ID: 1034889797

View in Genome Browser
Species Human (GRCh38)
Location 7:154829788-154829810
Sequence TGGGAGGGCTTTGAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 610
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 551}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889797_1034889810 26 Left 1034889797 7:154829788-154829810 CCATCCTGCTCAAAGCCCTCCCA 0: 1
1: 0
2: 3
3: 55
4: 551
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889797_1034889808 18 Left 1034889797 7:154829788-154829810 CCATCCTGCTCAAAGCCCTCCCA 0: 1
1: 0
2: 3
3: 55
4: 551
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889797_1034889811 27 Left 1034889797 7:154829788-154829810 CCATCCTGCTCAAAGCCCTCCCA 0: 1
1: 0
2: 3
3: 55
4: 551
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889797 Original CRISPR TGGGAGGGCTTTGAGCAGGA TGG (reversed) Intronic
900124477 1:1063338-1063360 TGGGCGGTCTCTGGGCAGGAAGG + Intergenic
900333733 1:2150404-2150426 AGGGAGGGCACTGATCAGGAAGG + Intronic
901015236 1:6225589-6225611 TGGGAGGGTCCTGGGCAGGAAGG - Intronic
901691089 1:10973843-10973865 GGGGAGGGCTAGGAGCAGGCAGG + Intronic
902858563 1:19227537-19227559 TTTGAGGCCTTTGTGCAGGAAGG + Intronic
903855887 1:26337356-26337378 TGGGTGGGCTACGAGAAGGAGGG - Exonic
905687296 1:39917713-39917735 TGAGAGGGCTTTCTGGAGGAGGG + Intergenic
905998182 1:42400311-42400333 TGGGAGGGCTTTAATCAGGGAGG + Intronic
906032745 1:42734108-42734130 TGGGAGAGGTCTGAGCATGAGGG + Exonic
906094790 1:43215318-43215340 TGGAAGGTCTTTGATAAGGATGG + Intronic
906196361 1:43932966-43932988 TGGGAGGGTTTTGAGCAGAATGG - Intergenic
906699828 1:47849845-47849867 TGGGTGGGGATGGAGCAGGAAGG - Intronic
907097566 1:51795598-51795620 TGGGAAGGCATGGAGGAGGATGG + Intronic
907334523 1:53691528-53691550 TGGGAGAGCATGGAGCAGCAGGG - Intronic
908440009 1:64143871-64143893 TGAGAGGGTTTTGAGCAGAAGGG + Intronic
908806224 1:67936221-67936243 TGGGATGGCCTTGAGCTGTATGG - Intergenic
908878638 1:68706230-68706252 TGTGAGGACTTTTAACAGGAGGG + Intergenic
909894961 1:81057379-81057401 AGGGAGGGCTTTCACCAGGCAGG - Intergenic
910502216 1:87905812-87905834 TGTGAGGGATTAGAGCATGAAGG - Intergenic
912178326 1:107187843-107187865 TGGCAGAGATTGGAGCAGGAAGG + Intronic
912305402 1:108561160-108561182 TGGGAGGGCTTAGAGCCAGATGG + Intronic
912385957 1:109271268-109271290 CGGCAGGGCTTTGAGAAGAAAGG + Exonic
912510588 1:110187630-110187652 TGGGAGGGCTCTGAGCAGTTTGG - Intronic
913070590 1:115294902-115294924 GTGGAGGGCTTTGAACAAGAGGG + Intronic
913099785 1:115552364-115552386 TAGGAGGACTTTAAGCAGGAGGG - Intergenic
913141241 1:115943253-115943275 TGGGAGGGCTTAGAGAATCAGGG - Intergenic
915286927 1:154859054-154859076 TTGGAGGGCTCAGAGCTGGATGG - Intronic
915310661 1:155004386-155004408 TGTGAGGGGTTAAAGCAGGATGG + Intronic
915456650 1:156044866-156044888 AGGTAGGGTTTGGAGCAGGAGGG - Intronic
915530379 1:156499620-156499642 TGGGGGGGCTTTTGGGAGGATGG - Intronic
915538633 1:156553213-156553235 CGGGAGGGTTTTGAGCCGGGAGG - Intronic
915570894 1:156744541-156744563 AGGCAGGGCTCTGTGCAGGAGGG + Intronic
915608449 1:156970403-156970425 TTGGAGATCTTTGAGGAGGATGG + Intronic
915897856 1:159825365-159825387 GGGGTGGGCTCTGGGCAGGAGGG - Intergenic
915953991 1:160208154-160208176 TGGGAGTGCTTTGAGAAGCCTGG - Intronic
916399408 1:164429817-164429839 CTGGAGGGTTTTGAGCAGGATGG + Intergenic
916693511 1:167213968-167213990 AGAGATGGCTTTGAGAAGGAAGG + Intergenic
917451556 1:175151533-175151555 ATGGTGGGCTTTGAGGAGGATGG + Intergenic
918537974 1:185595466-185595488 TGTGGGGACTTTGAGCTGGAGGG + Intergenic
919773020 1:201174809-201174831 TGGGAGGTCTTTGGTGAGGAGGG + Intergenic
920048665 1:203150254-203150276 AGGGATGGCTTTGTGGAGGAGGG - Intronic
920573102 1:207032820-207032842 TGGGAGGGGAATGAGCAGGGTGG + Intronic
920693457 1:208164212-208164234 TGGGAGGGGCTTGCCCAGGAAGG - Intronic
920905952 1:210168135-210168157 TGTGTGGGCTGGGAGCAGGAAGG + Intronic
920961951 1:210671376-210671398 TCTGAGGGCTTCCAGCAGGATGG + Intronic
921064312 1:211611894-211611916 TGGGAGGGCTTTGCGAAAAAGGG - Intergenic
921097672 1:211901335-211901357 TGGGAGTGCTGGGAGCAGGGAGG + Intergenic
922765066 1:228152304-228152326 TGGGAGGGCCTGGAGATGGAAGG + Intronic
922802710 1:228371582-228371604 TGAGGGGGCTTTGGCCAGGAGGG - Exonic
923122020 1:231000996-231001018 TGGGAGGGCTTTGGAGAGGAAGG + Intergenic
923425586 1:233865700-233865722 CTGGAGGGCTTGGAGAAGGATGG - Intergenic
924453162 1:244197715-244197737 TGGGAAGGCTTTTAGGAGGTAGG + Intergenic
924908224 1:248480120-248480142 TGGCAGGTCTCTGTGCAGGAAGG + Intergenic
924915881 1:248567964-248567986 TGGCAGGTCTCTGTGCAGGAAGG - Intergenic
1062772690 10:115575-115597 TGGGAGGGCTGGAAGCAGGGTGG + Intergenic
1062862587 10:822241-822263 TGGGAGGGGTGTGAGACGGATGG + Intronic
1062942542 10:1435083-1435105 TGGGAGGCCGTGGAGCACGAGGG + Intronic
1063190616 10:3690718-3690740 TGTGAGGTCTTTGGGCAGGTGGG + Intergenic
1063371917 10:5527657-5527679 GTGGGGGGCTGTGAGCAGGAGGG + Intergenic
1064558312 10:16569927-16569949 TGGAAGGAATTTGAGCAGAAGGG - Intergenic
1065133744 10:22648061-22648083 CAGGAAGGCTTTGAGGAGGAAGG - Intronic
1065664915 10:28048746-28048768 TAGGAGTGCTTTCAGCAGCAAGG + Intergenic
1065918110 10:30368936-30368958 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1065980615 10:30892102-30892124 TGGCAGGGCTTTGATCAGTTTGG + Intronic
1066792159 10:39077496-39077518 TGGGAGGACTTTGAGGACTATGG + Intergenic
1066801221 10:39193504-39193526 TGGGAGGTCTTTGAGGACAATGG - Intergenic
1066817160 10:39434237-39434259 TGGGAGCGCTTTGAGCCCTACGG - Intergenic
1067007689 10:42680395-42680417 TGGGAGGGTTCTGAGCAGAGAGG - Intergenic
1067474246 10:46555982-46556004 CGGGTGGGCTTTGTGCAGGAGGG - Intergenic
1067557365 10:47282325-47282347 TGGGAGGGCAGTCAGCAGGAAGG - Intergenic
1068725612 10:60298835-60298857 TGGGAAGGGTTTGAGCAATAAGG - Intronic
1071318290 10:84424902-84424924 GGGCTGGGTTTTGAGCAGGAAGG + Intronic
1071366798 10:84908241-84908263 TGGGAGGGCCGTGAGCAGGTGGG + Intergenic
1072330247 10:94341463-94341485 TTGGAGAGTTTTAAGCAGGAGGG - Intronic
1072517707 10:96202224-96202246 TTGGAGGGTTTTGAACAGGGGGG + Intronic
1073443115 10:103564493-103564515 GGGGAAGGCTGTGTGCAGGAGGG - Intronic
1073470191 10:103717380-103717402 AGGGAGGGCTTTCTGGAGGAGGG + Intronic
1074187424 10:111108748-111108770 TGGGTGGGGGTTGGGCAGGAGGG + Intergenic
1074492136 10:113947604-113947626 TGGGGAAGCTTGGAGCAGGAGGG + Intergenic
1075140463 10:119829640-119829662 TGGGCGGGCCTTGAGCAGGAAGG + Exonic
1075355986 10:121776322-121776344 TAGGAGGGATTTGGGCAGGATGG - Intronic
1075616425 10:123893364-123893386 GGGCAGGGCTTGGACCAGGAAGG + Intronic
1075714984 10:124550828-124550850 TGGCAGGGCCGTGGGCAGGAGGG - Intronic
1075811850 10:125230051-125230073 TGGCTGGGCTGGGAGCAGGAGGG - Intergenic
1076217957 10:128710994-128711016 AGGGAGGGCTTGCAGGAGGAGGG + Intergenic
1076333673 10:129690895-129690917 GGGGAGGCTTGTGAGCAGGATGG + Intronic
1076663278 10:132069402-132069424 TGGGGTGGGTCTGAGCAGGAAGG + Intergenic
1077145463 11:1042379-1042401 TGAGGGGGCTTTGAGGAGGGTGG + Intergenic
1077247809 11:1547773-1547795 TGGGGGGGCTTTGAGGCTGAAGG - Intergenic
1077482339 11:2821650-2821672 TGGGAGGGTTTCCAGCAGAAGGG - Intronic
1077871700 11:6268345-6268367 TGAGAGGGATTAGAGCTGGAAGG - Intronic
1078672807 11:13379800-13379822 TGGGCAGGCTTTGTGTAGGAAGG + Intronic
1078999929 11:16743358-16743380 TGGGAGAGCCATCAGCAGGAAGG - Intronic
1081642059 11:44762893-44762915 TGGGAGGGATGTAAGCAGGAAGG - Intronic
1082146204 11:48672838-48672860 TGGGAGCGCATTGAGCACTATGG + Intergenic
1082150510 11:48733390-48733412 TGGGAGAGCTTTGAGGACTATGG + Intergenic
1082261986 11:50083476-50083498 TGGGAGGGTTCTGAGCAGAGAGG - Intergenic
1082292633 11:50396876-50396898 TGGGAGCGCTTTGAGGACAATGG + Intergenic
1082298678 11:50477138-50477160 TGGGAGTGCTTTGAGGTGTATGG - Intergenic
1082464513 11:53152272-53152294 TTGGAGGGCTTTGAGGCGGGTGG + Intergenic
1082585137 11:54928007-54928029 TGGGAGTGCTTTGAGGAATATGG - Intergenic
1082589049 11:54982484-54982506 TGGGAGTGCATTGAGCACTATGG + Intergenic
1082592472 11:55029656-55029678 TGGGAGAGCTTTGAGTTGTATGG - Intergenic
1082600143 11:55139142-55139164 TGGGAGAGCTTTGAGGACTATGG - Intergenic
1083237710 11:61362214-61362236 TGGGAGGGCCCGGAGCAGGCCGG + Exonic
1083422208 11:62560359-62560381 TGGGAGCACTTTGATAAGGACGG - Exonic
1083571898 11:63765533-63765555 TGGAAAGGCTTGGAGCAGGGAGG - Intronic
1083671217 11:64300780-64300802 TGCGAGGGCTTCGACGAGGAGGG + Exonic
1083715460 11:64572701-64572723 CTGGAGGGCTTTCAGCAGGGAGG - Exonic
1083993325 11:66259607-66259629 CTGGAGGGCTTTAAGCAGGCAGG + Intronic
1084145889 11:67265288-67265310 TGGGTGGGCTCTCAGCAGGGTGG + Intergenic
1084573598 11:69975017-69975039 TGGGAGGGGCTGGAGCTGGAGGG + Intergenic
1084682595 11:70675540-70675562 TGGGAGGGCTGTGAGCTGTCGGG - Intronic
1086064042 11:82728479-82728501 TGGTATGGCTTTGAACAGGCTGG - Intergenic
1087950029 11:104209636-104209658 TGGGAGGGTTTGGAGGAGGTGGG - Intergenic
1088910476 11:114187152-114187174 TGGGCGAGCTGTGAGTAGGATGG + Intronic
1089402594 11:118173014-118173036 GGGGAGGCCCTTGAGCAGGAAGG - Intronic
1090316499 11:125794538-125794560 TTTGAGGGCTTTGAACATGAAGG + Intergenic
1090373148 11:126270732-126270754 TTGGAGGGTTTTAAGCAAGAGGG + Intronic
1090667597 11:128925057-128925079 TAGGAGGGATTTGTCCAGGATGG - Intergenic
1091011449 11:132004852-132004874 TGGTAGTCCTTTGAGCAGCATGG + Intronic
1091103270 11:132895600-132895622 TGGGAGGGCTCTGATGAGGCTGG + Intronic
1092237898 12:6821513-6821535 AGGGAGGGCGGTGAGGAGGATGG - Intergenic
1092283758 12:7116707-7116729 TGGGAGGGCTGTGAGCACTGAGG + Intergenic
1093253480 12:16837324-16837346 TTGGAGAGGTTTGAGCAGAAAGG - Intergenic
1094399976 12:30052245-30052267 TGAAACAGCTTTGAGCAGGATGG + Intergenic
1094439323 12:30457255-30457277 TGGGAGGGATGTCAGCAAGATGG - Intergenic
1094500254 12:31015318-31015340 TGGGAGAGCGGTGTGCAGGACGG - Intergenic
1095057655 12:37634045-37634067 TGGGAGCGCTTTGAGGACTATGG - Intergenic
1095066649 12:37786508-37786530 TAGGAGCGCTTTGAGGAGTATGG + Intergenic
1095070466 12:37837582-37837604 TGGGAGTGCTTTGAGGTGTATGG + Intergenic
1095070666 12:37840472-37840494 TGGGAGGGCGTTGAGGACTATGG + Intergenic
1095078243 12:37961116-37961138 TGGGAGTGCCTTGAGCACTATGG + Intergenic
1095078701 12:37968856-37968878 TGGGAGTGCTTTGAGGACTATGG + Intergenic
1095847315 12:46759674-46759696 TGGGAGGGGTTGGGGCAGAATGG + Intergenic
1096650614 12:53060367-53060389 GAGGTGGGCTGTGAGCAGGATGG - Intronic
1097885400 12:64723928-64723950 TAGGAGGTTTTTGAGCAGGGAGG + Intronic
1097915046 12:65012356-65012378 TGTGAGGGCTTTACGCATGAAGG + Intergenic
1099800007 12:87444826-87444848 TGTGAGGTCTGTGAGCAGGTAGG - Intergenic
1100973187 12:100093573-100093595 TAGGATGGATTTGAACAGGAAGG - Intronic
1102251064 12:111387959-111387981 TGGAAAGGCTTTGGGCAAGAGGG - Intergenic
1102858129 12:116312492-116312514 TGGGAGAGCTTGGACCAGTAAGG + Intergenic
1102940446 12:116936879-116936901 TTGGAGTGCTTTGAGCAGAGGGG + Intronic
1103397511 12:120619373-120619395 TGGGAGGGTTTGCAGGAGGAAGG + Intergenic
1103566665 12:121819601-121819623 CCTGAGGACTTTGAGCAGGACGG + Exonic
1103858519 12:123992333-123992355 TGGCAGGGCTGTGCACAGGAGGG + Intronic
1104287096 12:127433266-127433288 TGGCAGGGCTCTCAGCAGAAAGG - Intergenic
1104619905 12:130303004-130303026 CTGGAGGGCTTTGTGCAGGAGGG + Intergenic
1106682500 13:32022578-32022600 AGGCAGGGCTTTGTGTAGGAGGG - Intergenic
1107444330 13:40457020-40457042 TGGCAGTGCTTGGAGCAGGCAGG - Intergenic
1107929898 13:45298632-45298654 TGAAAGGGCCTTGAGTAGGAGGG - Intergenic
1110296958 13:73878807-73878829 TGGGAGAGCTGTGAGTAGGCAGG + Intronic
1110574368 13:77038860-77038882 TGAGAGGGCATTGACTAGGACGG - Intergenic
1110810509 13:79807049-79807071 AGGGAGGATTTAGAGCAGGAAGG + Intergenic
1112459463 13:99590501-99590523 AGGGAGGGGTTTGAGTTGGATGG - Intergenic
1112724438 13:102286305-102286327 TGGGTGAGCTTTGGGCAGCAGGG - Intronic
1113304049 13:109057544-109057566 TTGCAGGGCTTTGGGAAGGACGG + Intronic
1113565934 13:111319870-111319892 CGGGAGGTTTGTGAGCAGGAAGG - Intronic
1114002827 14:18279066-18279088 TTGGAGTGCTTTGAGCACAATGG - Intergenic
1114517471 14:23309059-23309081 TGGGTGGGCATGGAACAGGATGG + Exonic
1115801593 14:37000393-37000415 TTGGAGGGTTTTGAGCATGGTGG - Intronic
1117066245 14:52015266-52015288 TGGGTGGGCTCTGAGCAGATGGG + Exonic
1117317924 14:54592028-54592050 GGGGGGAGCTTTGAGGAGGAAGG - Intronic
1117503938 14:56381974-56381996 TGGGAAGGATATGAGGAGGAAGG - Intergenic
1118128812 14:62939191-62939213 TGAGAGAGCTTTAAGAAGGAAGG - Intronic
1118232271 14:63964277-63964299 TTGGAGTACTTTGAGCAGCATGG + Intronic
1118541617 14:66833951-66833973 TGCTAGGGCTTTGAACATGAAGG - Intronic
1120121832 14:80690030-80690052 TGGAAGGGGTTAGAACAGGATGG - Intronic
1120684911 14:87527272-87527294 TGGGTCAGCTTTGAGCAAGAAGG - Intergenic
1121504007 14:94462400-94462422 AGGGAGGGGTGTGAGCATGAAGG - Intergenic
1121526905 14:94625505-94625527 TTGGAAGGCTTTGAGGAGAATGG + Intergenic
1121620700 14:95346127-95346149 TGGGAGAGCTTGGGGCATGAAGG + Intergenic
1121873785 14:97432775-97432797 AGTGATGGCTTTGACCAGGATGG + Intergenic
1121977352 14:98417564-98417586 TGGGAGGGGCTTGAGGAGGTGGG - Intergenic
1122345098 14:101053715-101053737 TGGAAGGGTTGTGAGCAGGGGGG + Intergenic
1122740079 14:103867232-103867254 TGGGAAGGCTTCCAGCAGGAAGG - Intergenic
1122767589 14:104082605-104082627 CAGGAGGGCTTTGGGCAGGGTGG - Intergenic
1122796997 14:104210923-104210945 TGGGTGGGCCTTCAGCAGGGAGG + Intergenic
1122799017 14:104220684-104220706 TGAGAGGGCTTGGAGGGGGATGG + Intergenic
1123028944 14:105441459-105441481 CGGGGGGGCTTTTAACAGGAAGG + Intronic
1123038327 14:105480309-105480331 TGGGATGTTTCTGAGCAGGAGGG + Intergenic
1123583630 15:21738137-21738159 TTGGAGGGTTTGGAGGAGGAAGG + Intergenic
1123620280 15:22180740-22180762 TTGGAGGGTTTGGAGGAGGAAGG + Intergenic
1123666315 15:22611592-22611614 TGGAAGGGCTTTGAGGCAGAGGG - Intergenic
1123733283 15:23163528-23163550 TGGAAGGGCTTTGAGGCAGAGGG + Intergenic
1123751417 15:23360903-23360925 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1124283787 15:28384821-28384843 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1124298910 15:28526792-28526814 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1124320134 15:28706006-28706028 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1124482378 15:30089411-30089433 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1124488836 15:30141513-30141535 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1124512655 15:30340254-30340276 TGGTTGTGCTTTGAGCAGCAGGG - Intergenic
1124521199 15:30407798-30407820 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1124537461 15:30558422-30558444 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1124543919 15:30610477-30610499 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1124730260 15:32190496-32190518 TGGTTGTGCTTTGAGCAGCAGGG + Intergenic
1124754694 15:32396810-32396832 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1124761195 15:32449165-32449187 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1124777439 15:32599898-32599920 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1124959379 15:34383331-34383353 TGGCAGGGCTTTGAGGCAGAGGG - Intronic
1124976005 15:34529552-34529574 TGGCAGGGCTTTGAGGCAGAGGG - Intronic
1125506413 15:40270265-40270287 TGGGAGGGCTGTGAGGGGGGTGG - Intronic
1125745917 15:41997061-41997083 TGGGAGGGCATGGTGCTGGAAGG + Intronic
1126230385 15:46316558-46316580 TTGGAGTTCTTAGAGCAGGAAGG - Intergenic
1126908878 15:53398067-53398089 AGGGAGGGCTTTGTGAAGGATGG - Intergenic
1128145004 15:65328145-65328167 TAGGTGGGCTGTGGGCAGGAGGG + Exonic
1128674017 15:69595677-69595699 TGGGAGGGCATGGGGCAGGGAGG + Intergenic
1129037884 15:72661934-72661956 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1129151781 15:73693687-73693709 TTGCAGGGCTTTGATAAGGAAGG + Intronic
1129198709 15:73985958-73985980 AGGGAGGAGTTTGAGCAGGGAGG + Intronic
1129212005 15:74075293-74075315 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1129338187 15:74866706-74866728 TGGGAGGGCTCTCAGGAGGAAGG - Intronic
1129398398 15:75265792-75265814 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1129402006 15:75290067-75290089 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1129729131 15:77919614-77919636 TGGAAGGGCTTTGAGGCAGAGGG - Intergenic
1129839374 15:78734335-78734357 TGGAAGGGCTTTGAGGCAGAGGG + Intergenic
1130259725 15:82345699-82345721 TGGAAGGGCTTTGAGGCAGAGGG - Intronic
1130260684 15:82351962-82351984 TGGGAGGGTGAGGAGCAGGAGGG + Intergenic
1130268994 15:82433737-82433759 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1130280552 15:82517045-82517067 TGGGAGGGTGAGGAGCAGGAGGG - Intergenic
1130281508 15:82523310-82523332 TGGAAGGGCTTTGAGGCAGAGGG + Intergenic
1130471923 15:84233228-84233250 TGGGAGGGTGAGGAGCAGGAGGG - Intergenic
1130472881 15:84239493-84239515 TGGAAGGGCTTTGAGGCAGAGGG + Intronic
1130479417 15:84347799-84347821 TGGGAGGGTGAGGAGCAGGAGGG - Intergenic
1130480372 15:84354064-84354086 TGGAAGGGCTTTGAGGCAGAGGG + Intergenic
1130484590 15:84391622-84391644 TGGAAGGGCTTTGAGGCAGAGGG + Intergenic
1130491397 15:84434065-84434087 TGGAAGGGCTTTGAGGCAGAGGG - Intergenic
1130492353 15:84440330-84440352 TGGGAGGGTGAGGAGCAGGAGGG + Intergenic
1130503013 15:84513105-84513127 TGGAAGGGCTTTGAGGCAGAGGG - Intergenic
1130594221 15:85237865-85237887 TGGGAGGGTGAGGAGCAGGAGGG - Intergenic
1131152229 15:90054313-90054335 GCGGAGGGCTTGGTGCAGGAGGG + Intronic
1131373428 15:91903643-91903665 TGGGAGGCCTTTGTGGAGGGAGG + Intronic
1131510470 15:93047153-93047175 TGGGAGGCCTGAGAGGAGGAGGG + Intronic
1131691813 15:94835467-94835489 TGAGAGAGCTTTAAGAAGGAGGG - Intergenic
1132433020 15:101775784-101775806 TGGAAGGGCTTTGAGGCAGAAGG - Intergenic
1132599555 16:767705-767727 TGGGGGGGCGTGGAGGAGGAGGG + Intronic
1133401941 16:5494539-5494561 AGGGAGGTCTTGGAGCAAGAGGG + Intergenic
1134402621 16:13924026-13924048 TCGGTGGGCTTTGATCAGAAAGG - Intronic
1134532616 16:14996109-14996131 TGGGAGGACTCTGAGAAGGAAGG - Intronic
1135246212 16:20859514-20859536 GGGGAGGGCATAGAGCAGGGCGG - Exonic
1135875664 16:26197830-26197852 TGGGAGACTTTTAAGCAGGAAGG - Intergenic
1136741455 16:32533389-32533411 TGGGAGTGCTTTGAGAACTATGG - Intergenic
1137082566 16:36079647-36079669 TGGGAGGGCTTTGAGAACTATGG + Intergenic
1137372323 16:47919051-47919073 TGGGAGCCCTTTGGCCAGGAGGG + Intergenic
1137749339 16:50847553-50847575 TAGAAAGGCTTTGAGCAAGATGG - Intergenic
1139863417 16:70044610-70044632 TGGGAGGACTCTGAGAAGGAAGG + Intergenic
1140541161 16:75757547-75757569 CTGGAGGGCTTTGAGCAGCATGG + Intronic
1140582548 16:76248685-76248707 TGGGAAGGGTATGAGGAGGAAGG + Intergenic
1140944802 16:79757994-79758016 AGGGTGGTCTTTGACCAGGATGG - Intergenic
1141107373 16:81244639-81244661 CGGGTGGGCTGAGAGCAGGAGGG - Intronic
1141429290 16:83962842-83962864 AGGGAAGACTTTGAGTAGGACGG + Intronic
1141496636 16:84414847-84414869 TCGGAGGGTTTGGAGCAGGAGGG + Intronic
1142345733 16:89552917-89552939 TGCGTGGGCTTTGAGGAGGAAGG - Intronic
1203028148 16_KI270728v1_random:541845-541867 TGGGAGTGCTTTGAGAACTATGG + Intergenic
1203043573 16_KI270728v1_random:792586-792608 TGGGAGTGCTTTGAGAACTATGG - Intergenic
1142601777 17:1056577-1056599 TGGGGGGGTTTTGAGCAGTGGGG - Intronic
1142856057 17:2731101-2731123 GAGAAGGGCTTCGAGCAGGACGG + Intergenic
1143019834 17:3911601-3911623 GGGGAGGGCCTGGAGCAGGCAGG - Intronic
1143498248 17:7324482-7324504 TGGGAGGACAAGGAGCAGGAGGG + Intronic
1143697248 17:8630110-8630132 TGGGGGGGCGCTGGGCAGGAAGG - Intronic
1143852693 17:9824561-9824583 TGGGATGGCAGAGAGCAGGATGG - Intronic
1144727246 17:17508021-17508043 AGGGAGGGATTCGTGCAGGAGGG + Intronic
1145834809 17:27946340-27946362 TGGGAGGTTTTGGAGCAAGAGGG + Intergenic
1146176658 17:30669470-30669492 TGGGAGGACTCTGAGGAGCAGGG - Intergenic
1147170131 17:38613524-38613546 TGGAAGATCTTTGAGCAGAAGGG - Intergenic
1147316670 17:39624306-39624328 TGGGAGGGCACTGAGAAGCAAGG - Intergenic
1148075228 17:44932003-44932025 CGGGAGGGCTTGGAGCTGGTGGG - Intronic
1149667695 17:58377430-58377452 TTGGAGGGCTGAGAACAGGAGGG - Intronic
1150295601 17:64005731-64005753 TGGGAGGGCTTTATGGGGGAGGG - Intronic
1151889373 17:76943065-76943087 GGGGAGGGCTGTGTGCATGAAGG + Intronic
1151980458 17:77505406-77505428 GGGGAGGGCTGGGAGCGGGAAGG - Intergenic
1152819001 17:82426192-82426214 CGGGAGGGGTTTGGGCAGTAGGG + Intronic
1155187660 18:23401634-23401656 AGGCAGGGCATTGAGGAGGAAGG + Intronic
1155302475 18:24443410-24443432 TGGGAGGGCTGGAGGCAGGAGGG - Intronic
1155497693 18:26458925-26458947 TTGGAGGGTTTTGAGCAGAAGGG - Intronic
1156463492 18:37334594-37334616 GGGGAGGGCTTGGAGGGGGAAGG - Intronic
1157446928 18:47753189-47753211 TGTGGGGGTTTTGAGCAGGGAGG - Intergenic
1158348638 18:56541275-56541297 GGGGAAGGCTTTGAGGAGGAAGG - Intergenic
1159597400 18:70395514-70395536 GAGGAGGCCTTTGGGCAGGATGG + Intergenic
1160585608 18:79911810-79911832 AGGGAGGGGATGGAGCAGGAAGG + Intronic
1161135685 19:2618227-2618249 TGGCAGGGATTTGGGCAAGATGG - Intronic
1161503923 19:4633852-4633874 CGGGAGGGCTTCCTGCAGGAAGG - Intergenic
1161657726 19:5526122-5526144 TGGGAGAGCTCTGAGGGGGAAGG + Intergenic
1161681557 19:5682198-5682220 TGAGAGGGTTTGGAGCAGGAAGG + Intronic
1162039255 19:7959876-7959898 TGGGAGGGGATTGAGGTGGAGGG + Exonic
1162076660 19:8192389-8192411 TGGGAGAGTTTAGAGCAGGAAGG - Intronic
1162419488 19:10558018-10558040 TGGGACGGGCCTGAGCAGGAGGG - Exonic
1163178639 19:15583504-15583526 GGGGAGGGCTTTGGGCAGGGTGG + Intergenic
1163687082 19:18717758-18717780 TGGGAGGGCCTCTCGCAGGACGG + Intronic
1163780040 19:19241450-19241472 TGGGAGGGCTTGAAGCAGGGAGG - Intronic
1163849075 19:19653452-19653474 AGGGTGGGCTTTGTGGAGGATGG + Intronic
1164357363 19:27454547-27454569 TTGGAGGGCTTTGAGGAATATGG + Intergenic
1164362885 19:27536890-27536912 TGGGAGGGCTTTGAGTCCTATGG + Intergenic
1164363932 19:27552056-27552078 TGGGAGGGCTTTGAGGCCTATGG + Intergenic
1164363980 19:27552908-27552930 TGGGAGCGCTTTGAGGACTATGG + Intergenic
1164364097 19:27554778-27554800 TGGGAGCGCTTTGAGGTGTAAGG + Intergenic
1164770272 19:30802905-30802927 AGGCAGGGCCTTGAGCAGGAAGG - Intergenic
1164992172 19:32692348-32692370 CGGGAGGCCTTTGAGGAGGCGGG + Exonic
1165323851 19:35102692-35102714 TGGGAGGGCGTTGAGACAGAAGG - Intergenic
1165419390 19:35715542-35715564 TGGGAGGGCATGGCCCAGGAGGG + Intronic
1165881498 19:39047285-39047307 TGGGAGGGGTCTGGGCAGTATGG - Intergenic
1166545487 19:43632443-43632465 TCGGAGGGTTTTAAGCAGAAAGG - Intronic
1166667491 19:44689704-44689726 ATGGATGGTTTTGAGCAGGAAGG - Intergenic
1166957203 19:46472485-46472507 TGGGAGGGGTCTGAGCAGTATGG - Intergenic
1167525795 19:49983116-49983138 AGGGTGGGCTGTGAGCAGGGAGG - Intronic
1167652668 19:50741555-50741577 TGGGAGGGGTCTGAGCAGTGTGG - Intergenic
1167784754 19:51627739-51627761 TGGGAGGGCTGTGGGGAGGGAGG + Exonic
1168323874 19:55528136-55528158 TGGCAGAGCTGTGGGCAGGAGGG - Intergenic
1168573483 19:57489140-57489162 TAGAAGGGCTCTCAGCAGGATGG + Intronic
1168574884 19:57501189-57501211 AGGGAGGGCTCTCAGCAGGATGG + Intronic
925137219 2:1530184-1530206 TGGGAGGGATTTGGGGAGGTTGG - Intronic
925137913 2:1532969-1532991 TGGGAGGGATTTGGGGAGGCTGG - Intronic
925250883 2:2436346-2436368 AGGGAGGGGTTTCAGCAGCAAGG + Intergenic
925443848 2:3910589-3910611 TGGCAGGGGTTTGAGCTGGTGGG + Intergenic
925998983 2:9315041-9315063 TGAGAAGGCTTTGAACAGCAGGG + Intronic
926670728 2:15574728-15574750 TGTGAGGGCTTTAAGGAGGCTGG - Intergenic
927885294 2:26714494-26714516 TGGGGAGGGGTTGAGCAGGAAGG + Intronic
928019050 2:27686660-27686682 CAGGAGGGCTCTGAGCAGGCAGG + Intronic
928103978 2:28455698-28455720 TGAGAGGGATTTGAGCAGCAGGG + Intergenic
928425862 2:31177195-31177217 TGAAGGGGCCTTGAGCAGGAGGG - Intronic
928957706 2:36888337-36888359 TGGGAGGGATTTGAGCAAGAAGG - Intronic
929028682 2:37630009-37630031 TTGGAGGGCCTCAAGCAGGAGGG - Intergenic
929694143 2:44099836-44099858 TGGGATTGCATTGAGGAGGAAGG - Intergenic
929770800 2:44890300-44890322 TGGGAAGTCTTTGAGCAGAACGG - Intergenic
932613256 2:73214841-73214863 TGGGAGAGTTTTTAGCAGGAAGG + Intronic
933099387 2:78232973-78232995 TGGGAGGTATTTGTGCATGAGGG - Intergenic
933714505 2:85350194-85350216 TGGGAGGAATTTCAACAGGATGG + Exonic
934603818 2:95679369-95679391 TGGGAGGGCTTCATGGAGGAAGG + Intergenic
936231009 2:110699558-110699580 ATGGAGGGCTCTGAGCAGGCTGG + Intergenic
936444244 2:112584057-112584079 TGCGAGCGCTTGGAACAGGAGGG - Intergenic
936537196 2:113321596-113321618 TGGGAGGGCTTCATGGAGGAAGG + Intergenic
938714032 2:134002447-134002469 TGTGAGGGCCTTGAGCAGCACGG + Intergenic
939424669 2:142019641-142019663 TTGGAGAGTTTTGAGCAGGAGGG - Intronic
939567887 2:143806249-143806271 TGGAAGGACTTAGAGCTGGAAGG + Intergenic
940780941 2:157933045-157933067 TGGGAGTGTATTGAGGAGGAGGG + Intronic
941699818 2:168592466-168592488 ACTGAGGGTTTTGAGCAGGAAGG + Intronic
942264536 2:174208653-174208675 TGGGAGAGCTTTGAATAAGAGGG - Intronic
946028997 2:216690632-216690654 TGGGCTGGATTTGAGCAGGCAGG - Intronic
946100438 2:217315833-217315855 TGGGAGTGGCTTCAGCAGGATGG - Intronic
946789483 2:223285577-223285599 TGGGAGGGCCAAGAGCAGGAAGG - Intergenic
946907729 2:224432296-224432318 AGGGAGGGTTTGGAGCAGGCTGG - Intergenic
947298836 2:228665519-228665541 TGGGAGTGATTTGAAAAGGAAGG - Intergenic
948337401 2:237221279-237221301 TGTTACGGATTTGAGCAGGAAGG - Intergenic
948945300 2:241216295-241216317 TGGGAGGCCCTTGAGCAGAGTGG - Intronic
1169325207 20:4670252-4670274 TGGGATGACCTTGAGCAGGAAGG - Intergenic
1169769492 20:9185617-9185639 TTGGAGGGCTCTGAGCAGGGAGG - Intronic
1170513887 20:17107832-17107854 TGGGAGGGCTGGGAGAAGAATGG - Intergenic
1170535005 20:17332223-17332245 TGGGATGGCTTTGAGCCCAAGGG + Intronic
1170911374 20:20573340-20573362 AGGGAGACCCTTGAGCAGGATGG + Intronic
1171122512 20:22579045-22579067 GGGGAGGGATTTAAGCGGGAGGG + Intergenic
1171341306 20:24431461-24431483 TGGGGGGACTTTGGGCTGGAAGG - Intergenic
1171641762 20:27362914-27362936 TTGGAGGGCTTTCAGGACGACGG + Intergenic
1171645856 20:27424105-27424127 TTGGAGGGCTTTCAGGACGACGG + Intergenic
1171691124 20:28102953-28102975 TTGGAGCGCTTTCAGGAGGACGG + Intergenic
1171911179 20:30957118-30957140 TGGGAGGGCTTTGAGGCCTATGG - Intergenic
1172125262 20:32621795-32621817 AGGGAGGGCTCGGAGGAGGAGGG + Intergenic
1172302114 20:33857659-33857681 AGGGAGGGCTGTGTCCAGGAGGG - Intergenic
1172801637 20:37580348-37580370 TGGGAGAGCTCTGAGGAGGTGGG - Intergenic
1173055086 20:39604191-39604213 TGGGAGGGCATTGTGGTGGAGGG + Intergenic
1173087994 20:39942732-39942754 TGGGAGGGCTGTGAGAATGAGGG + Intergenic
1173225594 20:41160702-41160724 TGAGAGGGCTTGGATCATGATGG + Intronic
1173366670 20:42392037-42392059 AGGGAGGGCTTGGGGCAGGTGGG - Intronic
1173819385 20:46010800-46010822 TGGGAGAGCTTCGCGCAGGCGGG + Intronic
1174146367 20:48455295-48455317 AGGGCGGGCTTTCTGCAGGAGGG + Intergenic
1174187868 20:48719874-48719896 TGGGAAGGTTCTGAGCAGGGAGG - Intronic
1174609678 20:51788831-51788853 TGTGTGGGCTTTCAGCAGGATGG - Intronic
1175050338 20:56149886-56149908 TGGAATGGGTTTCAGCAGGATGG - Intergenic
1175389399 20:58616858-58616880 TGTGTTGGCTTTGAGCTGGAGGG - Intergenic
1175552933 20:59828706-59828728 TGGGAGGGGTGGGAGTAGGAGGG + Intronic
1175881655 20:62262847-62262869 CTGGAGGGCTGTGAGCAGCAGGG + Intronic
1176322009 21:5337258-5337280 TTGGAGGGCTTTGAGGCCGATGG + Intergenic
1176479665 21:7269043-7269065 TTGGAGGGCTTTGAGGCCGATGG + Intergenic
1176758828 21:10752274-10752296 TTGGAGGGCTTTGAGGACTAAGG + Intergenic
1176886756 21:14265697-14265719 TGGGAGGGATTGGATCATGAGGG + Intergenic
1177113428 21:17056709-17056731 TGTGAGGGCTTTGTTCATGAAGG + Intergenic
1177725825 21:24966409-24966431 TTGGAAGGCTTTCAGCAGGCAGG - Intergenic
1178083188 21:29086926-29086948 TTGGAGGACTTTCATCAGGATGG - Intronic
1178694366 21:34780419-34780441 TGAGAGGGTTTTGAGCAGAGAGG - Intergenic
1179353449 21:40635254-40635276 AGGGAGGGATGTCAGCAGGAGGG + Intronic
1179924328 21:44525688-44525710 TGGGAGGCCTTCGAGGTGGATGG - Exonic
1180398361 22:12380877-12380899 TTGGAGGGCTTTGAGGCCGATGG + Intergenic
1180427341 22:15209861-15209883 TTGGAGTGCTTTGAGCACAATGG - Intergenic
1181008531 22:20026474-20026496 AGGGAGGGCCTTTAGCAGGACGG + Intronic
1181464260 22:23102298-23102320 TGGGAGGGGGATGAGCAGGGAGG + Intronic
1181961562 22:26625482-26625504 TGGGTGGGCTTTGAGCATGCTGG + Exonic
1183341104 22:37282340-37282362 TGGCAGAGTTTTGAGCAGCAGGG - Intronic
1183403452 22:37618335-37618357 TGGGTGGGCTTTCAGAAGGGAGG - Intronic
1183428623 22:37752574-37752596 GGAGAGGGCTTTGAGCCAGAGGG + Intronic
1183631580 22:39036222-39036244 TGGGAGGGATTTGAGAAGGGAGG - Intergenic
1183636111 22:39063804-39063826 AGGGAGGGGCATGAGCAGGAGGG - Intronic
1183636116 22:39063820-39063842 TGGGAGGGATTTGAGAAGGGAGG - Intronic
1183637408 22:39072717-39072739 TGGGAGGGATTTCAGAAGGGAGG - Intronic
1184340425 22:43882896-43882918 TGGGAAGGGTTTAAGCAGGGAGG - Intronic
1184535245 22:45082275-45082297 CGGGAGGGTGTTAAGCAGGAGGG + Intergenic
1185054998 22:48575066-48575088 TGGGAGGGCTCGGAGGAGGCTGG - Intronic
950104653 3:10380354-10380376 TGGGAGGGGTCTGAGAAGGTTGG + Intronic
950406621 3:12809020-12809042 TGGGAGGGGATTGAACAGGCAGG + Intronic
950850751 3:16060095-16060117 TGGGAGGACTTTGAGCAATAAGG + Intergenic
952845933 3:37688164-37688186 TGGGAAGCCTTTGACCTGGAGGG + Intronic
952860344 3:37807541-37807563 TGGGAGGTCTGTGAGCAGAGCGG + Intronic
953024764 3:39138423-39138445 TGGGAGGGAGGTGGGCAGGAGGG + Intronic
953061192 3:39429804-39429826 TGGGAGGGGTGTGTGCAGTATGG - Intergenic
953265375 3:41381764-41381786 TTGGAGGGTTTTGAGCTGAAGGG - Intronic
953835936 3:46344184-46344206 TGGGTGGGGTCTGAGCAGTATGG + Intergenic
954228664 3:49199581-49199603 CAGGAGGGCTTTGGGCAGGGTGG + Intronic
954648539 3:52145729-52145751 TGAGATGGCCTTGGGCAGGAAGG - Intronic
954650989 3:52162576-52162598 GGGGAGGGCTGGGAGCAGGCAGG - Intergenic
955538536 3:59950434-59950456 TGGAAAGGCTTTGATGAGGAGGG - Intronic
955710341 3:61772197-61772219 AGGGAGGGCGTTAAGCAGGGAGG + Intronic
956402628 3:68896376-68896398 GGTGATGGCTTGGAGCAGGATGG + Intronic
956899938 3:73704769-73704791 GGGGAGGGCATTTAGCAGGTAGG + Intergenic
956915417 3:73865975-73865997 TCAGAGGGCTCTGAGAAGGAAGG + Intergenic
958209608 3:90454379-90454401 TTGGAGGGCTTTGAGGATTATGG - Intergenic
958209844 3:90458808-90458830 TTGGAGGGCTTTGAGGACTATGG - Intergenic
960072889 3:113451904-113451926 TTGGAGGGCTTTGGTGAGGAAGG - Intronic
960690495 3:120341915-120341937 GGGGAGGGCTGGGAGCAGGCAGG + Intronic
960940806 3:122932616-122932638 TGGGAGGGGTCTGGGCAGTATGG - Intronic
961871741 3:129993415-129993437 GCTGAGGGCTGTGAGCAGGAGGG - Intergenic
961907446 3:130277110-130277132 TAGGAGTGCTGTGAGCAGAAAGG - Intergenic
962083494 3:132165775-132165797 TGGGTGGGAGGTGAGCAGGAGGG - Intronic
962857973 3:139366846-139366868 TGGGAAGGTTTTGAGCAAGAGGG - Intronic
962959687 3:140299120-140299142 TGGAAGGGCTTCCTGCAGGAGGG - Intronic
962978929 3:140470462-140470484 TGGCAGAGCAGTGAGCAGGAGGG + Intronic
963274218 3:143314313-143314335 AGGGAGGATTGTGAGCAGGAAGG - Intronic
965265117 3:166532688-166532710 TTGGAGGGCTCAGAACAGGAAGG - Intergenic
968228862 3:196992589-196992611 TGGGAGGGCTCGGGGGAGGAAGG - Intronic
968818323 4:2833051-2833073 TGAGAGGGCTCTGAGTGGGACGG + Intronic
969259195 4:6022881-6022903 TGGGAGAGGTCTGAGCTGGACGG - Intergenic
969271911 4:6108654-6108676 TTAGAGGGCTTTGAGCATGGAGG - Intronic
969465333 4:7353101-7353123 TGGGAGGGGGTAGAGGAGGATGG + Intronic
969694849 4:8728681-8728703 TGGGGTGGCCTTGGGCAGGAGGG + Intergenic
973275185 4:48299637-48299659 TGGGATGGCTTGGAGCAAGCTGG + Intergenic
973538709 4:51911866-51911888 TAGAAGGGCTTGGGGCAGGAGGG - Intronic
975459039 4:74628969-74628991 TGGGCTGGCTTTGAGCAAAAGGG + Intergenic
977749579 4:100593137-100593159 TGGCAAGACTTTGAACAGGATGG + Intronic
977878676 4:102178988-102179010 TGTGATGGCTCTGAGCAGGGTGG - Intergenic
978862881 4:113471703-113471725 TGGGAGACCTGGGAGCAGGAAGG - Intronic
980220247 4:129903781-129903803 TGGGAGCACTTTGATAAGGATGG + Intergenic
980837582 4:138215981-138216003 GGAAAGGGCTTGGAGCAGGATGG + Intronic
981592254 4:146376621-146376643 TGGGGTGGCTTTCAGCAGGATGG - Intronic
983010372 4:162538557-162538579 TGGGAGGGGTCTGAGCAGTATGG + Intergenic
983989278 4:174097869-174097891 TGGGAGTGATGTCAGCAGGATGG - Intergenic
985208122 4:187562600-187562622 AGGCATGGCTTTGTGCAGGAAGG - Intergenic
985661404 5:1158870-1158892 TGGGACGGACTTGAGGAGGAAGG + Intergenic
985666714 5:1184798-1184820 TGGGAGGGCTTTATCCTGGATGG + Intergenic
986429454 5:7666780-7666802 TGGGAGAGGATGGAGCAGGAAGG - Intronic
986645484 5:9912441-9912463 TGAGGGTGCTATGAGCAGGAGGG - Intergenic
987029397 5:13961783-13961805 TGGGAGGGAGTTGAGCATCAAGG - Intergenic
987373950 5:17217555-17217577 GGGGAGGGCACTGGGCAGGAAGG + Exonic
989837667 5:46013334-46013356 TGGGAGGGCTCTGAGTCGTATGG + Intergenic
989851029 5:46210578-46210600 TGGGAGGGCTTTGAGGCCTATGG + Intergenic
989852221 5:46228109-46228131 TGGGAGTGCTTTGAGGCTGACGG + Intergenic
990553106 5:56903980-56904002 CTGGAGGGTTTTAAGCAGGAGGG - Intergenic
991450228 5:66743500-66743522 TGGAAGTGCTTTGGGCAGGTTGG + Intronic
994946014 5:106392685-106392707 TGGGAGGCCTGTGAACAGGGAGG + Intergenic
995695473 5:114874216-114874238 TTGTAGGGATTTAAGCAGGAGGG + Intergenic
997900064 5:137755274-137755296 TGGGAGGGCTTCAAGGAGGGCGG - Intergenic
998178343 5:139916002-139916024 TTGAAGGGTTCTGAGCAGGAAGG + Intronic
998876236 5:146602580-146602602 TGCGAGTGCATTGAGCAGGCAGG - Intronic
999230004 5:150056188-150056210 TGGGAGGGCTTGGGCCAGGCTGG - Intronic
999360982 5:150986636-150986658 TGGGAGGGGTCTGGGCAGTATGG + Intergenic
999645412 5:153712522-153712544 TGGGAGGACAGAGAGCAGGAGGG - Intronic
1000201348 5:159013801-159013823 TGGGAGGAGTGTGAGCTGGAAGG - Intronic
1000281330 5:159784869-159784891 TGGGGGGACTTTGAATAGGATGG + Intergenic
1001137473 5:169114645-169114667 TGGGAGGGCCATGAGGAGGGAGG + Intronic
1001267851 5:170288057-170288079 AGAAAGGGCTCTGAGCAGGAGGG + Intronic
1001286065 5:170424973-170424995 TGGGAAGGGTCTGAGGAGGATGG - Intronic
1001402058 5:171451467-171451489 TGGCAGGGGTTAGGGCAGGAGGG - Intronic
1001403363 5:171459677-171459699 TGGGGGATTTTTGAGCAGGAAGG + Intergenic
1001970112 5:175948727-175948749 TGGGAAGGCTTTGTGCAGCCCGG - Intronic
1002247326 5:177895037-177895059 TGGGAAGGCTTTGTGCAGCCCGG + Intergenic
1005686916 6:28262039-28262061 TGGGAGGGGTCTGGGCAGTATGG + Intergenic
1005735101 6:28738357-28738379 AGGGAAGGCTTTGAAAAGGAAGG + Intergenic
1005959201 6:30684232-30684254 AAGGAGGGCTCTGAGAAGGAAGG + Intronic
1006002030 6:30972638-30972660 TGGGAGCGCTTAGAGCAGAGCGG - Intergenic
1007923201 6:45629247-45629269 TGGGATGGAGGTGAGCAGGAGGG + Intronic
1008028352 6:46664824-46664846 TACGAGGGCTTTGGGCAGGCTGG + Exonic
1008384552 6:50873699-50873721 AGGGAAGAATTTGAGCAGGAAGG + Intergenic
1009788141 6:68364672-68364694 TTGGAGGGCTTTGATCTGCATGG - Intergenic
1011028382 6:82894442-82894464 TGGGAGGGGTCTGGGCAGTATGG - Intronic
1011607565 6:89119073-89119095 TGGGAGGGCTGTGAGCTAGAAGG - Intergenic
1011849516 6:91608699-91608721 AGGGAGGGCTGAGGGCAGGAGGG + Intergenic
1012157732 6:95840849-95840871 TGGAAGGGCTGTGTGCAAGAGGG - Intergenic
1012261395 6:97091552-97091574 TGGGAAGGCATTGGGCAGGTGGG - Intronic
1013052845 6:106553984-106554006 TGGGAGGGCTTTGTACTGGGAGG + Intronic
1013680037 6:112514906-112514928 AGGGAGAACATTGAGCAGGAGGG + Intergenic
1015214543 6:130734723-130734745 TGGGAGGGCTTTACTCTGGAAGG - Intergenic
1016454566 6:144216840-144216862 GGGGAGGGCTGTGACCTGGAGGG + Intergenic
1016566440 6:145460369-145460391 TGGGAAGACTGTGATCAGGAAGG - Intergenic
1016670854 6:146705830-146705852 TTGGAAGACTTTGAGAAGGATGG + Intronic
1016825285 6:148382650-148382672 TGAGAGAGCTCTGAGGAGGAGGG + Intronic
1019023144 6:168935829-168935851 CGGCAGGGCCTGGAGCAGGAGGG - Intergenic
1019171875 6:170137274-170137296 TGGGAGGACTTGGGGCTGGAAGG - Intergenic
1019499262 7:1356188-1356210 ATGGAGGGTTTGGAGCAGGAGGG - Intergenic
1022023907 7:26428054-26428076 TGGAAGGGCTTTCAGCAGGGAGG - Intergenic
1022091057 7:27108342-27108364 TGGGGGGGCTTGGAGAAGGGCGG + Exonic
1024101085 7:46033499-46033521 AGGGAGGGGCTTGTGCAGGAAGG + Intergenic
1025026672 7:55522086-55522108 AGGAGGGGCTTTGGGCAGGACGG - Intronic
1025032547 7:55569802-55569824 TGAGAGGTCCTTGAGTAGGAAGG - Intronic
1025183499 7:56837835-56837857 TGGGAGGGTTCTGAGCAGAGAGG - Intergenic
1025313379 7:57982214-57982236 TTGGAGCGCTTTGAGGACGATGG - Intergenic
1025314276 7:57999424-57999446 TGGGAGTGCTATGAGCACTATGG + Intergenic
1025500078 7:61278219-61278241 TTGGAGTGCTTTGAGGAGTATGG + Intergenic
1025500280 7:61282309-61282331 TTGGAGGGCTTTGAGGACTATGG + Intergenic
1025514932 7:61624443-61624465 TTGGAGTGCTTTGAGGAGTATGG + Intergenic
1025515135 7:61628533-61628555 TTGGAGGGCTTTGAGGACTATGG + Intergenic
1025531288 7:61887978-61888000 TGGGAGTGCTTTGAGAACTATGG - Intergenic
1025536273 7:61951993-61952015 TGGGAGAGCTTTGAGTAATATGG - Intergenic
1025539274 7:62053269-62053291 TTGGAGTGCTTTGAGGAGTATGG + Intergenic
1025539475 7:62057359-62057381 TTGGAGGGCTTTGAGGACTATGG + Intergenic
1025572673 7:62596223-62596245 TGGGAGGGCTTTGAGGCCTATGG - Intergenic
1025573844 7:62609100-62609122 TGGGAGCGCTTTGAGGGTGATGG - Intergenic
1025591823 7:62870191-62870213 TGGGAGGGCTTTGAGGCCTATGG + Intergenic
1025688426 7:63739132-63739154 TGGGAGGGTTCTGAGCAGAGAGG + Intergenic
1026739416 7:72969456-72969478 TGGGAGCGCGCTGAGCATGATGG - Exonic
1026829021 7:73600353-73600375 TGGGTGGGCTCTGAGTGGGATGG + Intronic
1027104315 7:75395617-75395639 TGGGAGCGCGCTGAGCATGATGG + Exonic
1027567008 7:79807848-79807870 TTGGAGGGCATTGATCAGAAAGG - Intergenic
1027680708 7:81217486-81217508 TGGGAGGCTGATGAGCAGGAGGG + Intergenic
1029178870 7:98685063-98685085 TGGGAGGGCTCTGTGGAGGGAGG + Intergenic
1029423632 7:100484020-100484042 TGGGGAGGCTTGGTGCAGGAAGG + Intronic
1029634206 7:101773109-101773131 TGGGAGTGGGTGGAGCAGGAAGG + Intergenic
1032216540 7:129961809-129961831 TTGGAGGGTTTTGAACAGTAGGG - Intergenic
1032254185 7:130284060-130284082 TCGGGGGGTTTTCAGCAGGACGG + Intronic
1032574161 7:133034968-133034990 TGGGAGCACTTTGATAAGGACGG - Intronic
1033974394 7:147082131-147082153 TGGCTGGGCTTTGACCAGAAGGG + Intronic
1034008339 7:147499697-147499719 AAGGAAGGCTTTAAGCAGGAGGG + Intronic
1034702854 7:153111335-153111357 GAGGAGGGCATTGAACAGGAAGG + Intergenic
1034889797 7:154829788-154829810 TGGGAGGGCTTTGAGCAGGATGG - Intronic
1035089667 7:156297079-156297101 TGGAAGTTCTTTGAGCAGCACGG + Intergenic
1035127767 7:156621260-156621282 TAGGAAGGGTTTGAGAAGGATGG + Intergenic
1035173919 7:157037161-157037183 CTGGACTGCTTTGAGCAGGAAGG - Intergenic
1035186417 7:157129420-157129442 TGGGAGCTCTTTCTGCAGGATGG - Intergenic
1035740499 8:1924590-1924612 TGGAAGGGCTTTGTCCCGGACGG + Intronic
1036475844 8:9092629-9092651 TGAGAGCGCTGAGAGCAGGAAGG + Intronic
1036749970 8:11437410-11437432 TGGCAGCGCGTTGAGCAGGGAGG - Intronic
1037608544 8:20457588-20457610 TGGGAGGATTTTAAGCAGGGAGG - Intergenic
1037692973 8:21198263-21198285 TGGGAAGGCTTTGTGGAGGCTGG - Intergenic
1037803353 8:22046749-22046771 TGGGTGGGCTGAGAGTAGGATGG - Intronic
1038248128 8:25878148-25878170 AGTGAGTGCTGTGAGCAGGACGG - Intronic
1038528889 8:28300759-28300781 CTGGAGGGTTTTGAGCAGGGTGG - Intergenic
1038836798 8:31135003-31135025 TGGGGGGGCTTGGGGGAGGACGG - Intronic
1039473807 8:37829016-37829038 GGGGTGGGCATGGAGCAGGAGGG - Intronic
1041175256 8:55190211-55190233 TGGCTGGGCTTGGAGGAGGAAGG + Intronic
1042963641 8:74328650-74328672 TGAGAGGGCTCAGACCAGGAAGG + Intronic
1047605793 8:126473023-126473045 GAGGAGGGCTTTGTGCAGTATGG - Intergenic
1049260719 8:141637635-141637657 TGTGATGGCTTTGACCTGGAAGG + Intergenic
1049267848 8:141678845-141678867 GGGGAGGGCTTGGAACTGGAAGG - Intergenic
1049321131 8:141996995-141997017 TGTGAAGACTTTGACCAGGATGG + Intergenic
1050034444 9:1420766-1420788 TTTCAGGGCTTTGAGCTGGATGG - Intergenic
1050934671 9:11380179-11380201 TGGCAGGGCTCTCAGCAGAATGG + Intergenic
1051551828 9:18338394-18338416 TGTGAGGACTCTGAGCAGGCAGG - Intergenic
1052384140 9:27805335-27805357 TGGGAGGGGTCTGGGCAGTATGG + Intergenic
1053405834 9:37874747-37874769 TGTGAGGACTTTTAGAAGGATGG - Intronic
1053713729 9:40857804-40857826 TTGGAGAGCTTTGAGGAGTATGG + Intergenic
1054424115 9:64988152-64988174 TTGGAGAGCTTTGAGGAGTATGG + Intergenic
1056192117 9:84194777-84194799 GGGGAGGGCTGGGAGCAGGCAGG - Intergenic
1056844221 9:90023564-90023586 AGGGAGGGATTTGAGCAGAGAGG - Intergenic
1057851961 9:98572845-98572867 TGGGGGGGCTTGGAACTGGAGGG - Intronic
1058603527 9:106696803-106696825 TTGGAGGACTTTGAGCTGGAAGG - Intergenic
1059326121 9:113504970-113504992 TGGGAGGGCAGTGACCAGGCTGG + Intronic
1059434056 9:114265951-114265973 TGGAAGGGCTTGAAGCAGAAAGG + Intronic
1060815858 9:126634799-126634821 TGGGAGAGCTTTTACCAGGCAGG + Intronic
1060926190 9:127457034-127457056 TGGGAAGGTTATGATCAGGATGG + Intronic
1060948868 9:127587973-127587995 TTGGAGGGACTTAAGCAGGAAGG - Intergenic
1061082951 9:128383172-128383194 TGGGAGGGGTGTGGGGAGGAGGG - Intronic
1061304260 9:129723406-129723428 TGGGGTGACTTTGAGCAGAAAGG - Intergenic
1061782285 9:133003324-133003346 GGGGAGGGCTTGGAGCAGAAAGG - Intergenic
1061807267 9:133143425-133143447 TGGGAGGGCCTTGTGCGGGTAGG + Intronic
1061889677 9:133611586-133611608 TGGAAGGGCATTGAGCTGGTTGG - Intergenic
1062049967 9:134442207-134442229 TGGGAGGCCTCTCAGCAGGGAGG - Intergenic
1062057039 9:134474150-134474172 TGGGAGGGCAGAGAGCAGAAAGG + Intergenic
1062096645 9:134707131-134707153 TGGGTGAGCTATGACCAGGAGGG + Intronic
1062474170 9:136719313-136719335 TGGGAAGGCTCTGAGCAGCCAGG - Intronic
1203378363 Un_KI270435v1:3046-3068 TGGGAGGGCTTTGAGGCCTAGGG + Intergenic
1203379047 Un_KI270435v1:12213-12235 TTGGAGGGCTTTGAGGCCGATGG + Intergenic
1203397305 Un_KI270519v1:35479-35501 TTGGAGGGCTTTGAGGCCGATGG - Intergenic
1203397467 Un_KI270519v1:38175-38197 TTGGAGGGCTTTGAGGCCGATGG - Intergenic
1203397512 Un_KI270519v1:38860-38882 TTGGAGGGCTTTGAGGACTAAGG - Intergenic
1203413828 Un_KI270589v1:28869-28891 TTGGAGGGCTTTGAGGCCGATGG - Intergenic
1203414096 Un_KI270589v1:33300-33322 TGGGAGCGCTTTGAGGACTAAGG - Intergenic
1203684183 Un_KI270757v1:26578-26600 TGGGAGCGCTTTGAGGACTAAGG + Intergenic
1187135823 X:16546232-16546254 GGGGAGGGCCTTGTGCAGGGTGG - Intergenic
1187241747 X:17520246-17520268 TGGGGGGGCTTTGATGAGAAAGG + Intronic
1187546844 X:20263588-20263610 TGTGAGGTCTTAAAGCAGGAAGG + Intronic
1187773000 X:22723096-22723118 AGGAATGGCTTTGAGCAGTATGG + Intergenic
1188051938 X:25498274-25498296 TGGGAAGGTTTTGAGCAGACTGG + Intergenic
1189156033 X:38757565-38757587 TGGGAAGGCTTTCAACAGGCAGG - Intergenic
1189593712 X:42542556-42542578 TGGAAGGGGTTAGAGCAAGATGG + Intergenic
1190291404 X:48995183-48995205 TGGGAGGAGTTGGAGGAGGAAGG + Intronic
1190677797 X:52797083-52797105 TGGGAGGGATCTGGGCAGCATGG - Intronic
1190681611 X:52831098-52831120 TGGGGGGACTGTGAGCAGGCAGG + Intergenic
1192521869 X:71809206-71809228 TGGGAGGGCTTTCACCATAATGG - Intergenic
1194594476 X:95840064-95840086 TGGAAGGCTTTTGAGCAGGAGGG - Intergenic
1194651234 X:96517017-96517039 TGAGAGTGCTCTGAGGAGGAAGG - Intergenic
1195963963 X:110413502-110413524 TGGGGGGGGGTTGACCAGGAGGG - Intronic
1197335665 X:125206440-125206462 TGGGAGGGTGTTGAGCCGCAGGG - Intergenic
1198035260 X:132795488-132795510 CGGAAGGGCTTTGAGCACGTCGG - Intronic
1198528550 X:137526282-137526304 TGAGAGGGCTTGGAGAAGCAGGG - Intergenic
1199033331 X:143026261-143026283 TGGGAGAGGTTTGGGCAGTATGG + Intronic
1199159459 X:144591254-144591276 TGGGAATGCTGTGAGCAGCAAGG - Intergenic
1199215366 X:145255194-145255216 TGGGAGGGATCTGGGCAGTATGG + Intronic
1199687881 X:150280550-150280572 TGGGGGGGCTCAGAGCAGTAGGG + Intergenic
1200118779 X:153780853-153780875 AGGGTGGGCCTGGAGCAGGAGGG + Intronic
1200179495 X:154141591-154141613 AGGGAGGTCTTTCTGCAGGAGGG + Intergenic
1201344419 Y:12967131-12967153 TGGGAGGGCTCTGGGCAATATGG + Intergenic
1202366904 Y:24171800-24171822 TGGAAGGGCTTTGAGGCAGAGGG + Intergenic
1202373505 Y:24213682-24213704 TGGAAGGGCTTTGAGGCAGAGGG - Intergenic
1202497276 Y:25456438-25456460 TGGAAGGGCTTTGAGGCAGAGGG + Intergenic
1202503878 Y:25498323-25498345 TGGAAGGGCTTTGAGGCAGAGGG - Intergenic