ID: 1034885452

View in Genome Browser
Species Human (GRCh38)
Location 7:154795042-154795064
Sequence TCCGCCCCAGGTTAGATAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885452_1034885460 18 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA No data
Right 1034885460 7:154795083-154795105 AGCTTGCTTGAGGGGAAGGAAGG No data
1034885452_1034885458 10 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA No data
Right 1034885458 7:154795075-154795097 TTCTGATGAGCTTGCTTGAGGGG 0: 1
1: 1
2: 0
3: 16
4: 142
1034885452_1034885456 8 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA No data
Right 1034885456 7:154795073-154795095 TATTCTGATGAGCTTGCTTGAGG 0: 1
1: 0
2: 0
3: 25
4: 182
1034885452_1034885459 14 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA No data
Right 1034885459 7:154795079-154795101 GATGAGCTTGCTTGAGGGGAAGG No data
1034885452_1034885457 9 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA No data
Right 1034885457 7:154795074-154795096 ATTCTGATGAGCTTGCTTGAGGG No data
1034885452_1034885461 27 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA No data
Right 1034885461 7:154795092-154795114 GAGGGGAAGGAAGGAACGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885452 Original CRISPR TCCGCCCCAGGTTAGATAAA AGG (reversed) Intronic