ID: 1034889798

View in Genome Browser
Species Human (GRCh38)
Location 7:154829792-154829814
Sequence AGGGTGGGAGGGCTTTGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 346}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889798_1034889808 14 Left 1034889798 7:154829792-154829814 CCTGCTCAAAGCCCTCCCACCCT 0: 1
1: 0
2: 3
3: 32
4: 346
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889798_1034889810 22 Left 1034889798 7:154829792-154829814 CCTGCTCAAAGCCCTCCCACCCT 0: 1
1: 0
2: 3
3: 32
4: 346
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889798_1034889811 23 Left 1034889798 7:154829792-154829814 CCTGCTCAAAGCCCTCCCACCCT 0: 1
1: 0
2: 3
3: 32
4: 346
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889798 Original CRISPR AGGGTGGGAGGGCTTTGAGC AGG (reversed) Intronic
900187556 1:1339482-1339504 AGGGTGGGAGGGCAGGGTGCAGG + Intronic
900643547 1:3698538-3698560 AGGGGAGGTGGGCTTTGAGCGGG + Intronic
900758398 1:4454062-4454084 GGTGTGGGAGGGCTGGGAGCGGG - Intergenic
901333449 1:8428233-8428255 AGAGTGGGCAGGCTATGAGCTGG - Intronic
903547984 1:24138722-24138744 AGGGTGGGAGGAGGGTGAGCAGG + Intronic
903692358 1:25183599-25183621 ACCGTGGGAGGGCATTGTGCAGG - Intergenic
904411225 1:30326096-30326118 AGGGTGGGCGGGGGCTGAGCAGG - Intergenic
904971130 1:34420227-34420249 AGGGTGGAAGGACTTGGGGCTGG - Intergenic
905225154 1:36473904-36473926 AGAGTGTGAGGGCTTTGGGTGGG + Intronic
905485980 1:38296928-38296950 AGGGTGGGTGGGCCTGGAGAGGG - Intergenic
906096133 1:43225262-43225284 GAGCTGTGAGGGCTTTGAGCAGG - Intronic
906654124 1:47535333-47535355 GAGGTGAGAGGGTTTTGAGCAGG - Intergenic
906708545 1:47912655-47912677 ATGCTGGGAGGGCTTAGAGAGGG + Intronic
906888163 1:49675426-49675448 AGGGTGGGAGGGAGGTAAGCCGG + Intronic
908607697 1:65818099-65818121 AGGGTGGAAGAGGTTAGAGCAGG - Intronic
911060891 1:93746876-93746898 GGGAAGAGAGGGCTTTGAGCAGG - Intronic
911796727 1:102086118-102086140 AGAGTGGGAGGGCTGTATGCAGG + Intergenic
913973355 1:143433846-143433868 AGAGTGATAGGGCTTTGAGTTGG - Intergenic
914067742 1:144259453-144259475 AGAGTGATAGGGCTTTGAGTTGG - Intergenic
914111413 1:144706901-144706923 AGAGTGATAGGGCTTTGAGTTGG + Intergenic
915107011 1:153541043-153541065 TGGCAGGGAGGGCTTTGGGCTGG - Intronic
915194949 1:154182617-154182639 AGGGTGGGAGAACTTTGCTCTGG - Intronic
915936781 1:160094189-160094211 AGTGAGGGAGGGCTGGGAGCTGG + Intronic
920043842 1:203120916-203120938 AGTGGGGGAGGGCTTGGAGCTGG + Intronic
921067402 1:211632617-211632639 AGGATGGGAAGGCTGTGAGTAGG + Intergenic
922589128 1:226760072-226760094 AGTGTGGGTGGGCTGGGAGCTGG + Intergenic
923739137 1:236639822-236639844 CGGGTAGGAGTGCTTAGAGCCGG + Intergenic
924024206 1:239816064-239816086 AGGGTGTGAGGGCAATAAGCTGG - Intronic
924548671 1:245053945-245053967 AGGGTGGGAGGGCCTTGGCCAGG - Intronic
1063407368 10:5809313-5809335 AGTGAGAGAGGACTTTGAGCAGG - Intronic
1064639122 10:17397563-17397585 GGGATGGAAGGTCTTTGAGCAGG - Intronic
1066454511 10:35561258-35561280 GGGGTGGGAGGCGTTTGGGCAGG + Intronic
1066550282 10:36548282-36548304 AGGAAGGGAGGGAGTTGAGCAGG - Intergenic
1066640289 10:37548560-37548582 TGGGTGAGAGGGCATTGAGTTGG + Intergenic
1067725497 10:48767862-48767884 TGGGTGGGCAGGCTCTGAGCTGG + Intronic
1069076521 10:64043194-64043216 AGGGTGGGAGGGCGTGGTGGGGG - Intergenic
1069877590 10:71572621-71572643 TGGGTGGGTGGACTTTGGGCTGG - Intronic
1070772150 10:79088720-79088742 AAGGTGGGTGGGCTGTGAGCAGG + Intronic
1071366796 10:84908237-84908259 TGAGTGGGAGGGCCGTGAGCAGG + Intergenic
1071429473 10:85595334-85595356 AGCGAGGGAGGTCTCTGAGCAGG + Intergenic
1072117882 10:92381239-92381261 AGGGTGGGATAGCTTGCAGCAGG + Intergenic
1074873707 10:117597597-117597619 TGGGTGGAAGGGATTTGATCTGG - Intergenic
1075219262 10:120570223-120570245 AGGGTGGGCAGGCATTGACCAGG + Intronic
1075528501 10:123205835-123205857 AGGGAAGGAGAGCTTTGAGGGGG + Intergenic
1075828754 10:125384831-125384853 GGTGGGGGAGGGCTGTGAGCAGG + Intergenic
1076534351 10:131167334-131167356 AGGGTGGGAGTGCTGTGCCCAGG + Intronic
1077143378 11:1034577-1034599 GGGGTGGGAGAGCTCTGAGCGGG + Intronic
1077864677 11:6212214-6212236 AGGGTGAGAGGGCATGGAGAAGG - Intronic
1078131906 11:8620365-8620387 AGGGTCTGAGGCCTTTGAGAGGG - Intronic
1078357207 11:10641478-10641500 AGGGTGAGAGGGAGTGGAGCCGG - Intronic
1079238869 11:18708361-18708383 AGGTTGGGAAGGCTTTGATGAGG - Intronic
1079317443 11:19421161-19421183 AGGGCTGGAGGGCTTGGGGCAGG - Intronic
1080414435 11:32056084-32056106 AGGGTTGCAGGGCTTTGAGGAGG + Intronic
1081547386 11:44081098-44081120 AGGGTGGGAGGGCAGAGAGGTGG + Intronic
1082787399 11:57324563-57324585 AGGGGGCGAGGGCTTGGGGCGGG - Intronic
1083184476 11:61009173-61009195 AGGGAGGGAGGCCTCTGAGGAGG + Intronic
1083648586 11:64186840-64186862 AGGGTGGGAGAGCGTTGAGCGGG + Intronic
1084473480 11:69376203-69376225 ATGGTGTGAGGACCTTGAGCTGG - Intergenic
1084711738 11:70847856-70847878 AGGGGGGCAGGGCTTGGAGACGG + Intronic
1084796212 11:71506075-71506097 AGGGTGGGATAGCCTTGAGGAGG + Intronic
1085076563 11:73597576-73597598 AGGGTGGGATGGCTTTTAATGGG - Intronic
1085123450 11:73981994-73982016 AGGTTGGAAGGGCTGGGAGCCGG + Intronic
1085197631 11:74682089-74682111 TGGCTGGGAGGGCTTCGACCTGG - Intergenic
1085216032 11:74833119-74833141 AGGATGGGAGGGTTTTGAATGGG + Intronic
1085385959 11:76158540-76158562 AGTCTGGGAGGGTGTTGAGCAGG - Intergenic
1086064043 11:82728483-82728505 AGGCTGGTATGGCTTTGAACAGG - Intergenic
1086145514 11:83547036-83547058 AGAGTGTGAGTGTTTTGAGCTGG - Intronic
1088371155 11:109089839-109089861 TGGGTGGGAAGGCCTTGGGCTGG + Intergenic
1089639706 11:119839661-119839683 AGTGATGGATGGCTTTGAGCTGG + Intergenic
1092441937 12:8512177-8512199 GGGGTGGGAGGGATTTGGGTTGG - Intronic
1093107711 12:15109463-15109485 ATGGGGGGAAGGCTTTGTGCTGG - Exonic
1095411846 12:41933086-41933108 AGGGAGGGAGAGCTTGGAGGTGG + Intergenic
1096321597 12:50619022-50619044 AGGGTGGGGGGACTTTGGGAAGG - Intronic
1097587355 12:61530547-61530569 AAGGTGGGAGAGCTTTGGGTGGG + Intergenic
1099394228 12:82118137-82118159 AAGATGGAAGGGCTATGAGCAGG - Intergenic
1100731055 12:97470080-97470102 AAGGTTTGAGGGCTTTGAGAAGG - Intergenic
1102528268 12:113527586-113527608 GGGGTGTGAGGGGCTTGAGCTGG - Intergenic
1102543469 12:113638400-113638422 TGGGTGGGGGGGCCTGGAGCAGG + Intergenic
1102661122 12:114529456-114529478 AAGGTGGGAGGAGCTTGAGCTGG + Intergenic
1102761597 12:115390801-115390823 CAGGTGGGAGGGCTTGGTGCCGG - Intergenic
1103132360 12:118480345-118480367 AGGGAGGGAGGGCTTATTGCAGG + Intergenic
1103653730 12:122454079-122454101 AGGGTAGAATGGCTTTGAGGGGG - Intergenic
1103998354 12:124844354-124844376 GAGGTGGAAGTGCTTTGAGCTGG - Intronic
1104616322 12:130273002-130273024 AGGGTGTGAGTGCTTTCACCTGG + Intergenic
1104715532 12:131013622-131013644 AGGCTGTGTGGGCTGTGAGCGGG + Intronic
1104901782 12:132193349-132193371 AGGCTGGAAGGGCTGGGAGCTGG - Intergenic
1107295135 13:38899820-38899842 TGTGTGGGAGGGCTCTGTGCAGG - Intergenic
1112821810 13:103346368-103346390 AGGGAGGTAAGGCTTTGAGTTGG + Intergenic
1113629488 13:111872523-111872545 AGTGTGGGTGGTCTTTCAGCTGG + Intergenic
1114503587 14:23190762-23190784 AGCGTTGGAGGGTTTTGAACAGG - Intronic
1114974624 14:28079287-28079309 AGGCTGGGAGAGTTTTCAGCTGG - Intergenic
1117957216 14:61131911-61131933 AGGGCGGGTGGGCTTGGTGCCGG - Intergenic
1118896457 14:69949639-69949661 AGGGTGGGAGGGAATGGAGAAGG + Intronic
1118899454 14:69974292-69974314 AGGCTGGGACTGCTTTGAGGAGG + Intronic
1119182621 14:72614899-72614921 AGGGTGGGAGGGCATTTGGGAGG - Intergenic
1119379739 14:74220982-74221004 ATGTTGGGATGGCTTTGCGCAGG - Intergenic
1119870212 14:78010620-78010642 TGGATGTGGGGGCTTTGAGCTGG + Intergenic
1121330963 14:93049653-93049675 AGGGTGGGAGAGCCCAGAGCTGG + Intronic
1121358688 14:93235403-93235425 GGGGTGGGAAGGCTTTGTGTGGG - Intergenic
1122799016 14:104220680-104220702 GGGGTGAGAGGGCTTGGAGGGGG + Intergenic
1122969751 14:105147746-105147768 AGTGTGGGAGGGGTGTGGGCGGG - Intronic
1125091625 15:35799597-35799619 AGGATTGGAGGGCGTTGAACTGG + Intergenic
1126678563 15:51182869-51182891 AGGGTGGGAGGGATGTCAGTGGG - Intergenic
1127484321 15:59405295-59405317 AGAGTGGGAGGGGTTTGGGAGGG + Intronic
1128613247 15:69090269-69090291 AGAGAGGGAGGGCTTGGAGCAGG - Intergenic
1128783809 15:70380112-70380134 GGGCTGAGAGGGCTCTGAGCCGG - Intergenic
1129187991 15:73922360-73922382 TGGGTGGGAGGGCCCTGAGCTGG - Intergenic
1129200664 15:73997020-73997042 AGGGTGGGAGCGGCTAGAGCAGG + Intronic
1129231469 15:74199436-74199458 AGAGTGAGAGGCCTTGGAGCTGG - Intronic
1129241242 15:74253380-74253402 AGTGAGGGAGGCCATTGAGCAGG + Intronic
1130056041 15:80526967-80526989 AGGGTGGGATGGCTGGGGGCTGG - Intronic
1131510468 15:93047149-93047171 AGGGTGGGAGGCCTGAGAGGAGG + Intronic
1131565614 15:93482899-93482921 AGGGTGAGAGGGCTTTGAGACGG + Intergenic
1132565262 16:619556-619578 TCAGTGGGAGGGATTTGAGCGGG + Intronic
1132590056 16:722616-722638 TGGGTGGGAGGGTTCTGTGCTGG + Exonic
1132681711 16:1145127-1145149 AGGGAGGGAGGGCTGACAGCAGG - Intergenic
1132762730 16:1518811-1518833 AGGGTGTGTGGCCTGTGAGCTGG + Intronic
1134103576 16:11469887-11469909 AGGATGGGAGGGGTCTGTGCAGG - Intronic
1134277920 16:12792979-12793001 AGGGTAGAAGGGATTTCAGCAGG - Intronic
1134714530 16:16350382-16350404 AGGGTGGAAGGGGATAGAGCAGG - Intergenic
1134722405 16:16393746-16393768 AGGGTGGAAGGGGATAGAGCAGG - Exonic
1134796116 16:17038656-17038678 TGAGTGGGAGGGTTTTGAGCAGG - Intergenic
1134945022 16:18318123-18318145 AGGGTGGAAGGGGATAGAGCAGG + Exonic
1134952286 16:18358276-18358298 AGGGTGGAAGGGGATAGAGCAGG + Intergenic
1135165849 16:20138596-20138618 CAGGTGGAAGGGCTTTGAACTGG + Intergenic
1137607984 16:49799557-49799579 AGGGTGAGAGGGAGATGAGCTGG - Intronic
1138271723 16:55700334-55700356 AGGGTGGGAGGGGGCTGAGGGGG + Intronic
1138657907 16:58501311-58501333 AGGGGAGTGGGGCTTTGAGCCGG - Intronic
1139269169 16:65665920-65665942 AGGATGGGAGGGGACTGAGCTGG + Intergenic
1139649352 16:68354683-68354705 AGGGTGGGCAGGCCATGAGCAGG - Intronic
1142345734 16:89552921-89552943 AGGATGCGTGGGCTTTGAGGAGG - Intronic
1142518653 17:490073-490095 CGGGTGGGAGGCCTTTGGGTGGG - Intergenic
1143697249 17:8630114-8630136 AGGGTGGGGGGGCGCTGGGCAGG - Intronic
1143759495 17:9090801-9090823 AGGCTGGCAGGGCCTTGAGGAGG + Intronic
1143927875 17:10389187-10389209 AGCTTTGGAGGGTTTTGAGCAGG - Intergenic
1144394824 17:14833959-14833981 GAGGAGGAAGGGCTTTGAGCAGG - Intergenic
1144659143 17:17057163-17057185 TGGGTGGGAGGGCTATGGGTGGG + Intronic
1144762783 17:17716861-17716883 AGGGTGGGATGGCATGGAGCAGG + Intronic
1145775160 17:27522583-27522605 AAAGTGGGAGGGCTTTGTGGTGG + Intronic
1146054652 17:29575032-29575054 GGAGTGGGAGGGCCTCGAGCTGG - Intronic
1146456723 17:33014660-33014682 AGGCTGGGAGGGATGGGAGCAGG + Intronic
1147565631 17:41534965-41534987 AGAGTGGGAGGGCTTTCCTCAGG - Intergenic
1148283718 17:46369664-46369686 AGGAAGGAAGGGCTTTGAGTGGG - Intergenic
1148305936 17:46587581-46587603 AGGAAGGAAGGGCTTTGAGTGGG - Intergenic
1148332065 17:46819000-46819022 AGGGCGCGGGGGCTTTGACCCGG + Intronic
1148456315 17:47813329-47813351 AGGGTTGAAGGGCTTGCAGCCGG + Exonic
1148466902 17:47870487-47870509 TGAGGGAGAGGGCTTTGAGCTGG + Intergenic
1149663071 17:58346050-58346072 GGGGTGGGAGGGATTTGGGTTGG - Exonic
1150458641 17:65328610-65328632 AGTGTGGGAGGGGTTTGCACTGG - Intergenic
1150484416 17:65533789-65533811 AGGGTGGGAGGGGGCTCAGCAGG - Intronic
1151538458 17:74751714-74751736 GGGGGAGGAGGGCTTTAAGCAGG - Intronic
1151942369 17:77300782-77300804 GGGATGGGGGCGCTTTGAGCTGG - Intronic
1152285598 17:79410930-79410952 AGAGTGGGAGGGGTGTGAGCAGG - Intronic
1152684523 17:81687508-81687530 GGCCTGGGAGGGCTCTGAGCGGG + Intronic
1153651609 18:7245905-7245927 AGGGTGAGTGGGCTTTGGCCAGG - Intergenic
1155304065 18:24462184-24462206 AGGGTGAGTGAGCTTGGAGCTGG + Intronic
1156101032 18:33594935-33594957 AGGCTGGGAGTTCTTTGAGTTGG + Intronic
1156209619 18:34925492-34925514 AGGGTGGAAGGGATGTGAGAGGG + Intergenic
1157148532 18:45191083-45191105 AAGCTGGGAGGGCATGGAGCTGG - Intergenic
1157826616 18:50818192-50818214 CGGGTGAGAGGGCTTGGAGAAGG - Intronic
1160011186 18:75108034-75108056 TGGCTGGGAGGGCTTTGTGCTGG - Intergenic
1160134933 18:76263709-76263731 AGTGTGAGAGGGCTCTGTGCTGG - Intergenic
1160373768 18:78395664-78395686 AGGGTAGGATGGGTGTGAGCAGG - Intergenic
1160814505 19:1028883-1028905 AAGCTGGGTGGGCTGTGAGCTGG + Intronic
1160960525 19:1718767-1718789 AGGCTGGGAGCGCTTGGAGTGGG - Intergenic
1161359346 19:3838597-3838619 GCCTTGGGAGGGCTTTGAGCAGG - Intronic
1161468027 19:4442892-4442914 AGAGAGGGAGGGTCTTGAGCTGG - Intronic
1162909679 19:13842353-13842375 AGGGTGGGAGGGCTTGTGTCCGG - Intergenic
1163007551 19:14406201-14406223 AGGGTGGGCGGGTCTGGAGCGGG - Intronic
1163178637 19:15583500-15583522 AGGCGGGGAGGGCTTTGGGCAGG + Intergenic
1163515136 19:17758268-17758290 AGTGGGGGAGGGGGTTGAGCAGG + Intronic
1163701624 19:18789319-18789341 AGGGTCAGAGGGCTTCGAGCTGG + Intronic
1163780042 19:19241454-19241476 AGTCTGGGAGGGCTTGAAGCAGG - Intronic
1164148457 19:22528057-22528079 AGGGTGTGACAGCTTTTAGCTGG - Intronic
1164683350 19:30150541-30150563 AGCGTGGCAGGGCTTTGAAAAGG + Intergenic
1164856596 19:31529709-31529731 AGGGTGTGGGGGCTGTGGGCAGG - Intergenic
1165730876 19:38143869-38143891 GTGGTGGGAGGGTTTGGAGCAGG - Intronic
1165926132 19:39327400-39327422 AGGCTGGGAGGGCTTGGAGCTGG + Intergenic
1166108248 19:40608098-40608120 AGAGTGTCAGGGGTTTGAGCTGG - Intronic
1166593921 19:44027621-44027643 AGGGTGGGAAGGGTGGGAGCAGG - Intronic
1166882200 19:45936404-45936426 AGGGTGGGAGGGCTGTGGAAGGG + Exonic
1167138341 19:47632093-47632115 GCCATGGGAGGGCTTTGAGCTGG + Intronic
1167295212 19:48645656-48645678 AGGGGGGCAGGGCGTTGGGCAGG - Exonic
1167525797 19:49983120-49983142 AGGGAGGGTGGGCTGTGAGCAGG - Intronic
1167571300 19:50290612-50290634 ACCATGGGAGGGCTATGAGCAGG + Intronic
925135428 2:1522973-1522995 AGCGTGGGAGGGATCTGAGGAGG - Intronic
925136804 2:1528532-1528554 AGAGTGGGAGGGATTTGAGGAGG - Intronic
925137147 2:1529880-1529902 AGAGTGGGAGGGATTTGAGGAGG - Intronic
925137563 2:1531528-1531550 AGAGTGGGAGGGATTTGAGGAGG - Intronic
925138994 2:1537274-1537296 AGGGTGGGGGGGATTTGGGGAGG - Intronic
925235506 2:2273643-2273665 AGGGTAGGGGGGCTGTGACCAGG + Intronic
925443846 2:3910585-3910607 TTGGTGGCAGGGGTTTGAGCTGG + Intergenic
925644283 2:6020344-6020366 AGGGAGGGATGGCTTGGAGATGG + Intergenic
925847343 2:8045608-8045630 AGGGTGGGTGGGATTTATGCAGG - Intergenic
925859312 2:8159683-8159705 AGGCAGGGAGGGCTTCAAGCAGG - Intergenic
929211871 2:39366245-39366267 AGGGTGGGACAGCTTGAAGCAGG + Intronic
929485785 2:42352971-42352993 AGGGTGTGAGGGTTTTGAAATGG - Intronic
931023800 2:58084363-58084385 AGGGTGGGAGGGCATTTGGGAGG - Intronic
931115746 2:59164742-59164764 AGGGTGGGGGTGCCTTGAGAAGG + Intergenic
931869564 2:66444156-66444178 AGGGTGGGAGGGTGCAGAGCAGG - Intronic
932064393 2:68538107-68538129 AGGATTGGAGGGATTAGAGCTGG - Exonic
932471431 2:71962010-71962032 AGGGTGGGTGGGCATTAACCAGG - Intergenic
932897146 2:75651216-75651238 CGGGTGGGAGGGATTTGGGTTGG - Intronic
933474799 2:82776560-82776582 AGAGTGGGAGGGAATTGAGGGGG + Intergenic
934178047 2:89594813-89594835 AGAGTGATAGGGCTTTGAGGTGG - Intergenic
934288348 2:91669104-91669126 AGAGTGATAGGGCTTTGAGTTGG - Intergenic
935131659 2:100265307-100265329 GGGGAGGGAGGGCTTAGGGCTGG - Intergenic
935338488 2:102038225-102038247 AGGGTGGGGTGGCTTTGGGAGGG + Intergenic
935373700 2:102374097-102374119 AGGGTGGGCAGGGGTTGAGCGGG - Intronic
937004151 2:118496161-118496183 AGGGTGGGGTGGCTGTGACCCGG - Intergenic
937261117 2:120587300-120587322 AGGGTGGGAGGGCAGGGCGCGGG + Intergenic
938261972 2:129903022-129903044 AGGGAGGGAGGGCTCAGGGCAGG - Intergenic
938321516 2:130369234-130369256 AGGGTGGAAAGGCTTTGGGTTGG + Intronic
938826647 2:135012313-135012335 AGGGTGGGAGGGGTGGGAGGTGG + Intronic
938897388 2:135765745-135765767 AGGGTCTGTGGGCTTTGAGCAGG + Intronic
942058882 2:172209631-172209653 TGGGCAGGAGGGATTTGAGCTGG + Intergenic
942165202 2:173234549-173234571 AGAGTGGGTGGCCCTTGAGCCGG + Intronic
944151381 2:196562227-196562249 AGGGTGGGAGGGTTTAAAGCTGG - Intronic
946225979 2:218264340-218264362 AGGGTGGGAGGGCCCTGGGCTGG + Exonic
946907730 2:224432300-224432322 AGGAAGGGAGGGTTTGGAGCAGG - Intergenic
947353710 2:229271541-229271563 AGGGGGGAAGGGCCTGGAGCCGG + Intergenic
947403643 2:229752741-229752763 AGGGTGGGTGGGCCGAGAGCAGG + Intergenic
947644674 2:231729666-231729688 AGTGTGGGTGGGATTTGAACTGG - Intergenic
948395724 2:237643590-237643612 AGGGAGGGAGGCCTATGAGAGGG - Intronic
948850793 2:240704397-240704419 AGGGTGGGAGGGTTGGGAGAGGG - Intergenic
949032193 2:241802463-241802485 TGGGTGGGAGGGCTGTGGGCAGG + Intronic
1169867889 20:10219555-10219577 CGGGTGGGAGGGCTCTGCGGAGG + Intronic
1170397426 20:15942295-15942317 AGGGTGGGCAGGAGTTGAGCTGG + Intronic
1170889836 20:20367975-20367997 AGGGTGGGAGGGCGATGGGGCGG - Intergenic
1172013960 20:31862105-31862127 AGAGGGGGAGGGCTCTCAGCAGG - Intronic
1172129388 20:32645626-32645648 AAGCTGGGAGGGCTTGGTGCTGG - Intergenic
1172132852 20:32667237-32667259 GTCGTGGGAGGGCTTTAAGCAGG + Intergenic
1172327843 20:34050842-34050864 CTGGTGGGAGGCCTGTGAGCTGG - Intronic
1172424518 20:34846263-34846285 AGGGAGGGAGGGCTGGAAGCAGG - Intronic
1172424599 20:34846687-34846709 GCTGTTGGAGGGCTTTGAGCAGG - Intronic
1172530276 20:35626276-35626298 AGGGTGGAAGTGGCTTGAGCGGG + Exonic
1172716699 20:36969559-36969581 AGGTTAGGAGGTCATTGAGCTGG + Intergenic
1173248735 20:41353527-41353549 AGGATGGGTGGGCCTTGAGCTGG + Intronic
1173819383 20:46010796-46010818 AGGCTGGGAGAGCTTCGCGCAGG + Intronic
1174136265 20:48382181-48382203 AGGGTGGGAGGGGGAAGAGCAGG + Intergenic
1174300705 20:49580171-49580193 GGGGTGGGAGGGCTGAAAGCTGG + Intergenic
1174388017 20:50198307-50198329 AGGCTGGGCGGGCTGTGAGGTGG + Intergenic
1175187495 20:57188856-57188878 AGTGAGGAAGGCCTTTGAGCTGG + Intronic
1177909859 21:27017701-27017723 TGAGTGGGAGGGATATGAGCAGG - Intergenic
1179911034 21:44448979-44449001 AGGAAGTGAGGACTTTGAGCTGG + Intergenic
1180183529 21:46128519-46128541 AGGGTGGCTGGGCTTTGGGGTGG - Intronic
1181038942 22:20182905-20182927 GGGGTGGGAGGGCCCTGGGCTGG + Intergenic
1181049984 22:20233850-20233872 AGGAAGGGAGGGCTCTGGGCAGG + Intergenic
1181304107 22:21904673-21904695 ATGGTGGCAGGGCTCTGAGAGGG + Intergenic
1181438434 22:22923453-22923475 AGGGTGGGTGGGAGCTGAGCTGG - Intergenic
1181776834 22:25166020-25166042 GCTGTGGAAGGGCTTTGAGCAGG + Intronic
1182490563 22:30668659-30668681 AGTGTGGGATGGGTTCGAGCTGG - Intronic
1183827793 22:40402034-40402056 AGGCTGGGTGGGATTTTAGCAGG + Intronic
1184340427 22:43882900-43882922 AGGCTGGGAAGGGTTTAAGCAGG - Intronic
1184559674 22:45254802-45254824 AGGGTGGGCTGGCTGTCAGCAGG + Intergenic
1185065336 22:48629203-48629225 AGGGTGGGAGGGCCTAGATGGGG - Intronic
949612905 3:5721138-5721160 TGGGTGGCAGGGCTTTAAACTGG - Intergenic
950127067 3:10516298-10516320 ATGGTGGGAGGGCTAAGAGCAGG - Intronic
950420931 3:12899158-12899180 AGGGTGGGAGGGATGTGAGGAGG + Exonic
950552677 3:13676206-13676228 AGGGGAGGGGGCCTTTGAGCAGG - Intergenic
950637307 3:14324136-14324158 AGGGTGGGAAGCATTTGGGCCGG + Intergenic
950654793 3:14429941-14429963 ATGGTGGGGGTGATTTGAGCTGG + Intronic
954145605 3:48632895-48632917 AGGGTGAGGGGGCACTGAGCAGG - Intronic
954340207 3:49947266-49947288 GGGGGGGGGGGGTTTTGAGCTGG + Intronic
954396874 3:50297706-50297728 AGGGAGGGTGGGGTTGGAGCAGG + Intronic
956733125 3:72214880-72214902 GGGGTGGGAGGTTTTTGAGGAGG - Intergenic
956899937 3:73704765-73704787 AGGCGGGGAGGGCATTTAGCAGG + Intergenic
960593565 3:119388456-119388478 AGCATTGGAGGGTTTTGAGCAGG + Intronic
960926922 3:122803552-122803574 AGGCTGTGAGGGTTATGAGCAGG + Intronic
961567478 3:127774043-127774065 CTGGAGGGAGGGCTGTGAGCAGG - Intronic
962005649 3:131346764-131346786 ATGGTGGGAGGGCATTGAGGGGG + Intronic
966903016 3:184500567-184500589 AGGGTGGGACGCCTTTAAGAGGG + Intronic
967317632 3:188164186-188164208 AGGATGGGAAGGCTTAGACCAGG + Intronic
968317374 3:197736429-197736451 AGGGTGGGTGGGATTTGCGGAGG - Intronic
968609387 4:1550251-1550273 GGGGTGGGAGGGCTTTGGCAGGG - Intergenic
968818322 4:2833047-2833069 AAGGTGAGAGGGCTCTGAGTGGG + Exonic
968969910 4:3788358-3788380 AGGGAGGGAGGACAGTGAGCTGG + Intergenic
971728807 4:30349580-30349602 AGGGTGGGACGACTTGAAGCTGG - Intergenic
975732101 4:77347443-77347465 GGGGTGGGGGGGCGGTGAGCAGG + Intronic
977688263 4:99874205-99874227 AGGGAGTTAGGGCTTTGATCTGG + Intergenic
979198052 4:117943228-117943250 AGAGTGGTAGGGCTTTGCTCTGG - Intergenic
982215162 4:153076373-153076395 AGGCTGGATGGGATTTGAGCAGG - Intergenic
986602533 5:9487399-9487421 AGGAAGGGATGGGTTTGAGCAGG + Intronic
988787927 5:34581185-34581207 AGCCTTGGAGGGCTTTAAGCAGG - Intergenic
990003483 5:50921574-50921596 GGGGTGGGAGGGCTTTGGCAGGG + Intergenic
990486373 5:56262981-56263003 AGGGTGGGAAGGTTAAGAGCTGG + Intergenic
992169706 5:74089597-74089619 AGGGAGGCAGGGCTGGGAGCAGG - Intergenic
994666235 5:102708838-102708860 AGGGAGGGAGGGATTTGGACAGG + Intergenic
995708938 5:115015058-115015080 AGGGAGGTATGGCCTTGAGCAGG - Intergenic
999561838 5:152812119-152812141 AGAGTGGGAGGGCTGCTAGCAGG - Intergenic
1000353183 5:160368628-160368650 AGGTTGGCAGGCCTTTGACCAGG + Intronic
1001137471 5:169114641-169114663 AGGCTGGGAGGGCCATGAGGAGG + Intronic
1002581442 5:180211578-180211600 AGGGTGGCAGAGCTTTGCTCTGG + Intergenic
1004400953 6:15288260-15288282 AAGGTGGGAGGGGTGGGAGCAGG + Intronic
1005002848 6:21260103-21260125 AGGGTGAGAGTGCTGTGGGCAGG + Intergenic
1006106833 6:31721857-31721879 GGGGTGGGAAGGCACTGAGCAGG + Intronic
1006794219 6:36721788-36721810 ATGGTGGGAGGGGTTTGTGTGGG - Exonic
1006794380 6:36722415-36722437 ATGGTGGGAGGGGTTTGCGTGGG - Exonic
1007051521 6:38835817-38835839 AGGGTTGGAGGGTTCTAAGCAGG + Intronic
1008080409 6:47188767-47188789 AGGGCGGGAGGGGTTGGGGCAGG + Intergenic
1008679454 6:53856846-53856868 AGGGGTGGAGGGCCTTGAGAGGG + Intronic
1010258233 6:73785360-73785382 ATGGTTGGAAGGCTTGGAGCTGG - Exonic
1010708287 6:79140341-79140363 AGGGTGGGAGGGAGTGGATCTGG + Intergenic
1011130452 6:84046848-84046870 AGGGTGAGAGGACCATGAGCTGG + Intronic
1011751502 6:90459399-90459421 AGGTTTGGATGGCTTTGGGCAGG + Intergenic
1012091469 6:94902956-94902978 AGGGTGGTAGAGCACTGAGCAGG + Intergenic
1013418937 6:109948989-109949011 AGGGTGGGAAGGCTTAGCGTTGG + Intergenic
1014788134 6:125641192-125641214 ACGGTGGGAGGCCTTTGGCCGGG + Intergenic
1015868904 6:137755771-137755793 ATGATGGGAGGGTTTTAAGCAGG + Intergenic
1016841927 6:148533529-148533551 AGGGTGGAGGGGCTGTGACCGGG + Intronic
1016872212 6:148829528-148829550 AGAGTGGGGTGGATTTGAGCCGG - Intronic
1018054171 6:160037260-160037282 TTTGTGGGAGGGTTTTGAGCTGG + Intronic
1018705017 6:166457706-166457728 AGGGTTGCGGGGCTTTTAGCGGG - Intronic
1019308116 7:345985-346007 AGGGTGGGCAGGGTGTGAGCGGG + Intergenic
1020634562 7:10680944-10680966 AGGGTTTGAGGGCTTTGGGGAGG - Intergenic
1022501204 7:30883348-30883370 AGGGTGGGGGAGGCTTGAGCAGG + Intronic
1022526779 7:31043147-31043169 AGGGAGGGAGGGCTTCGGGGCGG - Intergenic
1023078843 7:36508866-36508888 GGGGTGGGGGTGCTTTGAGAAGG - Intergenic
1023626236 7:42117831-42117853 AGGGTGGGAAAGCCTCGAGCTGG - Intronic
1023847620 7:44131550-44131572 AGGGTGGGGGAGCCGTGAGCTGG - Intergenic
1023885017 7:44348380-44348402 AGGGTGGAAGAGCTTGGGGCAGG + Intergenic
1024334244 7:48188974-48188996 AGAGTAGGAGGGCTTTGTGGTGG + Intronic
1026952209 7:74355115-74355137 AGGCTGTGACTGCTTTGAGCAGG + Intronic
1027229156 7:76262085-76262107 AGTGTGGGGGAGCTCTGAGCAGG + Intronic
1028373347 7:90119243-90119265 AGGGTGGGGGGGCTGTGCGTGGG + Intergenic
1028792177 7:94865435-94865457 CTGGTGGGAGGTGTTTGAGCAGG + Intergenic
1032401835 7:131629342-131629364 AGTGTGGGGGGGCGTGGAGCGGG + Intergenic
1032781845 7:135170342-135170364 AGGGAGGGCGGGCTGTGAACTGG - Intronic
1034889798 7:154829792-154829814 AGGGTGGGAGGGCTTTGAGCAGG - Intronic
1035245553 7:157560246-157560268 AAGGTGGGAGACCTGTGAGCTGG + Intronic
1035357000 7:158281952-158281974 ACGATGGCTGGGCTTTGAGCTGG - Intronic
1037513895 8:19610674-19610696 AGAGTGGGAGGGCTTTCCTCGGG - Intronic
1037806095 8:22058619-22058641 AGGGAGGGCAGGCCTTGAGCAGG + Intronic
1037878993 8:22563908-22563930 AGGGTGAGAGGGCTGTGTGCTGG + Intronic
1038002184 8:23401725-23401747 AGTGTGGAAGGGCTTTGTGAAGG - Intronic
1038661927 8:29504976-29504998 AGGGTGGCAGGGCTCTAAGGGGG - Intergenic
1047109648 8:121774921-121774943 ATGGTGGGTAGGCTGTGAGCAGG - Intergenic
1047355669 8:124119350-124119372 AGGGTGGTGGGGCCTTGGGCTGG + Intronic
1047747205 8:127854062-127854084 AGGGTGGGCGGCCTTGGGGCAGG - Intergenic
1048032119 8:130642644-130642666 AGGGTGGGAGGGCTTCCTGGGGG + Intergenic
1048292323 8:133190680-133190702 CGGGTGTGTGGGCTTTGAGAGGG - Intergenic
1048536040 8:135295583-135295605 AGGGTGGGAGGGCACAGAGTAGG - Intergenic
1049419718 8:142511244-142511266 AGGGTGGGTGGGCGCCGAGCGGG + Intronic
1049637359 8:143696163-143696185 CGGGTGGGTGGGCTGTGAGTCGG + Intronic
1049783481 8:144439542-144439564 AGGGAGAGAGGGCTGAGAGCGGG - Intronic
1051165378 9:14256740-14256762 AGGGTGAGAGGGAGCTGAGCAGG + Intronic
1051524068 9:18022916-18022938 AGGATGGGAGGCCAGTGAGCTGG - Intergenic
1051551829 9:18338398-18338420 AAGGTGTGAGGACTCTGAGCAGG - Intergenic
1053641017 9:40080233-40080255 GGGGTGGGAGGGGTTGGGGCTGG + Intergenic
1053765119 9:41385235-41385257 GGGGTGGGAGGGGTTGGGGCTGG - Intergenic
1054321761 9:63676529-63676551 GGGGTGGGAGGGGTTGGGGCTGG + Intergenic
1054543735 9:66296397-66296419 GGGGTGGGAGGGGTTGGGGCTGG - Intergenic
1055147988 9:72959079-72959101 GTGGTGGGAGGGCTTTGAAATGG + Intronic
1055863679 9:80786313-80786335 GGGGTGGGAGGGCTTGGGGAGGG + Intergenic
1057037076 9:91818842-91818864 AGGGTGGGAGGGAGTTGAGTTGG - Intronic
1057391622 9:94645585-94645607 AAGATGGGAGGGTTTTAAGCTGG + Intergenic
1058429603 9:104906541-104906563 TGGGTGGGAGGAATTGGAGCAGG - Intronic
1058603528 9:106696807-106696829 AGAATTGGAGGACTTTGAGCTGG - Intergenic
1058675010 9:107392870-107392892 AGAGAGGGAGGGATATGAGCTGG - Intergenic
1058694407 9:107547299-107547321 AGGATGGGAAGGCTTTTAGGAGG + Intergenic
1059543650 9:115155108-115155130 AGTGTGGGAGAGCTGTGAGCTGG + Intronic
1060197270 9:121631870-121631892 ACCGTGGCAGGGCTTTCAGCAGG + Intronic
1060816594 9:126638429-126638451 AGGGTGGCAGGGCTGCGGGCAGG - Intronic
1061079233 9:128360362-128360384 ACGGAAGGAGGGCTTTGACCCGG + Exonic
1061571247 9:131478631-131478653 AGGGTGGGGGGGCATGGGGCTGG + Intronic
1061807266 9:133143421-133143443 GTGGTGGGAGGGCCTTGTGCGGG + Intronic
1062049969 9:134442211-134442233 AGGATGGGAGGCCTCTCAGCAGG - Intergenic
1062218120 9:135399986-135400008 AGGGTGGGTGGGGTCTGAGAGGG + Intergenic
1062298323 9:135847700-135847722 GGGGTGGGAGGGCTAGGAGAGGG + Intronic
1185471678 X:387330-387352 AGGCTGGGAGGTGTGTGAGCGGG + Intergenic
1186200906 X:7153883-7153905 AGAGAGGGAGGGAGTTGAGCAGG - Intergenic
1190304142 X:49072880-49072902 AGGATGGGAGGGCCTGAAGCGGG - Intronic
1192847735 X:74924153-74924175 AGGGCGGGAAGGCCGTGAGCCGG - Intronic
1197773593 X:130106186-130106208 AGGGAGGGAAGGCTTTGTGAGGG - Intronic
1197872068 X:131070157-131070179 AGAGGTGGAGGGCTTTGAGGAGG - Intronic
1198210196 X:134509091-134509113 AGGGAGGGAGGTCTTTGAGGAGG - Intronic
1198414059 X:136401919-136401941 AAGGTGGGAGGCCTGTGAGGAGG - Intronic
1198458238 X:136838391-136838413 TGGGTTGGAGGTCTTTGAACTGG - Intergenic
1199452437 X:147991539-147991561 AGGGAAGGAGGCCTTTGAGCAGG - Intronic
1199808770 X:151328438-151328460 AGGGTAGCAGGGCTAGGAGCAGG - Intergenic
1200214607 X:154362181-154362203 AGGGTAGGAGGGCTTGGGGCAGG - Intronic
1201708371 Y:16961813-16961835 GGGGTTGGAGGGGTTTGAGAGGG + Intergenic