ID: 1034885461

View in Genome Browser
Species Human (GRCh38)
Location 7:154795092-154795114
Sequence GAGGGGAAGGAAGGAACGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034885455_1034885461 2 Left 1034885455 7:154795067-154795089 CCAGGCTATTCTGATGAGCTTGC 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1034885461 7:154795092-154795114 GAGGGGAAGGAAGGAACGTGAGG No data
1034885452_1034885461 27 Left 1034885452 7:154795042-154795064 CCTTTTATCTAACCTGGGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 39
Right 1034885461 7:154795092-154795114 GAGGGGAAGGAAGGAACGTGAGG No data
1034885454_1034885461 15 Left 1034885454 7:154795054-154795076 CCTGGGGCGGATTCCAGGCTATT 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1034885461 7:154795092-154795114 GAGGGGAAGGAAGGAACGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034885461 Original CRISPR GAGGGGAAGGAAGGAACGTG AGG Intronic
No off target data available for this crispr