ID: 1034885456

View in Genome Browser
Species Human (GRCh38)
Location 7:154795073-154795095
Sequence TATTCTGATGAGCTTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885452_1034885456 8 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885456 7:154795073-154795095 TATTCTGATGAGCTTGCTTGAGG 0: 1
1: 0
2: 0
3: 25
4: 182
1034885454_1034885456 -4 Left 1034885454 7:154795054-154795076 CCTGGGGCGGATTCCAGGCTATT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1034885456 7:154795073-154795095 TATTCTGATGAGCTTGCTTGAGG 0: 1
1: 0
2: 0
3: 25
4: 182
1034885448_1034885456 13 Left 1034885448 7:154795037-154795059 CCTGACCTTTTATCTAACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1034885456 7:154795073-154795095 TATTCTGATGAGCTTGCTTGAGG 0: 1
1: 0
2: 0
3: 25
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885456 Original CRISPR TATTCTGATGAGCTTGCTTG AGG Intronic
909618028 1:77634683-77634705 TATTCTGGTGTGGATGCTTGAGG + Intronic
910754014 1:90666614-90666636 ATTTCTGATTAGCATGCTTGAGG - Intergenic
911250634 1:95572574-95572596 TGATCTCATGAGCTTGCTTAGGG + Intergenic
912368740 1:109156630-109156652 TATTCTGTGGAGTTTGGTTGGGG + Intronic
915907074 1:159886767-159886789 TATACTGCTGAGCATGCTGGAGG + Intronic
916456347 1:164974721-164974743 TCTTCTGCTGGCCTTGCTTGGGG + Intergenic
918978089 1:191516977-191516999 TTTACTGATGAGCTTTCATGTGG + Intergenic
919193534 1:194253987-194254009 TATTTTAATTAGCTTGATTGTGG + Intergenic
921127757 1:212193004-212193026 TATGTTGATTAGCTTGATTGTGG - Intergenic
922250801 1:223846724-223846746 CATTCTGAGGAGCTTCCCTGGGG + Intergenic
923385058 1:233457836-233457858 TATGTTAATTAGCTTGCTTGTGG - Intergenic
924853449 1:247853807-247853829 TTTTCTCATGAGCTTTCTTTTGG - Intergenic
1062996477 10:1871204-1871226 TGCTCTGAAGAGCTTGCCTGTGG + Intergenic
1063834677 10:9999110-9999132 TCTTCTTATAACCTTGCTTGAGG + Intergenic
1068502943 10:57863275-57863297 CATTCTGATTAGCTTGATTGTGG + Intergenic
1068888636 10:62125167-62125189 CATTCTAATGAGTTTGCTTGTGG - Intergenic
1069118804 10:64541984-64542006 TATACTAATAAGCTTGATTGTGG + Intergenic
1069224127 10:65920513-65920535 GATTCGGATGATCTTGGTTGAGG + Exonic
1069967481 10:72132912-72132934 TATTCTGATGAGCATAGTAGAGG - Intronic
1070070658 10:73086125-73086147 TATTCTGTTCAGCTTTTTTGAGG - Intronic
1071000656 10:80827546-80827568 TACCCTGCTGAGCTTGCTTCTGG + Intergenic
1078160289 11:8834125-8834147 TATCCAGATGTTCTTGCTTGGGG - Intronic
1079602909 11:22331773-22331795 TATTCTTTTGTGCCTGCTTGTGG - Intergenic
1079653844 11:22964281-22964303 TAGTCTGATGGGCTTCCTTTTGG + Intergenic
1081148811 11:39600998-39601020 TATTTTTATTAGCTTGATTGTGG + Intergenic
1081353132 11:42080066-42080088 CTTTCTGAAGAGATTGCTTGAGG + Intergenic
1082267445 11:50134784-50134806 TGTTCTGCTGATCTTGCTCGGGG + Intergenic
1082288642 11:50343782-50343804 TGTTCTGCTGATCTTGCTCGGGG - Intergenic
1085678728 11:78550407-78550429 TATTCTGATGAGCTGACCTGAGG - Intronic
1086349057 11:85926355-85926377 TAGTCTGATGAGCTTCCCTTTGG - Intergenic
1086476272 11:87178231-87178253 TATGCTGATGAGGTTGCTCATGG - Intronic
1089579407 11:119471956-119471978 TATTCTGATGTCCTGGCTAGGGG - Intergenic
1093230002 12:16532275-16532297 TATTCTTGTTTGCTTGCTTGGGG + Intronic
1098118842 12:67212861-67212883 TATTCTAATGCTATTGCTTGGGG - Intergenic
1098285965 12:68907221-68907243 TACTCTGATGAGCCTTCATGAGG - Intronic
1107144540 13:37044428-37044450 TATTCTGATTATTTTGCTTTGGG - Intronic
1107179225 13:37438725-37438747 TATGCTAATTAGCTTGATTGTGG - Intergenic
1109662469 13:65481744-65481766 TACGCTGATTAGCTTGATTGTGG - Intergenic
1110120800 13:71879212-71879234 TATTATGTTCAGCTTGCTTGTGG - Intergenic
1110359088 13:74605341-74605363 TATTTTGATAGGCATGCTTGGGG - Intergenic
1111815023 13:93141462-93141484 TATGTTGATCAGCTTGATTGTGG - Intergenic
1111830812 13:93326656-93326678 TATTTTGTTGACTTTGCTTGTGG + Intronic
1112594050 13:100791737-100791759 CATTCTGATTTACTTGCTTGAGG + Intergenic
1113284290 13:108829537-108829559 TACTCTGATGAGGTTGTGTGGGG + Intronic
1115744917 14:36426940-36426962 TTTTCTGCTGATCTTGCCTGGGG + Intergenic
1118515440 14:66523319-66523341 TATTCTTCTAAGCTTGATTGTGG - Intronic
1118908348 14:70040291-70040313 TATACTAATCAGCTTGATTGTGG + Intergenic
1120938126 14:89918751-89918773 AACTCTAATGAGCTGGCTTGGGG + Intronic
1122444196 14:101757410-101757432 TATTCAGCTGAGCTTCCTAGGGG - Intergenic
1125999868 15:44198535-44198557 TCTTCTCATGAGCTTTTTTGTGG - Intergenic
1130271357 15:82451098-82451120 TATTCTGATGAGATTGATGGTGG - Intergenic
1130463698 15:84178438-84178460 TATTCTGATGAGATTGATGGTGG - Intronic
1130488977 15:84416349-84416371 TATTCTGATGAGATTGATGGTGG + Intergenic
1130500568 15:84495104-84495126 TATTCTGATGAGATTGATGGTGG + Intergenic
1131963287 15:97810848-97810870 TCTTCTGCTGGTCTTGCTTGTGG - Intergenic
1133356147 16:5138373-5138395 TATTCTGATGATATAGTTTGAGG + Intergenic
1134365806 16:13578276-13578298 TATGCTCATGATCTTGATTGTGG + Intergenic
1138212686 16:55176322-55176344 CATGCTGATGAGCTCTCTTGAGG - Intergenic
1139168897 16:64606137-64606159 CTTTCTGATGAGCTTGATTGAGG - Intergenic
1139359402 16:66388165-66388187 TTTTCTGAGGAGCCTGCATGGGG - Intronic
1140571694 16:76114323-76114345 TATGTTGATTAGCTTGATTGTGG - Intergenic
1141022350 16:80509207-80509229 TATTCTGAACATCTTGCTTTTGG - Intergenic
1141328579 16:83086246-83086268 TATTTTTCTGAGTTTGCTTGGGG - Intronic
1142909470 17:3075596-3075618 TATGCTAATTAGCTTGATTGTGG - Intergenic
1144642069 17:16943127-16943149 TCTTCTGCTGCTCTTGCTTGGGG - Intronic
1145207794 17:20993983-20994005 TCTTCTGCTGCTCTTGCTTGGGG + Intergenic
1146023627 17:29300542-29300564 TATTTTTATGATCTTGGTTGGGG + Intergenic
1147475673 17:40709593-40709615 AATACTGATGAGATGGCTTGCGG + Intergenic
1147725001 17:42561624-42561646 TCCTCTGATGCGCTTGTTTGCGG - Intronic
1148495475 17:48051166-48051188 CATTCTGCTGAGTTTGATTGGGG + Exonic
1150620712 17:66806091-66806113 TACTCTGAGGACCTTGCATGGGG - Exonic
1153793510 18:8601494-8601516 CATTCTGATGTGCTTTCTTGAGG + Intergenic
1156889892 18:42178610-42178632 TGATCTGAGCAGCTTGCTTGTGG - Intergenic
1157028071 18:43871202-43871224 TATTCTGATGGGCTACCTTTAGG - Intergenic
1157296092 18:46445799-46445821 TATTCTGTTCAGCTTTCTAGTGG + Intronic
1158959309 18:62575258-62575280 TGCTCTGATGTGCTTGGTTGAGG - Exonic
1159527695 18:69614485-69614507 TATTTTAATTAGCTTGATTGTGG - Intronic
1159647661 18:70938407-70938429 AATTCTGTTGTGCTTCCTTGAGG + Intergenic
1164030865 19:21402915-21402937 TATCCTGATGTGCTAGCTTTTGG - Intronic
1165700746 19:37935562-37935584 TCTTCTGCTGGTCTTGCTTGGGG + Intronic
925396384 2:3536483-3536505 AATCCTGCTGAGCCTGCTTGGGG + Intronic
925532576 2:4881213-4881235 TCTTCTCATTAGCTTGCTTAAGG + Intergenic
926450148 2:12993594-12993616 TATGCTAATTAGCTTGATTGTGG - Intergenic
928517555 2:32058325-32058347 TCTTCTGATGGCCTTGCCTGTGG - Intergenic
929413500 2:41723788-41723810 TATTCAGATGAACTTGCAAGAGG + Intergenic
932546040 2:72711047-72711069 TATTTTGATTAGTTTGCTTTAGG - Intronic
938111503 2:128569435-128569457 TATACTAATTAGCTTGATTGTGG - Intergenic
938551508 2:132386582-132386604 TTTTCTGAGGAGCTTGCGGGTGG + Intergenic
939111593 2:138014343-138014365 TGTTATGTTGAGCCTGCTTGTGG - Exonic
939419594 2:141949037-141949059 TATTCTGAAGGGAATGCTTGTGG + Intronic
939437203 2:142193339-142193361 TAATGTGATAAGCTTTCTTGAGG + Intergenic
939470842 2:142617473-142617495 TATTCTGATGGGCTTCTCTGTGG - Intergenic
940775585 2:157880049-157880071 TATTCTGAAGAATTTGCTTCTGG - Intronic
944175588 2:196825483-196825505 TATGCTAATTAGCTTGATTGTGG + Intergenic
944795968 2:203185600-203185622 AATTCTGCTGGTCTTGCTTGAGG + Intronic
945577132 2:211545683-211545705 CATGCTAATGTGCTTGCTTGGGG + Intronic
945690390 2:213027046-213027068 GATTTTGATTAGATTGCTTGGGG - Intronic
946786976 2:223257774-223257796 TAGTCTGATGGGCTTCTTTGTGG + Intergenic
946837915 2:223790711-223790733 TATGCTAATTAGCTTGATTGTGG - Intronic
1169559583 20:6785794-6785816 TATTCAGCTGAGCTATCTTGTGG - Intergenic
1171940817 20:31327776-31327798 TATTTTAATTAGCTTGATTGTGG + Intergenic
1172455135 20:35065343-35065365 TATGCAGATGAGCTTGCTCTGGG + Intronic
1172760751 20:37319736-37319758 TATTTTAATTAGCTTGATTGTGG - Intergenic
1173751508 20:45480261-45480283 TAGTCTGATGAGCTGCATTGGGG + Intronic
1176006576 20:62867295-62867317 TATTCTGATGTGGGTGGTTGGGG - Intergenic
1176890251 21:14307943-14307965 TAATCTAATTAGCTTGATTGTGG + Intergenic
1178101313 21:29271558-29271580 TCTTCTGATGTCCTTGTTTGAGG + Intronic
1178551956 21:33548049-33548071 ATTTCTGATGAGCTTTTTTGGGG + Intronic
1181445399 22:22968780-22968802 TAGTCTGATGAGCTTCCCTGTGG - Intergenic
1184534431 22:45077061-45077083 GATGATGATGAGCTAGCTTGTGG + Intergenic
950990151 3:17426362-17426384 TCTTATAATGAGCTTACTTGTGG - Intronic
953254843 3:41279576-41279598 TAGTCTGATGGGCTTCCTTTGGG - Intronic
953814992 3:46147863-46147885 TATGTTGATTAGCTTGATTGTGG + Intergenic
955564712 3:60231692-60231714 TTTACTGATAAGCTTGTTTGGGG - Intronic
956909179 3:73799612-73799634 TGTTCTGCTGATCTTGCTTGGGG + Intergenic
957041307 3:75337495-75337517 AATTCTGATGAGCATGTATGGGG - Intergenic
958263925 3:91414931-91414953 TATTATCATGAGTTTGCTGGAGG - Intergenic
959144927 3:102533065-102533087 TATTCTGTTGCTCTTGCTTGCGG + Intergenic
962892088 3:139680825-139680847 CATTCTGGAAAGCTTGCTTGTGG + Intergenic
963072401 3:141315263-141315285 TTTTCTGATGAGCTTGGTGATGG + Intergenic
963302936 3:143618989-143619011 TGTTATGATGAGCTTGATTGTGG - Intronic
964178810 3:153858304-153858326 TATGCTAATTAGCTTGATTGTGG - Intergenic
967415411 3:189211999-189212021 TATTATGATAATCTTGGTTGTGG + Intronic
967509128 3:190289266-190289288 TGATCTGCTGAGCTTGCTTCTGG - Intergenic
969348315 4:6582867-6582889 TGTGCTAGTGAGCTTGCTTGTGG + Intronic
969386439 4:6852723-6852745 TCTTCTGCTGTTCTTGCTTGGGG + Intronic
970970931 4:21982682-21982704 TATTATGTTGAGCTTGATTGTGG - Intergenic
973013700 4:45109486-45109508 TATTCTGATGGGCTTCCCTTTGG + Intergenic
973982369 4:56316757-56316779 TATTCTCATGAACCTGCGTGTGG - Intronic
974081041 4:57212823-57212845 TATGCTAATTAGCTTGATTGTGG + Intergenic
974201426 4:58646377-58646399 ATTTCTCATGAACTTGCTTGTGG - Intergenic
974316745 4:60292358-60292380 TATTTTAATCAGCTTGGTTGTGG + Intergenic
977114899 4:93011531-93011553 TATGCTAATGAGATTGCTGGGGG - Intronic
978021705 4:103822809-103822831 AATTCTGATGATCTTGGTTTAGG - Intergenic
979416072 4:120440506-120440528 TCTTCTGATGATCTGGCTTTTGG - Intergenic
979522149 4:121679831-121679853 TATGCTGATTAACTTGATTGTGG - Intronic
981331065 4:143511301-143511323 TATGCTTATTAGCTTGATTGCGG + Intergenic
984980241 4:185273477-185273499 TATGTTAATTAGCTTGCTTGTGG - Intronic
987427945 5:17795021-17795043 TATGCTAATGAGGTGGCTTGTGG + Intergenic
991040296 5:62168435-62168457 TTTTCTGATGTGCTGGCTTGGGG - Intergenic
991776807 5:70093319-70093341 TATGTTACTGAGCTTGCTTGTGG - Intergenic
991856094 5:70968764-70968786 TATGTTACTGAGCTTGCTTGTGG - Exonic
991870108 5:71101537-71101559 TATGTTACTGAGCTTGCTTGTGG - Intergenic
992837574 5:80655233-80655255 CATTCTGATGAGGGGGCTTGTGG + Intronic
993559711 5:89390954-89390976 TATGCTAATTAGCTTGATTGTGG - Intergenic
993776620 5:92007689-92007711 AGTTCTGATGAGCTGGATTGGGG - Intergenic
994248149 5:97504609-97504631 TGTTCTGATAAGCTTGCTAGTGG - Intergenic
995003784 5:107166391-107166413 TACTCTGATGGGCTTTCTTGTGG - Intergenic
995675268 5:114656069-114656091 TATGCTGATGAGGTTGGCTGGGG - Intergenic
997069311 5:130601204-130601226 TATTCTGATGATCTTACTTAGGG - Intergenic
999836486 5:155379069-155379091 TTTTCTCATGATCTTGTTTGAGG + Intergenic
1003471679 6:6442114-6442136 TATTTTGTTGATCTTGCTTTTGG - Intergenic
1003941853 6:11036583-11036605 TATGCTGAAGAGCGTGCTTTGGG - Intronic
1003996236 6:11542678-11542700 TATTCTGATGGGATTCATTGTGG + Intronic
1006045484 6:31292389-31292411 TATACTGAGGAGCTGGCTTTGGG - Intronic
1007017368 6:38482223-38482245 CAGTGTGATCAGCTTGCTTGTGG - Intronic
1008062036 6:47008823-47008845 TTTTCTGATGGTCTTGCTGGAGG + Intronic
1008222191 6:48868460-48868482 TATGTTAATGAGCTTGATTGTGG + Intergenic
1008551999 6:52641588-52641610 TATGCTAATTAGCTTGATTGTGG + Intergenic
1008847693 6:55987721-55987743 TATACTGATGTGCTTACTTTTGG + Intergenic
1008991509 6:57608044-57608066 TATTGTCATGAGTTTGCTGGAGG + Intronic
1009038313 6:58145254-58145276 TATTCTGATAATCTCACTTGTGG + Intergenic
1009214106 6:60898901-60898923 TATTCTGATAATCTCACTTGTGG + Intergenic
1009351250 6:62682263-62682285 TTGTCTGATGGGTTTGCTTGTGG + Intergenic
1009489592 6:64272647-64272669 TAGTCTGATGTGCTTCCTTTAGG + Intronic
1010213323 6:73380170-73380192 TTTTCTGATGAGATTGGTGGTGG - Intronic
1010366952 6:75062138-75062160 TATTCTGTTGTCCTTCCTTGAGG + Intergenic
1010436517 6:75837909-75837931 TATTCTGATTTGCTCACTTGAGG + Intronic
1012750125 6:103150629-103150651 TAATCTGAAGATCTTGCTTCAGG - Intergenic
1014829481 6:126085123-126085145 TATGCTAATTAGCTTGATTGTGG + Intergenic
1016100814 6:140097805-140097827 TTCTCTGCTGATCTTGCTTGGGG - Intergenic
1020487852 7:8740843-8740865 TATTTTAATTAGCTTGGTTGTGG - Intronic
1020761438 7:12271396-12271418 TTTTCGGATGCGCTTGCATGGGG - Intergenic
1021151516 7:17157021-17157043 TATTCTCATGAGGTTGTCTGAGG - Intergenic
1023431111 7:40091941-40091963 GATTCAGATAAGCTTGCGTGAGG + Intronic
1024041940 7:45562791-45562813 TATTCTGATGAGATTACTGGTGG + Intergenic
1025501313 7:61303113-61303135 CATTCTGAGGAGCTTCTTTGTGG - Intergenic
1025516173 7:61649336-61649358 CATTCTGAGGAGCTTCTTTGTGG - Intergenic
1025540510 7:62078162-62078184 CATTCTGAGGAGCTTCTTTGTGG - Intergenic
1032960703 7:137030188-137030210 AATTCTGATGAAGCTGCTTGAGG + Intergenic
1034885456 7:154795073-154795095 TATTCTGATGAGCTTGCTTGAGG + Intronic
1038960980 8:32519723-32519745 TATTCTGCTTAGCTTGGTTTTGG - Intronic
1039214565 8:35255357-35255379 TTTTCTGAAGAGCTTGCTACTGG - Intronic
1040947669 8:52901131-52901153 CATTCTGAAGAGCTTGCTGGTGG - Intergenic
1042773822 8:72406929-72406951 TAGTCTGATGAGCTTCCCTTTGG - Intergenic
1043411914 8:80006156-80006178 TATTCTGTTGATTTTGGTTGGGG - Intronic
1043880174 8:85533287-85533309 TTTTCTTAGGAGCTAGCTTGTGG - Intergenic
1044620737 8:94188475-94188497 GATGCTGATGAGCCTTCTTGGGG - Intronic
1047002232 8:120584628-120584650 TACTCTGATGAGCCTTATTGTGG + Intronic
1048400532 8:134064115-134064137 TATTCCAATTAGCTTGGTTGTGG + Intergenic
1048911986 8:139143994-139144016 TATGTTAATGAGCTTGATTGTGG - Intergenic
1054076406 9:60539748-60539770 CATTCTGAGAAACTTGCTTGTGG - Intergenic
1055733120 9:79299499-79299521 TATTCTGATGAACTGACTTATGG - Intergenic
1059852128 9:118353957-118353979 TATGCTGATGTGCTTGGGTGTGG + Intergenic
1187182460 X:16955873-16955895 TATTCTGTTGAGCCTTTTTGTGG + Intronic
1188894285 X:35646969-35646991 TATGCTGATTAGCTTGATTGTGG + Intergenic
1189261654 X:39683189-39683211 TCTTCTGCTGGTCTTGCTTGGGG - Intergenic
1193174177 X:78372704-78372726 TAGTCTGATGTGCTTCCTTCTGG + Intergenic
1197111346 X:122778673-122778695 TATCCTCATGTGCTTGCTTGAGG + Intergenic
1197219063 X:123894326-123894348 GATTCAGAAGACCTTGCTTGTGG - Intronic
1198317071 X:135478577-135478599 TATGTTAATGAGCTTGATTGTGG - Intergenic
1198793031 X:140366166-140366188 TATGTTAATGAGCTTGATTGTGG + Intergenic
1199081357 X:143579959-143579981 TAATCTGATGTCCTTGCTGGGGG + Intergenic
1200291148 X:154875404-154875426 TATCTTAATTAGCTTGCTTGTGG + Intronic
1200688675 Y:6282096-6282118 AATTCTGAGCAGCATGCTTGAGG + Intergenic
1201046597 Y:9892625-9892647 AATTCTGAGCAGCATGCTTGAGG - Intergenic
1202371499 Y:24200177-24200199 TATTCTGATGAGATTGATGGTGG + Intergenic
1202499286 Y:25469939-25469961 TATTCTGATGAGATTGATGGTGG - Intergenic