ID: 1034885459

View in Genome Browser
Species Human (GRCh38)
Location 7:154795079-154795101
Sequence GATGAGCTTGCTTGAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885454_1034885459 2 Left 1034885454 7:154795054-154795076 CCTGGGGCGGATTCCAGGCTATT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1034885459 7:154795079-154795101 GATGAGCTTGCTTGAGGGGAAGG No data
1034885448_1034885459 19 Left 1034885448 7:154795037-154795059 CCTGACCTTTTATCTAACCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1034885459 7:154795079-154795101 GATGAGCTTGCTTGAGGGGAAGG No data
1034885452_1034885459 14 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885459 7:154795079-154795101 GATGAGCTTGCTTGAGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885459 Original CRISPR GATGAGCTTGCTTGAGGGGA AGG Intronic
No off target data available for this crispr