
1017001874 6:150002899-150002921 GGCTCTCTGGGGGAGGCTGAAGG - Intergenic
1019336377 7:484895-484917 TGACTGCTGGCGGAGGCTGTCGG - Intergenic
1019598460 7:1869285-1869307 AGGCCTCTGGGAGAGGCTGTGGG - Intronic
1019723602 7:2588131-2588153 AGCCCGCCTGTGCAGGCTGTGGG + Intronic
1019995090 7:4718884-4718906 ACCCCGGAGGCGGAGGCTGTGGG - Intronic
1022902364 7:34823834-34823856 AGCCCTCTGGGGGTCACTGTGGG - Intronic
1023856785 7:44188985-44189007 AGCCTACTGGGGAAGGCTGAGGG - Intronic
1030100890 7:105944285-105944307 AGCCAGATGGGGGACGCTGAGGG + Intronic
1030398261 7:109015880-109015902 AGCCTGCTGGGGGAGGATGGTGG - Intergenic
1032000598 7:128262730-128262752 GGCCAGCTGGGGCAGGCTGTGGG + Intergenic
1032202571 7:129832541-129832563 GACCTGCTGGGGGAGGTTGTAGG - Exonic
1034885370 7:154794581-154794603 AGCCCGCTGGGGGAGGCTGTCGG - Intronic
1036640232 8:10578958-10578980 GCCACGCTGGGGGAGTCTGTTGG + Intergenic
1037390733 8:18388934-18388956 ACCACCCTGTGGGAGGCTGTAGG + Intergenic
1037759030 8:21729756-21729778 AGCCCTTTGGGGGTGGCGGTGGG - Intronic
1037960279 8:23092670-23092692 AGAACCCCGGGGGAGGCTGTGGG - Intronic
1040339760 8:46434593-46434615 AGCCTGCCGGGGAAGGCTTTGGG + Intergenic
1040567803 8:48582668-48582690 AGGCCGGTGGGGGAGGAAGTTGG + Intergenic
1041567391 8:59294765-59294787 AGATGGCTGGGGAAGGCTGTGGG - Intergenic
1043476178 8:80608136-80608158 AGCTCGCTGGAGCAGGCTGGAGG - Intergenic
1045343252 8:101272715-101272737 AGGCCCCTGAGGGAGGCTGATGG - Intergenic
1046628311 8:116598610-116598632 AGGCCGCTGGCGGAGGCAGCTGG - Intergenic
1047406452 8:124589568-124589590 TGCACGCTGGGGGGCGCTGTGGG - Intronic
1049911428 9:272251-272273 AGCGCGCTGGGGAACGCTTTAGG - Intronic
1051221400 9:14852088-14852110 AGGCGGCTGGAGGAGGTTGTTGG - Intronic
1051946684 9:22577758-22577780 AGCCTGTTGGGGGATGGTGTTGG + Intergenic
1053446154 9:38154733-38154755 AGCCCTCTGGGGGAGGGTAGGGG + Intergenic
1055532024 9:77194124-77194146 AAGCCGTCGGGGGAGGCTGTGGG + Intronic
1056791220 9:89626586-89626608 AGCCCACTGAGTTAGGCTGTGGG - Intergenic
1059284503 9:113161238-113161260 AGCCTGCTGGGGGAGTGGGTGGG + Intronic
1059419214 9:114180722-114180744 AGCCAGGTGGGGGAGGCTCTGGG - Intronic
1060748249 9:126151884-126151906 AGGCAGCTCAGGGAGGCTGTGGG - Intergenic
1062311438 9:135939781-135939803 AGCTCGCTGGGGGCGGCAGGAGG + Intronic
1062538159 9:137029948-137029970 GGCCGTCTGGCGGAGGCTGTAGG + Intronic
1186476590 X:9862471-9862493 AGCTGGCTGGGGGTGTCTGTGGG + Intronic
1196607771 X:117675032-117675054 AAGCTGTTGGGGGAGGCTGTGGG - Intergenic
1199127572 X:144140920-144140942 GGCCAGTTGGGGGAGACTGTTGG + Intergenic
1200154910 X:153970229-153970251 AGCCCGCTGGGTAACGGTGTGGG + Intronic
1200714308 Y:6520376-6520398 TGGCCGCAGGGGGAGGCTGGCGG + Intergenic
1201019514 Y:9640781-9640803 TGGCCGCAGGGGGAGGCTGGCGG - Intergenic