ID: 1034889796

View in Genome Browser
Species Human (GRCh38)
Location 7:154829785-154829807
Sequence GAGGGCTTTGAGCAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 772
Summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 702}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889796_1034889810 29 Left 1034889796 7:154829785-154829807 CCTCCATCCTGCTCAAAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 702
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889796_1034889808 21 Left 1034889796 7:154829785-154829807 CCTCCATCCTGCTCAAAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 702
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889796_1034889811 30 Left 1034889796 7:154829785-154829807 CCTCCATCCTGCTCAAAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 702
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889796 Original CRISPR GAGGGCTTTGAGCAGGATGG AGG (reversed) Intronic
900149162 1:1170764-1170786 GAGGGCTGCGGACAGGATGGAGG + Intergenic
900571093 1:3358591-3358613 GAGGGCTGAGGGCAGGAGGGAGG - Intronic
900643549 1:3698545-3698567 GTGGGCTTTGAGCGGGATCCGGG + Intronic
901137059 1:7004678-7004700 GTTGTCTTTGAGGAGGATGGGGG - Intronic
901859467 1:12064681-12064703 GTGGGCTTTAGGCAGGAGGGAGG + Intronic
901863366 1:12088748-12088770 GAAGGCTGTGAACAGGAAGGAGG + Intronic
902289008 1:15424655-15424677 GAGGGCACAGAGCAGGACGGGGG - Intronic
902334519 1:15747411-15747433 GAGGGCTGTGGACAGGGTGGGGG - Intronic
902533981 1:17108407-17108429 GAGAGCTATGGGCAGGAGGGTGG - Intronic
903546873 1:24129922-24129944 GAGGGCCTGAACCAGGATGGAGG - Intronic
904625752 1:31800998-31801020 CAGAGCTTTGAGCAGGAGGAGGG - Intronic
904848766 1:33441122-33441144 GAGGACGTGGAGCAGGAGGGAGG + Intergenic
904939117 1:34152472-34152494 AAGGGCATTGAGGAGGCTGGAGG - Intronic
905389061 1:37624574-37624596 AAGGGCTTTGCGTAGGATGAAGG - Intronic
906096132 1:43225255-43225277 GAGGGCTTTGAGCAGGAGAGTGG - Intronic
906160217 1:43642590-43642612 GATGGCTTGGAGCAGGGTGATGG + Intergenic
907316563 1:53576246-53576268 GGGGGCATTGAGGAGGATGGAGG - Intronic
907498842 1:54863332-54863354 GAGGGCTTTGAACAGGAAAGTGG - Intronic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
909625034 1:77705762-77705784 GAGGGCTCTAAGCTGGATTGTGG - Intronic
910138287 1:83998717-83998739 GAGAGGTTTGGGCAGAATGGGGG - Intronic
911391227 1:97246433-97246455 GAAGGCTTTGAGGAAGATGCAGG + Intronic
912296861 1:108478100-108478122 GGCTGCTTTGAGCAGGATTGGGG - Intergenic
913936040 1:125048937-125048959 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
913936655 1:125060760-125060782 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
914334795 1:146704530-146704552 GAGGGCTGAGTGCAGGGTGGAGG + Intergenic
914402314 1:147334049-147334071 AGGGGCTTTGAGCAGAATGGTGG + Intergenic
915297060 1:154928922-154928944 GGGGGCTTGGGCCAGGATGGTGG + Intronic
915482980 1:156199812-156199834 CTGGGATTTGAGCAGTATGGAGG - Intronic
915509471 1:156378632-156378654 GAAGGTTTTAAGTAGGATGGAGG - Intronic
915552205 1:156641887-156641909 GAGGGCTTGGAGTAGGGAGGAGG - Intronic
915570897 1:156744544-156744566 CAGGGCTCTGTGCAGGAGGGGGG + Intronic
915896268 1:159813557-159813579 AAGGACTTCCAGCAGGATGGTGG + Intronic
916085508 1:161266232-161266254 GAGGGCTTTGTGTGGGAGGGAGG - Intronic
917166135 1:172115324-172115346 TGGAGCTTTGAGCAGGGTGGTGG - Intronic
917297719 1:173539218-173539240 TAGGGTTTTAAGCAGGAAGGAGG + Intronic
917760858 1:178155701-178155723 GGGGGCTTTCAGCAGAACGGAGG - Intronic
917765956 1:178217353-178217375 GAGGGCTTTGGGGAGGAAGCAGG - Intronic
919075522 1:192808699-192808721 GAGGGCTTTGCGACGGAGGGAGG - Intergenic
919805268 1:201377700-201377722 GAGGGCTTTAAGCAGGCATGTGG + Exonic
922015161 1:221637760-221637782 GAGAGCTGTGGGCAGGATGCTGG - Intergenic
922369267 1:224893117-224893139 GGTGGCTTCGAGCAGGATTGGGG - Intergenic
922525170 1:226296612-226296634 GAAGGCTTTGAAAAGGATGTAGG - Intronic
922802709 1:228371579-228371601 GGGGGCTTTGGCCAGGAGGGTGG - Exonic
924649905 1:245916662-245916684 GATGGCTCAGACCAGGATGGTGG - Intronic
1063017951 10:2096787-2096809 GAGGGGTTGGAGGAGGCTGGAGG - Intergenic
1064153417 10:12884385-12884407 GGGGGCTTGGACCAGGCTGGTGG + Intergenic
1066804810 10:39236508-39236530 GAGAGCTTTGAGTACTATGGTGG + Intergenic
1066816210 10:39417706-39417728 GAGCGCTTTGAGCCCTATGGTGG + Intergenic
1066816356 10:39420760-39420782 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1066817474 10:39437968-39437990 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1066817709 10:39442566-39442588 GAGGGCTTTGAGGCTTATGGTGG - Intergenic
1067294599 10:44968042-44968064 CAGGGCTTAGAGCAGGAAGTTGG + Intronic
1067539582 10:47142020-47142042 GATGGATTTGGGCAAGATGGAGG - Intergenic
1067557362 10:47282322-47282344 GAGGGCAGTCAGCAGGAAGGGGG - Intergenic
1068936403 10:62639597-62639619 GGGGGCTGTGAGTAGGTTGGGGG - Intronic
1069599026 10:69691495-69691517 TGGGGCTCTGAGTAGGATGGAGG - Intronic
1070668575 10:78362468-78362490 GAGGGCTGGGAATAGGATGGGGG - Intergenic
1070823368 10:79375995-79376017 GAGGGCTAAGAGAAGGCTGGTGG + Intergenic
1073300624 10:102469106-102469128 GAAGACATTGTGCAGGATGGTGG - Exonic
1075355985 10:121776319-121776341 GAGGGATTTGGGCAGGATGGTGG - Intronic
1075446274 10:122515674-122515696 GAGGGCCTTGGACCGGATGGAGG + Intergenic
1076550817 10:131277241-131277263 GAGGGCTTAAAGCTGGAAGGTGG + Intronic
1077145466 11:1042382-1042404 GGGGGCTTTGAGGAGGGTGGGGG + Intergenic
1077369682 11:2175666-2175688 GAGGGCTCCGTGCAGGAAGGTGG - Intergenic
1077883959 11:6372089-6372111 GAAGGCCTTGAGCAGAAAGGTGG - Intergenic
1078498609 11:11845329-11845351 GAAGGTTTTGAACAGGAAGGAGG - Intronic
1078758939 11:14236214-14236236 GGTGGCTTGGATCAGGATGGAGG + Intronic
1081379198 11:42394489-42394511 GAGGGCATTGAGAGTGATGGAGG + Intergenic
1081709760 11:45209179-45209201 GTGGGCCGTGAGCACGATGGTGG - Intronic
1082156670 11:48828058-48828080 GAGTGCTTTGAGGACTATGGTGG + Intergenic
1082157390 11:48841449-48841471 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1082313744 11:50691129-50691151 GAGCGCTTTGAGGAGTATGGTGG + Intergenic
1082315701 11:50717226-50717248 GAGTGCTTTGAGACGTATGGTGG - Intergenic
1082318833 11:50770374-50770396 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1082318988 11:50773282-50773304 GAGGGCTTTGAGGCTTATGGTGG - Intergenic
1082319468 11:50782493-50782515 GAGAGCTTTGAGGTGGATTGTGG - Intergenic
1082326332 11:51148055-51148077 GAGGGCTTTGAGGCCGGTGGTGG + Intergenic
1082344900 11:51418040-51418062 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082355324 11:51569194-51569216 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082377592 11:51893085-51893107 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082382859 11:51969720-51969742 GAGGGCTTTGAGGCCGGTGGTGG + Intergenic
1082397635 11:52184936-52184958 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082425163 11:52582776-52582798 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082431854 11:52679661-52679683 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082435988 11:52739163-52739185 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082439509 11:52790170-52790192 GAGGGCTTTGAGCTCTGTGGTGG + Intergenic
1082441635 11:52820754-52820776 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1082464514 11:53152275-53152297 GAGGGCTTTGAGGCGGGTGGTGG + Intergenic
1082469716 11:53227300-53227322 GAGGGCTTTGAGCCCTGTGGTGG + Intergenic
1082473509 11:53282556-53282578 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082473745 11:53285959-53285981 GAGGGCTTTGAGCCCTGTGGTGG + Intergenic
1082475277 11:53308063-53308085 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082493069 11:53563545-53563567 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082495866 11:53604357-53604379 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082506105 11:53752790-53752812 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082517121 11:53911785-53911807 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082533458 11:54148320-54148342 GAGGGCTTTGAGCCCTGTGGTGG + Intergenic
1082540749 11:54253916-54253938 GAGGGCTTTGAGGTGTGTGGTGG + Intergenic
1082547604 11:54352337-54352359 GAGGGCTTTGGGGATGGTGGTGG + Intergenic
1082549093 11:54371785-54371807 GAGGGCTTTGGGGATGGTGGTGG + Intergenic
1082549705 11:54379973-54379995 GAGGGCTTTGGGGATGGTGGTGG + Intergenic
1082550460 11:54390209-54390231 GAGGGCTTTGGGGATGGTGGAGG + Intergenic
1082554622 11:54547879-54547901 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1082554742 11:54550261-54550283 GAGGGCTTTGAGTACTGTGGTGG + Intergenic
1082606542 11:55241267-55241289 GAGCGCTTTGAGCCCTATGGTGG + Intergenic
1083613674 11:64016118-64016140 CAGGGCTGTGCGCAGGAAGGTGG - Intronic
1083742463 11:64718150-64718172 GAGGCCTTTGGTCAGGTTGGAGG - Intronic
1083801991 11:65052225-65052247 TGGGGCTTGGACCAGGATGGAGG - Intronic
1083897410 11:65626976-65626998 GAGGGCGTTGAGCACCACGGCGG - Exonic
1084366545 11:68705005-68705027 GGGGGTTGGGAGCAGGATGGAGG + Intergenic
1084585326 11:70057979-70058001 GGCTGCTTTGAGCAGGATTGTGG + Intergenic
1085357345 11:75850518-75850540 GAGGGCTTTGAACACAATGATGG + Intronic
1085471087 11:76758596-76758618 GAGGGTTTTGAGCAAGGAGGTGG + Intergenic
1086402522 11:86472333-86472355 GAGGGCTTTAGGCAGGAAGGTGG + Intronic
1086933196 11:92715997-92716019 AAGGTTTTTGAGCAGGATGGTGG + Intronic
1087216932 11:95504649-95504671 GAGGGGTGTGAGGAGGATGCAGG + Intergenic
1089350354 11:117818531-117818553 GGGGGCTTTCAGGAGGAGGGAGG - Intronic
1091007499 11:131966765-131966787 GATGGCTTTGAGCAGGGTAGGGG + Intronic
1091541912 12:1469868-1469890 GCTGGCATTGAGGAGGATGGGGG - Intronic
1091940627 12:4477384-4477406 GAGGGCTCTGAGCTGCCTGGTGG + Intergenic
1094363329 12:29653299-29653321 GAGGGCCTTCAGGAAGATGGTGG + Intronic
1095031869 12:37296994-37297016 GAGGGCTTTGAGGTCAATGGTGG + Intergenic
1095032125 12:37301917-37301939 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1095033897 12:37332078-37332100 GAGGGCTTTGAGGCCTATGGAGG + Intergenic
1095036074 12:37374510-37374532 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1095056501 12:37610725-37610747 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1095057175 12:37624136-37624158 GAGGGCTTTGAGGACTACGGTGG + Intergenic
1095057654 12:37634042-37634064 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1095057867 12:37638130-37638152 GAGGGCTTTGAGATCTATGGTGG - Intergenic
1095058178 12:37644095-37644117 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1095058201 12:37644611-37644633 GAGGGCTTTGAGCACTATAATGG - Intergenic
1095058783 12:37655734-37655756 GAGAGCTTTGAGGCGGATTGTGG + Intergenic
1095059786 12:37669942-37669964 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1095060111 12:37676917-37676939 GAGGGCTTTGAGTCCTATGGTGG - Intergenic
1095060135 12:37677429-37677451 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1095060255 12:37679647-37679669 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1095060995 12:37688028-37688050 GAGGGCTTTGAGTCCTATGGTGG - Intergenic
1095061003 12:37688199-37688221 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1095062174 12:37710427-37710449 GAGTGCTTTGAGCCCTATGGTGG + Intergenic
1095062400 12:37713986-37714008 GAGTGCTTTGAGGACTATGGTGG + Intergenic
1095063246 12:37729914-37729936 GAGGGCTTTGAGGCGTATTGTGG + Intergenic
1095244819 12:39907688-39907710 GAGGGCTTTCTGCAGGAGGATGG - Intronic
1095727060 12:45465473-45465495 ACGGGTTTTGAGCAGGATGTTGG - Intergenic
1096721691 12:53527689-53527711 CATGGCTTAGACCAGGATGGAGG + Intronic
1099610237 12:84858296-84858318 GAGGGGGTGGAGCAAGATGGTGG - Intergenic
1100973184 12:100093570-100093592 GATGGATTTGAACAGGAAGGGGG - Intronic
1102229550 12:111253060-111253082 GGCGGCTCAGAGCAGGATGGTGG - Intronic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102512997 12:113428291-113428313 CAGGGCTGTGGGCAGGATGAGGG + Intronic
1102753329 12:115315491-115315513 AAGGGCCTTGAGGAGGGTGGTGG - Intergenic
1104067389 12:125317020-125317042 GAGGGCTGGAAGCAGAATGGGGG + Intronic
1105067198 12:133210823-133210845 GAGGTCTGTGAGCAGAATGCAGG + Exonic
1105074276 12:133261992-133262014 GAGGGCTGTGAGGAGCAGGGTGG - Intergenic
1105074840 13:16001309-16001331 GAGGGCTTTGTGGAGTATAGTGG + Intergenic
1105075687 13:16017180-16017202 GAACGCTTTGAGGAGTATGGTGG + Intergenic
1105683418 13:22752553-22752575 GAGGGCGGTGAGCAGGACTGAGG - Intergenic
1106682499 13:32022575-32022597 CAGGGCTTTGTGTAGGAGGGTGG - Intergenic
1106879169 13:34110351-34110373 GAGGGTTGTTTGCAGGATGGTGG + Intergenic
1107070056 13:36259169-36259191 GAGGGCCGAGAGCAGGATGGCGG + Intronic
1108703135 13:52960470-52960492 GAGGGGTTTGAGGGGGGTGGGGG + Intergenic
1109970810 13:69765840-69765862 AAGGGCTTTCAGCTGAATGGTGG + Intronic
1111412153 13:87891286-87891308 GAGGGCTGTGATGATGATGGAGG - Intergenic
1112382818 13:98909070-98909092 GTGGGCTTTGGGCAGGAAAGTGG - Intronic
1113582835 13:111440813-111440835 AGGGGCTTAGAGCAGGGTGGCGG - Intergenic
1113966242 13:114155376-114155398 GGGGGCTTTGGGCAGGGTAGAGG + Intergenic
1113999332 14:16136723-16136745 GAGGGCTTTGTGGAGTATAGTGG - Intergenic
1113999420 14:16138421-16138443 GAGGGCTTTGTGGAGTATTGTGG - Intergenic
1114000923 14:18244211-18244233 GAGAGCTTTGAGGCGTATGGTGG - Intergenic
1114002826 14:18279063-18279085 GAGTGCTTTGAGCACAATGGTGG - Intergenic
1117507701 14:56419079-56419101 GGGGGCTTGCAGGAGGATGGTGG - Intergenic
1118126247 14:62907908-62907930 GAGGGCATTGTGCAAGATGAAGG + Intronic
1119543351 14:75454992-75455014 GAGGGCTTGGACCAGGCTGGAGG + Intronic
1119783857 14:77297904-77297926 GAGGTCTTTGAGCAGCCAGGAGG - Intronic
1119811808 14:77527380-77527402 GAAGGCCTTGAAAAGGATGGAGG + Intronic
1120353349 14:83393525-83393547 GAGGGCATTGAATAGGATGAGGG - Intergenic
1120498045 14:85260550-85260572 GTTGGCTTTGAGGAGGATGGTGG + Intergenic
1120860192 14:89248071-89248093 GAGGGGTTGGAGCAGGAGGAAGG - Intronic
1120974293 14:90235304-90235326 CCAGGCTTTGAGCAGGATAGAGG + Intergenic
1121007395 14:90499168-90499190 GACGGCTTGGACCAGGATGACGG + Intergenic
1121108490 14:91296205-91296227 AAGGGCTGTGGCCAGGATGGTGG - Intronic
1122046429 14:99027270-99027292 CAGGGCTTGGAGGAAGATGGTGG - Intergenic
1122421934 14:101583192-101583214 GAGGGCTGTTTGAAGGATGGGGG - Intergenic
1122592084 14:102860960-102860982 GTGGTCTTTGGGCAAGATGGTGG + Intronic
1122870677 14:104636908-104636930 CAGGGATTTGAGGAGAATGGAGG - Intergenic
1123226149 15:17033722-17033744 GAGGGCTTTGAGGAGTATAGTGG + Intergenic
1123227610 15:17058803-17058825 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1123387330 15:19827021-19827043 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1123387445 15:19829245-19829267 GAGGGCTTTGAGAATTATTGTGG - Intergenic
1124191607 15:27582373-27582395 GAGGGCTATGAGAAGAAGGGAGG - Intergenic
1125506412 15:40270262-40270284 GAGGGCTGTGAGGGGGGTGGAGG - Intronic
1125518069 15:40333993-40334015 CAGGGCTGGGGGCAGGATGGCGG - Exonic
1125724680 15:41862285-41862307 GAGCGCTGTGGGCAGGAGGGAGG - Exonic
1126316613 15:47376780-47376802 GAGGGGTTTGAGGAGATTGGGGG - Intronic
1127015751 15:54685379-54685401 GAGGTCTGTGAGTTGGATGGTGG + Intergenic
1127046998 15:55036439-55036461 TAAGGCTTTGACCAGGAGGGTGG - Intergenic
1127653197 15:61029433-61029455 GAGGGCTTTAAGCAGGAAAGAGG + Intronic
1128194904 15:65743947-65743969 GAGGGTTTTGAGCAGAAGAGAGG + Intronic
1128613246 15:69090262-69090284 GAGGGCTTGGAGCAGGTGAGAGG - Intergenic
1128647499 15:69388139-69388161 GAGGGCTTTGACAGGGAGGGAGG - Intronic
1128810420 15:70567254-70567276 AAGGCCTTGGAGCAGGATGCCGG - Intergenic
1129151784 15:73693690-73693712 CAGGGCTTTGATAAGGAAGGGGG + Intronic
1129293615 15:74587266-74587288 GAGGGCCTGGACCAGGATGGTGG + Intronic
1130202926 15:81850236-81850258 GAGAGTTTTGAGCATGATGCTGG - Intergenic
1133401942 16:5494542-5494564 GAGGTCTTGGAGCAAGAGGGAGG + Intergenic
1134015549 16:10885647-10885669 CTGGACTTGGAGCAGGATGGGGG - Intronic
1134066705 16:11233096-11233118 GAGGGGGTTGGGCAGGAAGGTGG - Intergenic
1134402620 16:13924023-13924045 GTGGGCTTTGATCAGAAAGGAGG - Intronic
1134649579 16:15898140-15898162 GAGGGCTGGGAGGAGGAAGGAGG - Intergenic
1135246209 16:20859511-20859533 GAGGGCATAGAGCAGGGCGGGGG - Exonic
1136906899 16:34102145-34102167 GAGCGCTTTGAGGAGTATTGGGG - Intergenic
1137027315 16:35489982-35490004 GAGGGCCTGGGGAAGGATGGTGG + Intergenic
1137077607 16:35993030-35993052 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1137082567 16:36079650-36079672 GAGGGCTTTGAGAACTATGGTGG + Intergenic
1137364795 16:47851466-47851488 GAGGGCTTTGGGCAGCCTGTGGG + Intergenic
1139909470 16:70388505-70388527 GTGGGCTTTGAGCAGGATGTTGG - Exonic
1139998829 16:71006706-71006728 GAGGGCTGAGTGCAGGGTGGAGG - Intronic
1141542708 16:84738446-84738468 GAGGGTTTTGAACGAGATGGAGG + Intronic
1141617404 16:85217799-85217821 GAGGGCTTCGAGGAGGAGGCAGG - Intergenic
1142410772 16:89915510-89915532 GAGGCCTTTGAGACGGACGGCGG - Intronic
1142741038 17:1932193-1932215 AAGGCCTGTGAGCAGGTTGGGGG - Intergenic
1143096988 17:4483421-4483443 GAGGACTTGGAACAGGCTGGGGG + Intronic
1143181467 17:4986871-4986893 GAGGGCTGTCAGCCGGAGGGTGG - Intronic
1143352222 17:6297402-6297424 GGGGCCTTTGAGAAGGATGGGGG - Intergenic
1143376507 17:6470574-6470596 GTGGGTTTTGAGAAGGAAGGAGG - Intronic
1143502088 17:7345181-7345203 TAGGGTTTGGAACAGGATGGTGG + Intronic
1144162727 17:12577756-12577778 AAGGGTTTTGAGCAAGAAGGTGG - Intergenic
1144459014 17:15442631-15442653 AGAGGCTCTGAGCAGGATGGTGG - Intronic
1145419779 17:22762982-22763004 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1145551798 17:24713660-24713682 GAGGGCTTTGAGGCGTGTGGTGG + Intergenic
1145632846 17:25893134-25893156 GAGGGCTTTGAGGCGTGTGGTGG + Intergenic
1147196969 17:38773442-38773464 GGGTGCTGTGAGCAGGGTGGTGG + Intronic
1147326419 17:39671869-39671891 GAGAGGTTGGAGCAGGATGAGGG - Exonic
1147760835 17:42796463-42796485 GATGCCTGGGAGCAGGATGGGGG - Exonic
1147840698 17:43369267-43369289 GAGGGCTTGGGCCAGGATGGGGG + Intergenic
1148536414 17:48442740-48442762 GGTGGCTTGGACCAGGATGGTGG - Intergenic
1148749499 17:49936395-49936417 GAGGGCAGTGAGGAGGCTGGGGG - Intergenic
1149221134 17:54416263-54416285 GGCTGCTTTGAGCAGGATTGGGG - Intergenic
1149328321 17:55555836-55555858 GAGAGCTTAGAGCAGGGGGGTGG - Intergenic
1149457079 17:56796891-56796913 GAAGGCTTCGAGGAGGAAGGTGG - Intronic
1151458752 17:74242223-74242245 AAGGGCTTGGAGGAGGCTGGAGG + Intronic
1151783388 17:76262625-76262647 GAGGGCTTTGAGCTGATGGGAGG - Intergenic
1152000325 17:77641273-77641295 TAGGGCTTTGAGCAAGACAGTGG + Intergenic
1152463657 17:80454253-80454275 GACGGCTCGGAGCAGGGTGGTGG + Intergenic
1153829685 18:8911212-8911234 GAGGGCTTTGGGATGGAGGGAGG + Intergenic
1154534970 18:15394654-15394676 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1154535797 18:15409323-15409345 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1155111164 18:22715888-22715910 AAGGGCTCTGAGAAGGATAGAGG - Intergenic
1155187661 18:23401637-23401659 CAGGGCATTGAGGAGGAAGGAGG + Intronic
1155655119 18:28183677-28183699 GAGGGCTTTGAGGAGCCTGCTGG + Intergenic
1156371357 18:36474322-36474344 GAGGGATATGCGCATGATGGTGG + Intronic
1156456136 18:37295513-37295535 GAGGGCTCAGAGCATGCTGGAGG + Intronic
1156477324 18:37414018-37414040 GAGTGCTTAGAACAGGATGATGG - Intronic
1157555572 18:48610835-48610857 CAGGGCTTTGCACAGGGTGGGGG + Intronic
1157855409 18:51100491-51100513 GTGGGCTATCAGCAAGATGGAGG - Intergenic
1159597401 18:70395517-70395539 GAGGCCTTTGGGCAGGATGGTGG + Intergenic
1159691485 18:71494029-71494051 CAAGGCTTTGAGAAGGATGTTGG - Intergenic
1160084052 18:75757778-75757800 GGGGGCTTTGAGGGGGAAGGAGG + Intergenic
1160873632 19:1287607-1287629 GAGGCCGTTGACCAGGGTGGGGG - Intronic
1161375240 19:3936604-3936626 CAGGGCTCTGAGCAGGCTGTTGG - Exonic
1162327643 19:10008296-10008318 GAGAGCTTTGAGTTGGATGCCGG - Intronic
1163178640 19:15583507-15583529 GAGGGCTTTGGGCAGGGTGGAGG + Intergenic
1163364553 19:16868777-16868799 GAGTGGTTGGAGCAGGCTGGTGG + Intronic
1163574037 19:18099977-18099999 GAGGGCTAGGAGCAGGAGTGGGG + Intronic
1164346158 19:27261193-27261215 GAGCACTTTGAGCACTATGGTGG + Intergenic
1164351025 19:27341993-27342015 GAGCGCTTTGAGGAATATGGTGG - Intergenic
1164354137 19:27396584-27396606 GAGGGCTTTGAGGGCTATGGTGG - Intergenic
1164354333 19:27400696-27400718 GAGGGCTTTGAGACCCATGGTGG - Intergenic
1164592318 19:29513574-29513596 GAGGGGTATGAGGAGGAAGGAGG + Intergenic
1165104414 19:33460590-33460612 GAGAGCTTAGAGCAGGGGGGTGG - Intronic
1165105964 19:33469876-33469898 GAGGGCTGGCAGCATGATGGGGG - Intronic
1165738650 19:38193032-38193054 GAGCGCTTTGATCAGAAAGGAGG + Intronic
1165813085 19:38624118-38624140 GAGGGCCTTCAGCAGGATCTGGG - Exonic
1165893921 19:39130315-39130337 GAGGGGTTGGGGCTGGATGGTGG + Intronic
1165940124 19:39410660-39410682 GAGGCCTGAGAGCAGGAGGGAGG - Intergenic
1166926676 19:46273714-46273736 GGCTGCTTTGAGCAGGATTGGGG + Intergenic
1167246044 19:48373787-48373809 GAGGGCTGTGAGCGGGAGGAGGG - Intronic
1167421160 19:49404183-49404205 GAGGACTTGGAGCTGGCTGGAGG + Intronic
1167488975 19:49781063-49781085 TAGGGCATTGAGGAGCATGGAGG + Intronic
1167494599 19:49810176-49810198 GAGGGCTGTGAGCAGGAAAGGGG + Intronic
1167566957 19:50262635-50262657 GAGGGCTGTGAGCAGGGGAGGGG + Intronic
1167631978 19:50631023-50631045 GAGGGCTGTGAGCAGGGGAGGGG - Intronic
925250884 2:2436349-2436371 GAGGGGTTTCAGCAGCAAGGTGG + Intergenic
926321732 2:11753095-11753117 GAGGGGGATGAGCAGGGTGGGGG + Intronic
926674100 2:15605131-15605153 GAGGGTTTTGAGCAGAGGGGTGG + Intronic
927253415 2:21018659-21018681 GAGGGCTAGGAGTAGGAGGGAGG - Intronic
927783488 2:25956736-25956758 CAGGGCTAGGAGGAGGATGGGGG + Intronic
927881987 2:26695437-26695459 GGAGGCTTTGAGGAGGAGGGGGG - Intronic
928332726 2:30369928-30369950 GAGGGCTAGGGGTAGGATGGGGG + Intergenic
928662140 2:33513633-33513655 TAGGACTTGGAGCAGGAGGGAGG - Intronic
929879184 2:45821635-45821657 GGGGGACTTGGGCAGGATGGTGG + Intronic
931106346 2:59060815-59060837 GAAGGCTTTGAACATGATGATGG + Intergenic
931712435 2:65000221-65000243 GAGGGCTCTGTGTAGGATGCTGG - Intronic
932347586 2:71005803-71005825 GAGGGGTTTGCGCAGGAGGCAGG - Intergenic
932461318 2:71883708-71883730 GTGGGCTGTGAGCTGGATGAAGG - Intergenic
934470916 2:94534142-94534164 GAGAGCTTTGAGGTGTATGGTGG - Intergenic
934471149 2:94538406-94538428 GAGAGCTTTGAGGACTATGGTGG - Intergenic
934471257 2:94540285-94540307 GAGAGCTTTGAGGACTATGGTGG - Intergenic
934471880 2:94552408-94552430 GAGCGCTTTGAGGCGTATGGTGG - Intergenic
935173095 2:100625975-100625997 GAGGGCTTGGAGCAGGGCAGGGG + Intergenic
935619709 2:105118094-105118116 ATGGGTTTTGAGCAGGATAGTGG - Intergenic
935945134 2:108279270-108279292 GAGGGCTGGGAGCAGGAGGCTGG + Intergenic
936868066 2:117099780-117099802 GAGGGATTTGGGCTGGAAGGAGG - Intergenic
937296297 2:120811710-120811732 AAGGGCTTTGAGCAGGGGAGGGG + Intronic
937659484 2:124414191-124414213 GATGGCTTTGAATAGGTTGGTGG + Intronic
938533050 2:132209991-132210013 GAGTGCTTTGAGCTCAATGGTGG + Intronic
938714033 2:134002450-134002472 GAGGGCCTTGAGCAGCACGGTGG + Intergenic
940014789 2:149092772-149092794 GAGGGCCCTGCTCAGGATGGTGG + Intronic
940099722 2:150020734-150020756 GAGAGCTGTCAGCTGGATGGTGG + Intergenic
940431623 2:153598128-153598150 GAGGGCTTTGAGCACAAGAGTGG - Intergenic
942912211 2:181257953-181257975 CAGGGCTTGGAGCATGAAGGAGG + Intergenic
942931250 2:181495992-181496014 GAGGGCTCCAAGCAGGATTGTGG - Intronic
945431681 2:209772094-209772116 GAGGGCCAGGAGCAGGACGGCGG + Exonic
946073903 2:217057834-217057856 GAGGTCTTAGAGCTGGAAGGAGG - Intergenic
946144469 2:217718565-217718587 TAAGGCTTTGAGGAGGCTGGAGG + Intronic
946458402 2:219848412-219848434 GAGGGGATGGAGCAGGATGGTGG + Intergenic
947528664 2:230894803-230894825 GTGGGCCTTGGGCAGGGTGGTGG + Intergenic
948414344 2:237791441-237791463 GAGGCTTCTGAGCAGGCTGGTGG - Intronic
948673752 2:239585021-239585043 GAGGGCTCCGAGCAGGTTGGGGG - Exonic
948886900 2:240889127-240889149 CAGGGCCTGGGGCAGGATGGAGG - Intronic
1168850084 20:970363-970385 GAGGGTTATCAGCAGGATGTGGG - Intronic
1169268207 20:4180540-4180562 GAGGGCCGTGAGCAAGAAGGCGG - Intronic
1171122515 20:22579048-22579070 GAGGGATTTAAGCGGGAGGGGGG + Intergenic
1171729402 20:28669166-28669188 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171730430 20:28688124-28688146 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171731371 20:28705126-28705148 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171731610 20:28709550-28709572 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1171731879 20:28714489-28714511 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171732213 20:28720641-28720663 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171732513 20:28726262-28726284 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171732529 20:28726603-28726625 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1171735084 20:28770590-28770612 GAGGGCTTTGTGGAGTATAGTGG - Intergenic
1171735178 20:28772293-28772315 GAGGGCTTTGTGGAGTATTGTGG - Intergenic
1171739359 20:28860917-28860939 GAGGGCTTTGAGGAACATTGTGG - Intergenic
1171739890 20:28870274-28870296 GAGTGCTTTGAGGACCATGGTGG - Intergenic
1171740959 20:28887857-28887879 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1171743724 20:28938049-28938071 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171762138 20:29214714-29214736 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1171765078 20:29258883-29258905 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1171808710 20:29720368-29720390 GAGAGCTTTGAGGCGTATGGTGG - Intergenic
1171822163 20:29860857-29860879 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1171824815 20:29885927-29885949 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1171826368 20:29913235-29913257 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1171827032 20:29926403-29926425 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1171828123 20:29948113-29948135 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1171832623 20:30035050-30035072 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1171836558 20:30157131-30157153 GAGAGCTTTGAGGACTATGGTGG - Intergenic
1171912625 20:30978048-30978070 GAGAGCTTTGAGCCCTATGGAGG - Intergenic
1171914078 20:30997792-30997814 GAGAGCTTTGAGGACTATGGTGG - Intergenic
1172013958 20:31862098-31862120 GAGGGCTCTCAGCAGGTTGAGGG - Intronic
1173087995 20:39942735-39942757 GAGGGCTGTGAGAATGAGGGAGG + Intergenic
1173233530 20:41222002-41222024 GAGGGCTTTGAGCAGAAGGTTGG + Intronic
1173415023 20:42847444-42847466 CAGGGCAGTGAGCAGGGTGGAGG + Intronic
1174609675 20:51788828-51788850 GTGGGCTTTCAGCAGGATGGGGG - Intronic
1175250747 20:57609008-57609030 GGGGGCTTTGAGCAGGAGAGGGG - Intronic
1175276213 20:57772655-57772677 AGGGGCTGTGAGCAGGATGATGG - Intergenic
1175843445 20:62046035-62046057 GAGGGCTTTCAGCGGCCTGGCGG - Intronic
1175891377 20:62317522-62317544 GGTGGCTGTGAGCAGGATGAGGG - Intronic
1176317862 21:5266565-5266587 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1176319596 21:5298139-5298161 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1176319828 21:5301898-5301920 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1176320340 21:5311813-5311835 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1176320421 21:5313516-5313538 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1176320490 21:5315117-5315139 GAGTGCTTTGAGGTGTATGGTGG - Intergenic
1176320860 21:5322244-5322266 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1176321961 21:5336405-5336427 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176322010 21:5337261-5337283 GAGGGCTTTGAGGCCGATGGTGG + Intergenic
1176375785 21:6086339-6086361 GGCGGCGTGGAGCAGGATGGAGG + Intergenic
1176475726 21:7203340-7203362 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1176477262 21:7232936-7232958 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1176477805 21:7243535-7243557 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1176477876 21:7245136-7245158 GAGTGCTTTGAGGTGTATGGTGG - Intergenic
1176478242 21:7252265-7252287 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1176479617 21:7268190-7268212 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176479666 21:7269046-7269068 GAGGGCTTTGAGGCCGATGGTGG + Intergenic
1176535793 21:8048946-8048968 GAGGGCTTTGTGGAGTATAGTGG - Intergenic
1176758829 21:10752277-10752299 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1176759085 21:10757397-10757419 GAGGGCTTTGAGGCCAATGGTGG - Intergenic
1176759430 21:10764394-10764416 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1176762490 21:12969154-12969176 GAGAGCTTTGAGGACTATGGTGG - Intergenic
1177943578 21:27440642-27440664 GGTGGCTTTCAGTAGGATGGAGG - Intergenic
1179488521 21:41726204-41726226 GAGGGCCTCGACCAGGCTGGAGG - Intergenic
1179747689 21:43451905-43451927 GGCGGCGTGGAGCAGGATGGAGG - Intergenic
1180159257 21:45991834-45991856 GAGGTCTTTGTGCAGGGTTGTGG + Intronic
1180395507 22:12330239-12330261 GAGCGCTTTGAGGCGTATGGTGG - Intergenic
1180395523 22:12330580-12330602 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1180398323 22:12380195-12380217 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1180398362 22:12380880-12380902 GAGGGCTTTGAGGCCGATGGTGG + Intergenic
1180400005 22:12407319-12407341 GAGGACTTTGAGAAGTATAGTGG + Intergenic
1180400031 22:12407829-12407851 GAGCACTTTGAGCACTATGGTGG + Intergenic
1180400093 22:12409022-12409044 GAGGACTTTGAGAAGTATAGTGG + Intergenic
1180402742 22:12505571-12505593 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1180404223 22:12534171-12534193 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1180404239 22:12534512-12534534 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1180425434 22:15175009-15175031 GAGAGCTTTGAGGCGTATGGTGG - Intergenic
1180427340 22:15209858-15209880 GAGTGCTTTGAGCACAATGGTGG - Intergenic
1180505633 22:15997607-15997629 GAGAGCTTTGAGGCGTATGGTGG - Intergenic
1180508764 22:16050937-16050959 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1180509322 22:16062023-16062045 GAGCGCTTTGAGGCGTATGGTGG - Intergenic
1180509794 22:16069671-16069693 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1180510591 22:16084245-16084267 GAGTGCTTTGAGCCCAATGGTGG - Intergenic
1182109631 22:27713743-27713765 GAGGGCTTTGAGCAAGGGAGTGG + Intergenic
1182593577 22:31400457-31400479 GAGGGAAATGAGCTGGATGGAGG + Intronic
1182775382 22:32827677-32827699 GAGGGCTTTGAGCAGGGCATTGG - Intronic
1182786501 22:32912188-32912210 CAGAGCTTTGGGCACGATGGAGG + Intronic
1183386918 22:37519902-37519924 GGGGGCTTTCTGCAAGATGGGGG + Intergenic
1183636110 22:39063801-39063823 GAGGGGCATGAGCAGGAGGGAGG - Intronic
1183830385 22:40415764-40415786 GAGGCCTGGGAGCAGGGTGGGGG - Intronic
1184101210 22:42342627-42342649 GAGGGCTCTGTCCAGCATGGTGG - Intronic
1184474325 22:44712373-44712395 GGAGGCTCTGAGCAGCATGGGGG - Intronic
1184802154 22:46767972-46767994 GAGGGCTTTGAGCAGAGAAGTGG + Intronic
1185239236 22:49733758-49733780 CAGGGCTTTGAGCTGGATGCAGG + Intergenic
1203331534 22_KI270738v1_random:96945-96967 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1203333025 22_KI270739v1_random:24440-24462 GAGAGCTTTGAGGCGTATGGTGG + Intergenic
950556618 3:13699813-13699835 GAGGGCTGTGAGGATGATAGTGG + Intergenic
951814575 3:26739607-26739629 GTGTGCTTTTAGCATGATGGAGG - Intergenic
952183521 3:30944008-30944030 AAGGGATCTGAGCAGAATGGTGG - Intergenic
953929296 3:46997937-46997959 AAGGGTTCTGAGCAGGCTGGTGG + Intronic
954148327 3:48645316-48645338 CAGGGTTTTCAGCAGGATGCTGG - Intronic
954440755 3:50520843-50520865 CAGGGCCTGGAGCAGGATGTAGG - Intergenic
954619044 3:51985419-51985441 GTGGGAGTTGAGCAAGATGGAGG - Exonic
954626499 3:52024724-52024746 GAGGCCTTTGAGCAGGGGTGAGG + Intergenic
954803765 3:53202986-53203008 GGGGGCTTTTAGAAGGTTGGAGG + Intergenic
955123080 3:56081142-56081164 TAGGGCTTTAAGAAGGATGTAGG - Intronic
958203285 3:90351162-90351184 GAGTGCTTTGAGGACTATGGTGG - Intergenic
958206437 3:90402328-90402350 GAGTGCTTTGAGCCCTATGGTGG - Intergenic
958209098 3:90445541-90445563 GAGGGCTTTGAGGTGTGTGGTGG - Intergenic
958210666 3:90469718-90469740 GAGGGCTTTGAGGTCTATGGTGG - Intergenic
961134214 3:124495045-124495067 GTGGGCTTGGTACAGGATGGGGG + Intronic
961500105 3:127326405-127326427 GAGGTAGGTGAGCAGGATGGAGG - Intergenic
961501939 3:127342515-127342537 GAGGACCTTCAGCAGGATGTGGG + Intergenic
961826586 3:129602342-129602364 GAAGGCTGTGAGCAGGCTCGAGG - Intronic
962744297 3:138386220-138386242 GGGGGTTTTGAGCAGGGTTGGGG - Intronic
965771298 3:172184166-172184188 AAGGGCTTTGAGGGGAATGGGGG - Intronic
967626339 3:191689193-191689215 TAGGGATTTGGTCAGGATGGTGG - Intergenic
968713591 4:2138400-2138422 GAGGGATGAGAGCAGGAAGGTGG + Intronic
969318680 4:6397200-6397222 AGGGGCTTTGTGCAGGATGAGGG - Intronic
970360635 4:15305454-15305476 GACTGCTTTGAGATGGATGGGGG - Intergenic
971349468 4:25843352-25843374 GACGGCTTAGACCAGGATGACGG + Intronic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
972453930 4:39233238-39233260 GAGGGCCTAGAGCAGGATGAAGG + Intronic
973950284 4:56006177-56006199 GAGGGAGTTGAGCAAGATGAAGG - Intronic
976184117 4:82429024-82429046 GAGGGGTTGGAGGAGGAGGGCGG - Intronic
979059843 4:116043832-116043854 GAGGGCCTTCAGCAGGATCTGGG + Intergenic
981065937 4:140485955-140485977 GAGGGTTTTGAGCAGGGGAGAGG - Intronic
981730533 4:147892554-147892576 GTGGGAGTTGAGCAGCATGGGGG + Intronic
982346613 4:154367208-154367230 GAGGGCTTTGAGCACAAGAGTGG + Intronic
982395617 4:154912134-154912156 GAGTGATATGAGCAAGATGGCGG - Intergenic
982544236 4:156712601-156712623 CTGGTCTTTGAACAGGATGGGGG + Intergenic
983003218 4:162446756-162446778 GATGGCTTTGAGAACTATGGAGG + Intergenic
984593933 4:181646063-181646085 CAGGGCTTTGCGCATGTTGGAGG - Intergenic
985009526 4:185568330-185568352 GTGGTCCTAGAGCAGGATGGTGG + Intergenic
985091296 4:186364863-186364885 GGGGGATTTGAGGAGGATGAAGG - Intergenic
985359039 4:189152963-189152985 GCAGGCTTGGATCAGGATGGCGG + Intergenic
985950268 5:3217572-3217594 GCTGGCTTTGAACAGAATGGAGG - Intergenic
985985304 5:3510752-3510774 CAGGGCTGGCAGCAGGATGGGGG + Intergenic
985997388 5:3604549-3604571 GAGGGCGGTGGGCAGGATGGTGG - Intergenic
987056720 5:14200228-14200250 AAGGGCCCTGAGAAGGATGGAGG - Intronic
987492557 5:18599067-18599089 AAGGGCTTTGAGGAGAATGGAGG + Intergenic
988523111 5:31963879-31963901 CATGGCATTGAGAAGGATGGGGG - Intronic
988787923 5:34581178-34581200 GAGGGCTTTAAGCAGGGGCGTGG - Intergenic
989859235 5:46345325-46345347 GAGTGCTTTGAGCCTTATGGTGG - Intergenic
989862782 5:46402088-46402110 GAGGGCTTTGAGGGCTATGGTGG + Intergenic
989926229 5:49880372-49880394 GAGCGCTTTGAGGACTATGGTGG + Intergenic
989944164 5:50197550-50197572 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
989944616 5:50206057-50206079 GAGGGCTTGGAGGTGTATGGTGG - Intergenic
989944980 5:50212899-50212921 GAGTGCTTTGAAGAGTATGGTGG - Intergenic
989945739 5:50226089-50226111 GAGTGCTTTGAGGACTATGGTGG - Intergenic
990646783 5:57854463-57854485 GAGAGCTGTTAGCAGGAAGGAGG + Intergenic
991450229 5:66743503-66743525 AAGTGCTTTGGGCAGGTTGGTGG + Intronic
991472587 5:66984871-66984893 GAGGGCGGGGAGCAGGATCGTGG + Intronic
992471602 5:77061764-77061786 GAGGGCCTGGGGAAGGATGGTGG + Exonic
993589713 5:89778892-89778914 AAGGGCTTAGAACTGGATGGTGG + Intergenic
993739305 5:91518068-91518090 GAGGGTTTTGGGCAGGATATTGG + Intergenic
996092265 5:119362819-119362841 GATGGTTTTCAGCTGGATGGAGG + Intronic
996490161 5:124085489-124085511 GAGGGCTTTGTGAAGCTTGGAGG - Intergenic
996651439 5:125881613-125881635 GAGGGTTTTGAGGAGGATAATGG + Intergenic
998135543 5:139672520-139672542 AAGGGTTTTGAGCAGGACGCAGG - Intronic
998350663 5:141498506-141498528 GAGGGCAGTGGGCAAGATGGTGG - Intronic
998369622 5:141652401-141652423 GGGGGCTTGGACTAGGATGGTGG - Intergenic
999325384 5:150640519-150640541 GAGGGTTTTGAGCAGGAGAGAGG + Intronic
1001147385 5:169196709-169196731 AAAGGCTTTGAGTAGCATGGTGG - Intronic
1001723608 5:173877377-173877399 GGGGGCTTTGCGCAGGTGGGTGG + Intergenic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1001768307 5:174272701-174272723 GTGGGCTCAGAGCAGGCTGGGGG - Intergenic
1001876587 5:175206825-175206847 GAGGGCTTAGACCAGGAGGTGGG + Intergenic
1002592448 5:180300034-180300056 GAGGGCATAGGACAGGATGGTGG + Intergenic
1002592463 5:180300104-180300126 GAGGGCATAGGACAGGATGGTGG + Intergenic
1003264110 6:4550712-4550734 GAGGGTGTTGAGGAGGATGTGGG - Intergenic
1003360336 6:5419799-5419821 GTGGGCTTGGGGCAGGAGGGAGG - Intronic
1003598223 6:7493990-7494012 AAGGGCCTTGACCAGGGTGGTGG - Intergenic
1003723905 6:8737169-8737191 GAGGGATTTGAAAAGGATTGAGG - Intergenic
1003981825 6:11397047-11397069 GGGGGCTTGGATCAGGGTGGTGG + Intergenic
1005453287 6:25994230-25994252 GAGGGCTTGGAGTGGGATGAGGG + Intergenic
1006183956 6:32169941-32169963 GAGGGCTTTGAGCAGTTCTGGGG - Exonic
1006427825 6:33977121-33977143 TGGGGCTGTGAGCAGGGTGGTGG - Intergenic
1007424677 6:41739334-41739356 TGGGGCTGTGTGCAGGATGGGGG - Intronic
1007772521 6:44202817-44202839 GAGGGGTTTGGGCAGGGAGGTGG - Intergenic
1007795388 6:44342846-44342868 GAGCACCTTGAGCTGGATGGGGG + Exonic
1008603289 6:53116564-53116586 GAGGGACTTGAGAAGGGTGGGGG + Intergenic
1009252705 6:61326931-61326953 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1009252870 6:61329831-61329853 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1009253354 6:61340410-61340432 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1009257391 6:61428752-61428774 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1009257556 6:61431652-61431674 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1009258040 6:61442231-61442253 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1009442502 6:63697566-63697588 GTTGGCTTTGAGCAGGGTTGTGG + Intronic
1015053005 6:128864403-128864425 AAGAGCTGTGAGCTGGATGGAGG + Intergenic
1015250621 6:131124002-131124024 GAGCGGAGTGAGCAGGATGGCGG - Intergenic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1019898295 7:4000069-4000091 GAGGGCCTGGAGCAGGAAGGTGG + Intronic
1021194035 7:17654411-17654433 GGGATCTTTTAGCAGGATGGTGG - Intergenic
1022112040 7:27237805-27237827 GTGGCCTTTGAGCTGGAGGGAGG + Intergenic
1022131845 7:27411884-27411906 GAGGGCTTTGAGGAGGAATGTGG - Intergenic
1024353781 7:48394227-48394249 GAGGGTTTTGAGGTGGAAGGGGG - Intronic
1024554481 7:50591775-50591797 GGGGGTTTTCAGCAGGACGGAGG + Exonic
1025308003 7:57883962-57883984 GAGGGCTTTGAGGCCTATGGTGG - Intergenic
1025308110 7:57886011-57886033 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1025308222 7:57888057-57888079 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1025308575 7:57894530-57894552 GAGGGCTTTGAGGCCCATGGTGG + Intergenic
1025308888 7:57900657-57900679 GAGTGCTTTGAGGATTATGGTGG + Intergenic
1025309142 7:57905769-57905791 GAGCGCTTTGAGGAGTATTGTGG - Intergenic
1025309546 7:57913794-57913816 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1025310027 7:57923459-57923481 GAGGGCTTTGAGGAATATGATGG + Intergenic
1025310967 7:57941381-57941403 GAGCGCTTTTAGCACTATGGTGG - Intergenic
1025312740 7:57970045-57970067 GAGCGCTTTGAGGCGTATGGTGG - Intergenic
1025313283 7:57980286-57980308 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1025313378 7:57982211-57982233 GAGCGCTTTGAGGACGATGGTGG - Intergenic
1025313958 7:57993350-57993372 GAGGGCTTTGAGGCCCATGGTGG - Intergenic
1025314277 7:57999427-57999449 GAGTGCTATGAGCACTATGGTGG + Intergenic
1025314291 7:57999769-57999791 GAGCGCTTTGAGAACTATGGTGG + Intergenic
1025490556 7:61115136-61115158 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025490719 7:61117871-61117893 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025490877 7:61120606-61120628 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025491041 7:61123340-61123362 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025491203 7:61126074-61126096 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025491364 7:61128808-61128830 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025491519 7:61131542-61131564 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025491679 7:61134276-61134298 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025491976 7:61139402-61139424 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025492149 7:61142306-61142328 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025492306 7:61145040-61145062 GAGGGCTTTGAGGACCATTGTGG + Intergenic
1025492470 7:61147774-61147796 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025492632 7:61150508-61150530 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025492792 7:61153241-61153263 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025492947 7:61155975-61155997 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025493270 7:61161443-61161465 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025493434 7:61164177-61164199 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025493595 7:61166911-61166933 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025493753 7:61169645-61169667 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025493911 7:61172379-61172401 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025493958 7:61173235-61173257 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025494118 7:61175969-61175991 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025494274 7:61178703-61178725 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025494434 7:61181437-61181459 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025494576 7:61183830-61183852 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025494737 7:61186564-61186586 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025494895 7:61189297-61189319 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025495053 7:61192030-61192052 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025495226 7:61194936-61194958 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025495386 7:61197670-61197692 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025495548 7:61200404-61200426 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025495711 7:61203138-61203160 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025496191 7:61211339-61211361 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025496353 7:61214073-61214095 GAGGGCTTTGAGGACCATTGTGG + Intergenic
1025496517 7:61216807-61216829 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025496679 7:61219541-61219563 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025496836 7:61222274-61222296 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025496998 7:61225008-61225030 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025497158 7:61227742-61227764 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025497335 7:61230817-61230839 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025497494 7:61233551-61233573 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025497654 7:61236285-61236307 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025497815 7:61239019-61239041 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025497964 7:61241753-61241775 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025498126 7:61244487-61244509 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025498287 7:61247221-61247243 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025498449 7:61249955-61249977 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025498601 7:61252688-61252710 GAGGGCTTTGAGGACCATTGTGG + Intergenic
1025498763 7:61255422-61255444 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025498936 7:61258498-61258520 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025499097 7:61261232-61261254 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025500079 7:61278222-61278244 GAGTGCTTTGAGGAGTATGGTGG + Intergenic
1025500281 7:61282312-61282334 GAGGGCTTTGAGGACTATGGTGG + Intergenic
1025500501 7:61286904-61286926 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1025500639 7:61289609-61289631 GAGGGCTTTGAGGTCTATGGTGG + Intergenic
1025503267 7:61384739-61384761 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025503429 7:61387475-61387497 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025503587 7:61390209-61390231 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025503746 7:61392943-61392965 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025503904 7:61395677-61395699 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025504065 7:61398411-61398433 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025504225 7:61401145-61401167 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025504388 7:61403879-61403901 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025504553 7:61406613-61406635 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025504713 7:61409347-61409369 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025504875 7:61412081-61412103 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025505034 7:61414814-61414836 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025505198 7:61417549-61417571 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025505361 7:61420283-61420305 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025505524 7:61423014-61423036 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025505690 7:61425748-61425770 GAGGGCTTTGAGGACCACGGCGG + Intergenic
1025505852 7:61428482-61428504 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025506028 7:61431387-61431409 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025506187 7:61434121-61434143 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025506352 7:61436855-61436877 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025506506 7:61439589-61439611 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025506671 7:61442322-61442344 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025506828 7:61445056-61445078 GAGGGCTTTGAGAACCATTGCGG + Intergenic
1025507151 7:61450539-61450561 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025507479 7:61456008-61456030 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025507646 7:61458747-61458769 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025507809 7:61461481-61461503 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025507970 7:61464216-61464238 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025508131 7:61466950-61466972 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025508292 7:61469684-61469706 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025508613 7:61475152-61475174 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025508770 7:61477886-61477908 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025508932 7:61480619-61480641 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025509098 7:61483362-61483384 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025509258 7:61486094-61486116 GAGGGCTTTGAGGACCATTGTGG + Intergenic
1025509417 7:61488829-61488851 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025509574 7:61491564-61491586 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025509736 7:61494297-61494319 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025509897 7:61497031-61497053 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025510058 7:61499766-61499788 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025510220 7:61502500-61502522 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025510386 7:61505235-61505257 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025510545 7:61507970-61507992 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025510717 7:61510701-61510723 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025510871 7:61513436-61513458 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025511027 7:61516171-61516193 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025511191 7:61518906-61518928 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025511357 7:61521641-61521663 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025511526 7:61524375-61524397 GAGGGCTTTGAGGACCATTGAGG + Intergenic
1025511685 7:61527111-61527133 GAGGGCTTTGAGGACCATTGCGG + Intergenic
1025514933 7:61624446-61624468 GAGTGCTTTGAGGAGTATGGTGG + Intergenic
1025515136 7:61628536-61628558 GAGGGCTTTGAGGACTATGGTGG + Intergenic
1025515359 7:61633128-61633150 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1025515498 7:61635833-61635855 GAGGGCTTTGAGGTCTATGGTGG + Intergenic
1025519245 7:61700097-61700119 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1025539275 7:62053272-62053294 GAGTGCTTTGAGGAGTATGGTGG + Intergenic
1025539476 7:62057362-62057384 GAGGGCTTTGAGGACTATGGTGG + Intergenic
1025539699 7:62061954-62061976 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1025539836 7:62064659-62064681 GAGGGCTTTGAGGTCTATGGTGG + Intergenic
1025543569 7:62128745-62128767 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1025570397 7:62555332-62555354 GAGTGCTTTGAGCACTATGGGGG - Intergenic
1025571083 7:62568494-62568516 GAGTGCTCTGAGGAGTATGGTGG - Intergenic
1026829024 7:73600356-73600378 GTGGGCTCTGAGTGGGATGGGGG + Intronic
1027141458 7:75660821-75660843 GAGGGCTTTGAGGATGAAGGGGG - Intronic
1029305741 7:99618610-99618632 AAGGGCTTAGATCAGGGTGGTGG - Exonic
1029746060 7:102516481-102516503 GAGGGGGTGGAGCAGGGTGGGGG - Intronic
1029763998 7:102615460-102615482 GAGGGGGTGGAGCAGGGTGGGGG - Intronic
1031258068 7:119482063-119482085 GAGGGGATGGAGCAGGAAGGTGG - Intergenic
1033540718 7:142353377-142353399 GAGGTTTATGAGCAGGAAGGAGG - Intergenic
1033544154 7:142384860-142384882 GAGGTTTATGAGCAGGAAGGAGG - Intergenic
1034128164 7:148692572-148692594 AAGGTCTTTGAGCAGGAAAGTGG + Intergenic
1034439089 7:151077469-151077491 GAGGGCTTTGCCCAGGGTGGTGG - Intronic
1034702855 7:153111338-153111360 GAGGGCATTGAACAGGAAGGAGG + Intergenic
1034889796 7:154829785-154829807 GAGGGCTTTGAGCAGGATGGAGG - Intronic
1035496601 7:159333237-159333259 GAGGGCTGTGAGGAGCAGGGTGG - Intergenic
1036634697 8:10540912-10540934 GAGGGCGGTGAGCAGGAAAGTGG - Intronic
1037692970 8:21198260-21198282 GAAGGCTTTGTGGAGGCTGGGGG - Intergenic
1037710012 8:21347986-21348008 AAGGGGTTTGAGCAGAGTGGGGG + Intergenic
1038029291 8:23622990-23623012 GACTGCTTTGAGCAGGAAGGTGG + Intergenic
1038059407 8:23895907-23895929 GAGAGTTTTGAGCAAGATGGTGG - Intergenic
1039374395 8:37018860-37018882 GAGGGCTTAGAACAGGATAAGGG - Intergenic
1040272658 8:45972128-45972150 GAGCGCTTTGAGGACTATGGTGG + Intergenic
1040272721 8:45973145-45973167 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1040619341 8:49072189-49072211 GAGGGCCTTTGGCAGGCTGGAGG + Intronic
1040896379 8:52373249-52373271 GGGGGCTTTGGGGAGGAGGGAGG - Intronic
1041724778 8:61007909-61007931 GAGGGCTTTGTGGAGGAAGCAGG + Intergenic
1042887431 8:73567860-73567882 GGGGGAGTTGGGCAGGATGGTGG + Intronic
1047754578 8:127908737-127908759 GTGGACTTTGAGTCGGATGGAGG + Intergenic
1048344688 8:133567805-133567827 GAGGGTTTTGAGGATGATGCTGG + Intronic
1049363926 8:142227339-142227361 TGGGGCTATGGGCAGGATGGGGG - Intronic
1049365697 8:142235861-142235883 GAGGGCTTCATGCAGGGTGGGGG + Intronic
1049551938 8:143264063-143264085 TAGGGGTTGGAGCAGGAAGGAGG - Intronic
1049825260 8:144663586-144663608 GAGGCCTAGGAGCAGGAAGGAGG - Intergenic
1049969375 9:807964-807986 GTGGGATTTGAGCAGGGGGGAGG - Intergenic
1050710500 9:8456599-8456621 GAGGGCTTGGAACTGTATGGAGG + Intronic
1051099791 9:13507577-13507599 GAGGGCCTTGAGTAGGGAGGTGG + Intergenic
1053073899 9:35116499-35116521 GAGGGCTCTGAGCCGGGTTGGGG + Intergenic
1053686643 9:40534572-40534594 GAGTGCTTTGAGGACTATGGTGG + Intergenic
1053712319 9:40830035-40830057 GAGAGCTTTGAGGACTATGGTGG + Intergenic
1053713730 9:40857807-40857829 GAGAGCTTTGAGGAGTATGGTGG + Intergenic
1053936141 9:43154262-43154284 GAGTGCTTTGAGCTCAATGGTGG + Intergenic
1053939012 9:43208501-43208523 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1054277155 9:63091475-63091497 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1054277550 9:63098980-63099002 GAGTGCTTTGAGCTCAATGGTGG - Intergenic
1054397287 9:64665950-64665972 GAGTGCTTTGAGCTCAATGGTGG + Intergenic
1054397682 9:64673454-64673476 GAGTGCTTTGAGGACTATGGTGG + Intergenic
1054421518 9:64936839-64936861 GAGTGCTTTGAGCCCAATGGTGG + Intergenic
1054421687 9:64939961-64939983 GAGGTCTTTGAGGACTATGGTGG + Intergenic
1054421931 9:64945173-64945195 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1054422859 9:64963283-64963305 GAGAGCTTTGAGGACTATGGTGG + Intergenic
1054424116 9:64988155-64988177 GAGAGCTTTGAGGAGTATGGTGG + Intergenic
1054431930 9:65171142-65171164 GAGTGCTTTGAGCTCAATGGTGG + Intergenic
1054432322 9:65178648-65178670 GAGTGCTTTGAGGACTATGGTGG + Intergenic
1054498062 9:65843028-65843050 GAGTGCTTTGAGGACTATGGTGG - Intergenic
1054498447 9:65850365-65850387 GAGTGCTTTGAGCTCAATGGTGG - Intergenic
1055647882 9:78377880-78377902 GATGGCTTGGACCAGGGTGGAGG + Intergenic
1056085721 9:83147794-83147816 GGTGGCTCTCAGCAGGATGGAGG + Intergenic
1056647317 9:88425139-88425161 GAGAGGTTTGGGCAGGCTGGGGG + Intronic
1056719339 9:89059313-89059335 GAGGACGTTGTGGAGGATGGTGG + Intronic
1056719457 9:89059788-89059810 GAGGACGTTGTGGAGGATGGTGG + Intronic
1057303594 9:93900092-93900114 GAAGGACTTGAGCAGGATGAGGG - Intergenic
1059235293 9:112755520-112755542 CAGGGTCTTGAGCAGGAGGGGGG + Intronic
1059401936 9:114076195-114076217 GGTGGCTTGGACCAGGATGGTGG + Intronic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1061002915 9:127912532-127912554 GTGGGCTTTGAGGCGGATGTGGG - Exonic
1061408879 9:130407573-130407595 GGGGTGTCTGAGCAGGATGGAGG + Intronic
1061865786 9:133491152-133491174 GAGGACTTGGAGGAGGAGGGAGG + Intergenic
1062249844 9:135588566-135588588 GGGGGCCTTGAGCTGCATGGAGG - Intergenic
1203341410 Un_KI270420v1:489-511 GAGGGCTTTGGGGATGGTGGTGG - Intergenic
1203379009 Un_KI270435v1:11535-11557 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1203379048 Un_KI270435v1:12216-12238 GAGGGCTTTGAGGCCGATGGTGG + Intergenic
1203379534 Un_KI270435v1:18890-18912 GAGGGCTTTGAGGACTAAGGTGG + Intergenic
1203379574 Un_KI270435v1:19575-19597 GAGGGCTTTGTGGCCGATGGTGG + Intergenic
1203380746 Un_KI270435v1:36554-36576 GAGGGTTTTGAGTCGTATGGTGG + Intergenic
1203357081 Un_KI270442v1:164885-164907 GAGGGCTTTGAGACCTATGGAGG + Intergenic
1203357601 Un_KI270442v1:174028-174050 GAGCGCTTTGAGGCGTATGGTGG + Intergenic
1203374452 Un_KI270442v1:353130-353152 GAGCGCTTTGAGGCCGATGGTGG + Intergenic
1203374604 Un_KI270442v1:356033-356055 GAGCACTTTGAGGAGTATGGTGG + Intergenic
1203396847 Un_KI270519v1:26799-26821 GAGGGCTTTGAGGCCAATGGTGG - Intergenic
1203397342 Un_KI270519v1:36159-36181 GAGGGCTTTGAGGACTAAGGTGG - Intergenic
1203397466 Un_KI270519v1:38172-38194 GAGGGCTTTGAGGCCGATGGTGG - Intergenic
1203397511 Un_KI270519v1:38857-38879 GAGGGCTTTGAGGACTAAGGTGG - Intergenic
1203398578 Un_KI270519v1:54385-54407 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1203411159 Un_KI270579v1:6029-6051 GAGCGCTTTGAGGACTATGGTGG - Intergenic
1203413504 Un_KI270589v1:21893-21915 GAGGGCTTTGAGGCTGATGGTGG - Intergenic
1203413598 Un_KI270589v1:23534-23556 GAGGGCTTGGAGGCCGATGGTGG - Intergenic
1203413827 Un_KI270589v1:28866-28888 GAGGGCTTTGAGGCCGATGGTGG - Intergenic
1203413972 Un_KI270589v1:31253-31275 GAGGGCTTTGAGGCTGATGGTGG - Intergenic
1203416335 Un_KI270591v1:995-1017 GAGGGCTTTGAGGCCCATGGTGG - Intergenic
1203416363 Un_KI270591v1:1511-1533 GAGCGCTTTGAGGACCATGGTGG - Intergenic
1203684307 Un_KI270757v1:28625-28647 GAGGGCTTTGAGGCTGATGGTGG + Intergenic
1203684452 Un_KI270757v1:31012-31034 GTGGGCTTTGAGGCCGATGGTGG + Intergenic
1203684713 Un_KI270757v1:35678-35700 GAGGGCTTGGAGGCCGATGGTGG + Intergenic
1203684807 Un_KI270757v1:37319-37341 GAGGGCTTTGAGGCTGATGGTGG + Intergenic
1203685439 Un_KI270757v1:50001-50023 GAGCGCTTTGAGGACCATGGTGG + Intergenic
1203685469 Un_KI270757v1:50517-50539 GAGGGCTTTGAGGCCCATGGTGG + Intergenic
1203685542 Un_KI270757v1:51793-51815 GAGGGCTTTGAGGACCATTGTGG + Intergenic
1185774899 X:2794270-2794292 GAGGGCTTTGAGCAGAAGAGGGG + Intronic
1186175604 X:6923016-6923038 GAGGACTTTGAGAACTATGGTGG - Intergenic
1186543284 X:10422706-10422728 GGGGGTTTTGGGCGGGATGGTGG + Intergenic
1187233671 X:17446170-17446192 GGCTGCTTTGAGCAGGATTGGGG - Intronic
1189920031 X:45894578-45894600 GGGGGCTTTTAGGAGGGTGGAGG - Intergenic
1190626066 X:52339935-52339957 GTAGGCTTTGAGAAGGAGGGAGG + Intergenic
1191273251 X:58507421-58507443 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1191273306 X:58508439-58508461 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1191286336 X:58736742-58736764 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1191439683 X:60787550-60787572 GAGGGCTTTGAGTACTGTGGTGG + Intergenic
1191502287 X:61624839-61624861 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1191525231 X:61932191-61932213 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1191549271 X:62253740-62253762 GAGGGCTTTGAGGACTGTGGTGG + Intergenic
1191573638 X:62666899-62666921 GAGTGCTTTGAGCCATATGGTGG + Intergenic
1191573732 X:62668769-62668791 GAGGGCTTTGAGGCCTATGGTGG + Intergenic
1191841884 X:65519141-65519163 GAGGGCTTTGTGCAGGAGGTAGG + Intronic
1191859767 X:65656754-65656776 GAGGGCTTTGTGCAGGAGGTAGG + Intronic
1192220525 X:69194691-69194713 AAGAGCTTTGATCAGGCTGGGGG - Intergenic
1192836086 X:74801420-74801442 GAGGGGTCAGAGCAAGATGGTGG + Intronic
1193014286 X:76714955-76714977 CAGGGCTTTGACCAGGATGATGG + Intergenic
1193729550 X:85086585-85086607 GAGGGCTTTAGTTAGGATGGTGG - Intronic
1196759305 X:119187011-119187033 GAGCACTTTGGGGAGGATGGTGG - Intergenic
1196810146 X:119622411-119622433 GAGGGCTTTGAGGAGGGGGCGGG + Intronic
1196854654 X:119971435-119971457 GAGAGTTTTGTGCAGGATGGAGG + Intergenic
1200034506 X:153319056-153319078 GAGGGCCTTGTCCAGGTTGGAGG - Intergenic
1200035118 X:153321634-153321656 GAGGCCCTGGAGCAGGAGGGTGG + Intergenic
1200118782 X:153780856-153780878 GTGGGCCTGGAGCAGGAGGGGGG + Intronic
1201079995 Y:10233061-10233083 GAGCGCTTTGAGAACTATGGTGG - Intergenic
1201080992 Y:10245892-10245914 GAGTGCTTTGAGATGTATGGCGG - Intergenic