ID: 1034885452

View in Genome Browser
Species Human (GRCh38)
Location 7:154795042-154795064
Sequence TCCGCCCCAGGTTAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 39}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885452_1034885458 10 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885458 7:154795075-154795097 TTCTGATGAGCTTGCTTGAGGGG 0: 1
1: 1
2: 0
3: 16
4: 142
1034885452_1034885460 18 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885460 7:154795083-154795105 AGCTTGCTTGAGGGGAAGGAAGG No data
1034885452_1034885456 8 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885456 7:154795073-154795095 TATTCTGATGAGCTTGCTTGAGG 0: 1
1: 0
2: 0
3: 25
4: 182
1034885452_1034885461 27 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885461 7:154795092-154795114 GAGGGGAAGGAAGGAACGTGAGG No data
1034885452_1034885457 9 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885457 7:154795074-154795096 ATTCTGATGAGCTTGCTTGAGGG No data
1034885452_1034885459 14 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885459 7:154795079-154795101 GATGAGCTTGCTTGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885452 Original CRISPR TCCGCCCCAGGTTAGATAAA AGG (reversed) Intronic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
924791457 1:247253734-247253756 TGCGCCCGAGGTTAGTGAAAGGG - Intergenic
1066406007 10:35119086-35119108 TCCATCCAATGTTAGATAAAAGG - Intergenic
1067726244 10:48773442-48773464 TCCTTCCCAGGCTGGATAAAGGG - Intronic
1070281330 10:75050996-75051018 TCCATCCCAGGTTAGCTCAAGGG - Intronic
1094687996 12:32738426-32738448 TCTTCCACAGGTTAGATAAAAGG - Intronic
1101207402 12:102502301-102502323 TCCTTCCCAGGTTTGCTAAAGGG - Intergenic
1104093729 12:125537488-125537510 TCCGCCCCAGGTGACTTAGAAGG - Intronic
1105858424 13:24390565-24390587 TCCGCCCCAGCCAAGATGAAGGG - Intergenic
1106200186 13:27529559-27529581 TTCGCCCCAGGTTTTCTAAAGGG + Intergenic
1139060528 16:63245304-63245326 TCCTTCCCATGTTAGAGAAATGG + Intergenic
1141698879 16:85633367-85633389 TCTGCCCCACGTTACAGAAAAGG - Intronic
1149290665 17:55215052-55215074 TCCGCCTCCTGTTAGATAAGTGG - Intergenic
1159249260 18:65852531-65852553 TGTGCCCCAGGTGAGAGAAAGGG + Intronic
927026152 2:19071165-19071187 GCCGCCCCAGTTTAGACAAGGGG + Intergenic
927229760 2:20810788-20810810 TCCGCCTCATGTTAGATCAGTGG + Intronic
928161997 2:28936313-28936335 TCAGCAGCATGTTAGATAAATGG - Intronic
930406041 2:50956867-50956889 TCAGCCCCAGTTTACATACACGG + Intronic
931289121 2:60856879-60856901 CCAGGCCCAGGTTAGATAATTGG + Intergenic
936992847 2:118384274-118384296 GCTGCCCCAGGTGAGATAACAGG - Intergenic
941253614 2:163199321-163199343 TACTGCACAGGTTAGATAAATGG + Intergenic
941511740 2:166419093-166419115 TCTGCCCCAATTTAGAGAAAAGG - Intronic
946870256 2:224078525-224078547 TCCGCCCCATGTCACATAGATGG + Intergenic
1169022133 20:2338133-2338155 TCAGTACCAGGTTAGATAATGGG - Intronic
1169475256 20:5925125-5925147 TCTGCCCTTGGGTAGATAAATGG - Exonic
1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG + Intronic
1184773220 22:46610031-46610053 TACGGCCCAGGTTGGATAAGAGG + Intronic
954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG + Intronic
957249493 3:77755379-77755401 TCTTCCACAGGTTAGACAAAAGG - Intergenic
973924213 4:55720579-55720601 TCAGCTCCAGGTAAGATAAATGG - Intergenic
979613907 4:122719779-122719801 TCAAGCCCAGGTTAGATGAAGGG + Intergenic
985000692 4:185479571-185479593 TCGGCCCCATGTCAGATAGAGGG + Intergenic
992407643 5:76475108-76475130 CCCACCCCAGCTTAGAAAAAAGG + Intronic
995366850 5:111371540-111371562 TCAGCCCCATGTTAAATAATTGG - Intronic
997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG + Intergenic
1004305401 6:14497456-14497478 TCTGCCCAAGGTGAGATAAAAGG - Intergenic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1040571083 8:48611467-48611489 TTCGCCCTCGGTTAGATACACGG - Intergenic
1047983128 8:130204130-130204152 TCCGCCTCCTGTTAGATCAAGGG + Intronic
1050607411 9:7315975-7315997 TCAGCCCTGGGTGAGATAAAGGG + Intergenic
1055719471 9:79155595-79155617 TCCACTCCAGGTATGATAAAAGG - Intergenic
1062571375 9:137187158-137187180 TCCTCCCCAGGATCGACAAAAGG + Intronic
1187730243 X:22245395-22245417 TCCCCCTCAGTTTAGGTAAATGG + Exonic
1199374572 X:147091737-147091759 TCTGCACCAGGTGATATAAAAGG + Intergenic