ID: 1034885458

View in Genome Browser
Species Human (GRCh38)
Location 7:154795075-154795097
Sequence TTCTGATGAGCTTGCTTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 142}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885448_1034885458 15 Left 1034885448 7:154795037-154795059 CCTGACCTTTTATCTAACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1034885458 7:154795075-154795097 TTCTGATGAGCTTGCTTGAGGGG 0: 1
1: 1
2: 0
3: 16
4: 142
1034885454_1034885458 -2 Left 1034885454 7:154795054-154795076 CCTGGGGCGGATTCCAGGCTATT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1034885458 7:154795075-154795097 TTCTGATGAGCTTGCTTGAGGGG 0: 1
1: 1
2: 0
3: 16
4: 142
1034885452_1034885458 10 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885458 7:154795075-154795097 TTCTGATGAGCTTGCTTGAGGGG 0: 1
1: 1
2: 0
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885458 Original CRISPR TTCTGATGAGCTTGCTTGAG GGG Intronic
908606254 1:65799974-65799996 TTCTGATAAGATTGCTTTAGTGG + Intronic
910083782 1:83373415-83373437 TTCTGAAGAGCTTGCTGTTGTGG + Intergenic
910721219 1:90288238-90288260 TTATGATGTGCTTTCTTGTGTGG + Intergenic
916867548 1:168876663-168876685 TGCTGAAGAGCTTGCTTTTGTGG - Intergenic
920808607 1:209259414-209259436 CTCTGCTGAGCTTGCTTGATTGG - Intergenic
922250803 1:223846726-223846748 TTCTGAGGAGCTTCCCTGGGGGG + Intergenic
923522524 1:234746765-234746787 TTCTGAAGAGCCTTCTGGAGGGG - Intergenic
1064000098 10:11656675-11656697 TTCAGAGGAGCCTGCTTGTGGGG - Intergenic
1064694683 10:17953453-17953475 TTTTGATGAGGCTTCTTGAGTGG - Exonic
1066294562 10:34042931-34042953 TACTGACTAGCTTTCTTGAGTGG + Intergenic
1066419034 10:35247205-35247227 TTGTGAAAAGCTTGCTTGGGCGG + Intronic
1068888634 10:62125165-62125187 TTCTAATGAGTTTGCTTGTGGGG - Intergenic
1069922495 10:71824967-71824989 TCCTCCTCAGCTTGCTTGAGTGG + Intronic
1069951053 10:72018335-72018357 CTCTGTTGAGCTTTCTTGTGTGG - Intergenic
1071589977 10:86863546-86863568 TTCAGACAAGGTTGCTTGAGTGG + Intronic
1072606105 10:96984094-96984116 TTCTGAAGAGGATGCTTGACAGG - Exonic
1077854776 11:6112797-6112819 TTCTGATGTGCTTGCCTGTCAGG - Intergenic
1079429325 11:20373692-20373714 TTCTGATAAACTGGCATGAGGGG + Intronic
1079688981 11:23398956-23398978 TACAGCTGAGCATGCTTGAGAGG - Intergenic
1089858232 11:121566118-121566140 TTCACTTGAGCTAGCTTGAGTGG - Intronic
1091457610 12:619396-619418 TTCTGAAGAGCTTCATGGAGTGG + Intronic
1093629694 12:21394211-21394233 TTCTGGTCAGCTTGCCTTAGTGG + Intronic
1094332257 12:29307188-29307210 TACTTATGAGCTTGCTAGAGAGG + Intronic
1094408669 12:30146843-30146865 TTCTTTTGAGATTGCTTCAGTGG + Intergenic
1096547330 12:52349479-52349501 TTCTGATATGCTTTCTTAAGCGG + Intergenic
1096681255 12:53256840-53256862 CCCTGATGAGCTTGCTTCAAAGG + Intergenic
1097340114 12:58427628-58427650 GTCTGATGAGCTTCCTTTTGTGG - Intergenic
1098373286 12:69782852-69782874 CTCCTATGAGCTTGCCTGAGTGG - Intronic
1100459940 12:94789483-94789505 TTCTGATGAGCTTGCTTGGGAGG - Intergenic
1101654640 12:106709024-106709046 TTTTGAAGAGCTTGTGTGAGGGG - Intronic
1101993587 12:109507948-109507970 TACTGATCAGCTTCCTTGAAAGG - Intronic
1102624239 12:114221754-114221776 TTCTGATGGGCCTGCTTGGTTGG - Intergenic
1103017556 12:117507659-117507681 TTCTGATTGGTTTTCTTGAGTGG + Intronic
1104403361 12:128496209-128496231 GTCTGATGAGCTTCCTTTTGTGG + Intronic
1104574530 12:129954986-129955008 TTTTGTTGAGCTAGTTTGAGCGG - Intergenic
1105252653 13:18714307-18714329 TTATGATGTGCTTTCTTGTGTGG - Intergenic
1107164535 13:37269202-37269224 GGCTGCTGAGCTTGCTAGAGAGG + Intergenic
1108692596 13:52872746-52872768 TTCTGATAATATTGCCTGAGTGG - Intergenic
1117211933 14:53509603-53509625 TTCTGATGAGTGTGCTAGGGAGG - Intergenic
1118013483 14:61634417-61634439 TTCAGATGTGCTTTCTTGAATGG - Intronic
1119188457 14:72661754-72661776 TTCTGCTGAGCTGGCTTCTGGGG - Exonic
1119285749 14:73452838-73452860 TTCTGACATGCTTTCTTGAGGGG + Intronic
1119819181 14:77599339-77599361 CTCTGATCAGATTGCCTGAGAGG - Intronic
1121764838 14:96477329-96477351 TTCTAATAAGCTTCCTTGAGTGG - Intronic
1121951383 14:98173723-98173745 TTCTCATGAGCTGTCTTGAGTGG + Intergenic
1124454810 15:29832246-29832268 TTCAGACTAGCTTGCTGGAGAGG + Intronic
1125479808 15:40072347-40072369 TGCTGTTGAGCTGGCTAGAGGGG - Intergenic
1127295671 15:57606963-57606985 TGCTGATGAGCAGGATTGAGTGG + Intronic
1127526826 15:59801269-59801291 TTCTGAATTGCTTGCTTTAGGGG - Intergenic
1128952213 15:71897513-71897535 TTCTGATGACCTTTCCAGAGAGG - Exonic
1134732400 16:16473319-16473341 TTCTGTTGAGCTTATTTCAGAGG + Intergenic
1134935038 16:18238645-18238667 TTCTGTTGAGCTTATTTCAGAGG - Intergenic
1140882669 16:79213121-79213143 TTCTCATGTGCTTGCTGGAACGG - Intergenic
1143029050 17:3957395-3957417 TTCAGATGAGCTTGGGTGAGCGG - Intronic
1146947178 17:36881842-36881864 TCCTGATAAGCTTTCTTGAGAGG + Intergenic
1147237557 17:39069006-39069028 TTCTGAAGAGCCAGCCTGAGGGG - Intronic
1147724998 17:42561622-42561644 CTCTGATGCGCTTGTTTGCGGGG - Intronic
1148384738 17:47226155-47226177 TACTTATGTGCTTGCTTAAGTGG - Intergenic
1150553204 17:66230148-66230170 TGCTGATGTTGTTGCTTGAGAGG + Intronic
1150716633 17:67577835-67577857 TTCTGGTGAGCTTACTTTTGGGG - Intronic
1150948886 17:69779278-69779300 TTTTGAGGAGCTTGTTGGAGGGG - Intergenic
1151920001 17:77147394-77147416 TTCTCATTAACTCGCTTGAGTGG + Intronic
1155918667 18:31580877-31580899 TTCTCTTGAGCTTTCTTCAGTGG - Intergenic
1156882848 18:42101572-42101594 TTCTGATGAGCTACCTTGTTTGG - Intergenic
926941913 2:18147134-18147156 TTCTGAAGAAGTTGCATGAGTGG - Intronic
929915409 2:46131527-46131549 TTCTGATGGGCCTGGTGGAGTGG + Intronic
931103304 2:59026910-59026932 TTCTGATTAGCTAGGTTGAGTGG - Intergenic
937844637 2:126566110-126566132 TTCTGGTGAGCATCCTTCAGTGG - Intergenic
938626025 2:133110609-133110631 TCCTGGTGTGCTTTCTTGAGTGG + Intronic
939437205 2:142193341-142193363 ATGTGATAAGCTTTCTTGAGGGG + Intergenic
943168447 2:184363742-184363764 TCCTGATGAGACTGCATGAGAGG - Intergenic
946540138 2:220675536-220675558 TTCTGATGAGAATGCTTGCATGG + Intergenic
946582674 2:221146825-221146847 TTCTGAAGAGCTTCTTTGAGAGG + Intergenic
947432362 2:230042321-230042343 TTCTAGTGAGCTTTCTTGAGTGG - Intronic
1171024064 20:21612793-21612815 TTCTGCTGTGCTTTCTTGCGTGG + Intergenic
1171822050 20:29858689-29858711 TTCTGAGGAACTTGTTTGTGAGG + Intergenic
1174327934 20:49794361-49794383 TTCTGAAGAGGATGCTTGATTGG - Intergenic
1175067182 20:56299274-56299296 ATATGATGAGCTTTCTTGCGCGG - Intergenic
949296014 3:2523965-2523987 TTCTGAACAGCTTTTTTGAGTGG + Intronic
950013033 3:9736836-9736858 TTCTAATATGCTTCCTTGAGGGG + Intronic
953567765 3:44047742-44047764 TTCCGACGAGCCTGCTGGAGTGG - Intergenic
953801128 3:46023314-46023336 TGCTGATGAGCCAGGTTGAGGGG - Intronic
954950723 3:54470196-54470218 TTCTGATGGGCTTCCTTTTGTGG - Intronic
955399548 3:58581609-58581631 TTCTGCAGAGCATGTTTGAGAGG - Intronic
957425878 3:80038082-80038104 CCCTGATGTGCTTGCTTCAGGGG + Intergenic
960255959 3:115511967-115511989 TTTTTATGACCATGCTTGAGAGG + Intergenic
960433692 3:117600257-117600279 TTCTGTGGAGCTGGCTGGAGAGG - Intergenic
962915725 3:139901792-139901814 TTTACATAAGCTTGCTTGAGGGG + Intergenic
966331669 3:178821635-178821657 TTCTGCTGACCTTGCTAAAGAGG - Intronic
966996719 3:185289042-185289064 TTGTGATGATCTAGATTGAGGGG + Intronic
968000793 3:195204933-195204955 CTCTGATGATCTTGCGTGATTGG - Intronic
970398153 4:15691672-15691694 TTCTGCTGAGATTGGTTGAGGGG + Intronic
971514486 4:27469297-27469319 GTTTGATGAGTTTGCTGGAGTGG - Intergenic
971863013 4:32133086-32133108 TTCCGATTAGCTTGCTTCATTGG - Intergenic
974362120 4:60894601-60894623 TTCTCATGAGGTTCCTAGAGAGG - Intergenic
974882876 4:67781026-67781048 TTCGAATGATCTTGCCTGAGAGG - Intergenic
976167793 4:82273516-82273538 GTCTGATGAGCTTCCCTGTGTGG - Intergenic
984009058 4:174348363-174348385 TACTTATGATCTTGCTTGATTGG + Intergenic
984090762 4:175372138-175372160 TTTTAATGTGCTTGCTTGATTGG + Intergenic
984160354 4:176245031-176245053 TCCTGAAGAGCTGGCTTTAGGGG - Intronic
986713136 5:10502405-10502427 TTCTGATGAACTTCCTTCTGTGG - Intergenic
987655454 5:20800309-20800331 TTCAGAGGGGCTTGCTTCAGAGG + Intergenic
988122176 5:26979709-26979731 TTCTCATGAGTGTGCTTGTGTGG - Intronic
988812489 5:34799204-34799226 TTCAGATATGCTTTCTTGAGAGG - Intronic
988855080 5:35220415-35220437 TACTGATGTGCTAGCTTGAAGGG + Intronic
989451436 5:41590819-41590841 TGCTGATGAGTCTGCTGGAGTGG + Intergenic
992365737 5:76087549-76087571 TTCTGGGGAGCTTGTTTAAGTGG + Intronic
994124154 5:96151022-96151044 TCCTGATGAGCTTCCTTGCCTGG + Intergenic
994510752 5:100700649-100700671 TGCTGGTGACCTTGCTGGAGAGG - Intergenic
995845913 5:116493708-116493730 TTCTGGTGAGCTTGTTGGTGCGG + Intronic
996940553 5:129000093-129000115 TTCTCATCAGCTTGCTGAAGAGG + Intronic
1000529795 5:162405428-162405450 TTCTGATATCCTTTCTTGAGTGG + Intergenic
1000701507 5:164456995-164457017 TTCTTAAGAGATTGCCTGAGTGG + Intergenic
1000995874 5:167958856-167958878 GTCTGATGAGCTTCCTTTTGTGG + Intronic
1004330878 6:14719534-14719556 TTCTGATCTGCTTTCTTGAGTGG - Intergenic
1010352168 6:74887652-74887674 GTCTGATGAGCTTCCTTTTGTGG + Intergenic
1012044606 6:94255096-94255118 TTCTCATGATAATGCTTGAGAGG - Intergenic
1015933255 6:138383523-138383545 TTCTGATTTGCTTCCTTGAATGG + Intergenic
1017467211 6:154705708-154705730 TTCTAATGAGCTTCCCTGATAGG + Intergenic
1024908535 7:54418767-54418789 TTCTGATGAGCTGATTTCAGGGG + Intergenic
1024999933 7:55307351-55307373 TGCTGATGAGCTTGCCTGGAGGG + Intergenic
1025521472 7:61737081-61737103 TTCTGAGAAACTTCCTTGAGAGG - Intergenic
1027300609 7:76829553-76829575 TTCTGAAGAGCTTGCTGTTGTGG + Intergenic
1028782721 7:94756007-94756029 TTCTGATGTGCTTCCTTTTGTGG + Intergenic
1029361540 7:100091784-100091806 TTCTGATGAGGGTACTTGAAGGG + Exonic
1031692127 7:124801879-124801901 TTCTTATGAGAAAGCTTGAGTGG - Intergenic
1031723124 7:125202052-125202074 TTCTGAAGAGCTTGCTGGGAAGG - Intergenic
1031829714 7:126611835-126611857 CTCTAATGAGCTCTCTTGAGAGG - Intronic
1032312402 7:130800911-130800933 GTCTGATGGGCTTCCTTGTGTGG + Intergenic
1033155119 7:138950353-138950375 TTCTGACCAGCTTAGTTGAGTGG - Intronic
1033448870 7:141445197-141445219 CTCTGGTGAGCTTGGTGGAGCGG - Intronic
1033629884 7:143147334-143147356 GTCTGATGATTTTGGTTGAGTGG + Intergenic
1034885458 7:154795075-154795097 TTCTGATGAGCTTGCTTGAGGGG + Intronic
1036018697 8:4816657-4816679 TTCTGATGAGCTTTCACCAGTGG - Intronic
1037420695 8:18698989-18699011 TCCTTATGAGCCTGGTTGAGTGG - Intronic
1038047910 8:23782037-23782059 TTATGGTGACTTTGCTTGAGTGG - Intergenic
1042282160 8:67066010-67066032 TTCTGATGTACTTTCCTGAGTGG + Intronic
1042350792 8:67775296-67775318 TTCTGATTTGCTTTCTTGAGTGG - Intergenic
1043488644 8:80724869-80724891 TTCTGAAGAGACTGCTTGAACGG - Intronic
1044601280 8:94007999-94008021 TTCTGATGAGCTTCCCTTTGTGG + Intergenic
1045404791 8:101855033-101855055 TCCTGATGAGGTTGCTGGGGAGG + Intronic
1046749847 8:117915276-117915298 TTCTGCTGATATTGTTTGAGTGG + Intronic
1047249163 8:123168808-123168830 TTCTGCTTAGCTAGCTAGAGTGG - Intergenic
1047654680 8:126964268-126964290 CCCTGATGAGCTAGCTAGAGAGG + Intergenic
1047654689 8:126964368-126964390 CCCTGATGAGCTAGCTAGAGAGG + Intergenic
1047845729 8:128802976-128802998 TTCTGTTGAGCTTCCTTTTGAGG - Intergenic
1048552051 8:135442560-135442582 TCCTGATGACATTGCATGAGAGG - Intergenic
1050532317 9:6601238-6601260 TTGTGATGACTGTGCTTGAGGGG - Intronic
1050731180 9:8711671-8711693 TTCTGATTAGGTTGGTTGGGAGG + Intronic
1052038903 9:23715467-23715489 TTCTAATCATCTTGCTTGAGAGG - Intronic
1054967072 9:71041442-71041464 TTATGATCAGCTTGGTGGAGAGG + Intronic
1056332565 9:85533584-85533606 TGCTGATGAGGTTTGTTGAGTGG - Intergenic
1058071262 9:100602743-100602765 TTCTCTTCTGCTTGCTTGAGAGG + Intergenic
1058140995 9:101356803-101356825 ATCTGCTGAGCTTGCATGTGTGG - Intergenic
1058921119 9:109616021-109616043 TTCAGATGAGATTGCCTGATTGG + Intergenic
1061970064 9:134040079-134040101 TTCTGCTGAGCCTGCTTGGCAGG + Exonic
1189369305 X:40415106-40415128 TTCTGATGCACTTTCTTGAGTGG - Intergenic
1193179340 X:78435113-78435135 TGCTGAAGAGTTTGGTTGAGAGG + Intergenic
1193759382 X:85444905-85444927 TTTTTATGAGCTTGGTTAAGTGG + Intergenic
1200269566 X:154669693-154669715 GTCTGATGAGCTTCCTTTTGTGG + Intergenic