ID: 1034889799

View in Genome Browser
Species Human (GRCh38)
Location 7:154829803-154829825
Sequence GGTGGTGGTGAAGGGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1954
Summary {0: 1, 1: 1, 2: 21, 3: 207, 4: 1724}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889799_1034889811 12 Left 1034889799 7:154829803-154829825 CCCTCCCACCCTTCACCACCACC 0: 1
1: 1
2: 21
3: 207
4: 1724
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889799_1034889808 3 Left 1034889799 7:154829803-154829825 CCCTCCCACCCTTCACCACCACC 0: 1
1: 1
2: 21
3: 207
4: 1724
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889799_1034889810 11 Left 1034889799 7:154829803-154829825 CCCTCCCACCCTTCACCACCACC 0: 1
1: 1
2: 21
3: 207
4: 1724
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889799 Original CRISPR GGTGGTGGTGAAGGGTGGGA GGG (reversed) Intronic
900099583 1:955892-955914 GGAGGGGGTGAAGGGGGGTAGGG - Intronic
900124132 1:1062097-1062119 GGTGGTGAGGGAGGGAGGGAAGG - Intergenic
900331641 1:2137759-2137781 GGTGGTGGTGGGGAGGGGGAGGG - Intronic
900438187 1:2641196-2641218 GGTTGTGGGGAGGGTTGGGAAGG + Intronic
900530801 1:3152170-3152192 TGTGATGGTGAAGGTGGGGAAGG + Intronic
900622843 1:3595295-3595317 GGTGGAGGTGGAGGGAGGGCGGG + Intronic
900747314 1:4369594-4369616 GATGGTGGTGACGATTGGGATGG + Intergenic
900785310 1:4645936-4645958 GGTGGTGGTGAGGAGAGGGAGGG - Intergenic
900785482 1:4647100-4647122 GGTGGTGGTGATGGTGGTGATGG + Intergenic
900785495 1:4647190-4647212 GATGGTGGTGATGGTTGTGATGG + Intergenic
900945596 1:5829763-5829785 GGTGGTGGTGATGGTGGTGATGG + Intergenic
901126737 1:6934660-6934682 GGTGGTGGTGAAGGGAGGGGAGG - Intronic
901404779 1:9038751-9038773 GGTGGAGGCGCAGGATGGGAGGG + Intronic
901565185 1:10108189-10108211 GGGGGCGGTGGAGGCTGGGAGGG - Intronic
901897556 1:12327461-12327483 GGTGGGGGTGGGGGGTGGGAGGG - Intronic
902389461 1:16094670-16094692 GGTGGTGGTGACGGTGGTGACGG - Intergenic
902389479 1:16094745-16094767 GGTGGTGGTGACGGTGGTGACGG - Intergenic
902389489 1:16094790-16094812 GGTGGTGGTGATGGTGGTGATGG - Intergenic
902542726 1:17166173-17166195 GGTGATGGTGATGGTAGGGATGG - Intergenic
902723480 1:18320306-18320328 CGTGGTGCTGAAGGCGGGGAAGG - Intronic
902737931 1:18413598-18413620 AGGGGTGGGGAGGGGTGGGAGGG - Intergenic
902881082 1:19372167-19372189 AGTGGAGGAGCAGGGTGGGAGGG - Intronic
902962881 1:19977212-19977234 GGTCATGGTGGAGGGTGGGGAGG - Intronic
903001476 1:20269290-20269312 GGGGGTGGTGGGGGGTGGGCAGG - Intergenic
903281694 1:22253943-22253965 GGTGGAGGTGCAGGCAGGGAGGG - Intergenic
903329214 1:22588612-22588634 GGTGGTCCTGATGGGTGGGGGGG + Intronic
903533483 1:24050416-24050438 GGTGGTGGTTGAGGGTCTGATGG + Intergenic
903558742 1:24212162-24212184 GGTGGTGGTGGAGGTGGTGAGGG + Intergenic
903671390 1:25037828-25037850 GGGGGTGGGGAGGGGAGGGAGGG - Intergenic
903842922 1:26257254-26257276 TGTGCTGCTGAAGAGTGGGAAGG + Intronic
903946736 1:26968790-26968812 GGTGGCGGTGAAGGGGGTGAGGG + Intergenic
904031241 1:27534774-27534796 CGTGGAGGAGATGGGTGGGAGGG + Exonic
904088984 1:27931328-27931350 GGGGGTAGTGAAAGGAGGGAGGG - Intergenic
904310615 1:29627120-29627142 GGTTCTGGTGGAGGGTGGAAAGG - Intergenic
904325175 1:29723558-29723580 GGTGGTGGTGATGGTGGTGATGG - Intergenic
904325214 1:29723717-29723739 GGTGGTGGTGATGGTGGTGATGG - Intergenic
904325260 1:29723963-29723985 GGTGGTGGTGATGGTTGTGGTGG - Intergenic
904326163 1:29728073-29728095 GTGGGTGGTGGAGGGTGGGGAGG + Intergenic
904377981 1:30093794-30093816 GGTGGTGGTGGAGGGTGGGAAGG + Intergenic
904433341 1:30479185-30479207 GTGGGTGGTGGAGGGTGGGGAGG - Intergenic
904457302 1:30655449-30655471 GGTGGTGGTGACGGTGGTGACGG + Intergenic
904457311 1:30655482-30655504 GGTGGTGGTGACGGTGGTGATGG + Intergenic
904457371 1:30655701-30655723 GGTGGTGGTGATGGTGGTGATGG + Intergenic
904563798 1:31415207-31415229 GGATGTGGGGAAGGGAGGGAAGG - Intronic
904605386 1:31695272-31695294 GGTGGTGATGGAGGTGGGGAGGG - Intronic
904629415 1:31829904-31829926 GCTGCTGGGGAAGGGTGGGGAGG + Intergenic
904669712 1:32154495-32154517 GGGGAGGGTGAAGGGTGGGTAGG + Intronic
904671596 1:32170130-32170152 GGTGGTGGCGGAGTGTGGGTTGG + Intronic
904710673 1:32427342-32427364 GGTGGTGGTGTAGGGTTGGGTGG + Intergenic
904831185 1:33307609-33307631 GGTGGGGGTGAGGGTTGGGAGGG - Intronic
904831242 1:33307750-33307772 GGTGGGGGTGAAGGTTGGGTGGG - Intronic
904831255 1:33307782-33307804 GGTGGGGGTGAGGGTTGGGGTGG - Intronic
904831306 1:33307918-33307940 GGTGGGGGTGAGGGTTGGGTGGG - Intronic
904840731 1:33370329-33370351 GGAGCTGGAGAAGGGTGGGGAGG - Intronic
904894740 1:33806190-33806212 GGTGGTAGTGACAGGTGAGAAGG - Intronic
904965505 1:34369485-34369507 GGTGAAGGTGGAGGGAGGGATGG + Intergenic
904991194 1:34594152-34594174 GGTGGTGGTGACTTGGGGGATGG - Intergenic
905033840 1:34904696-34904718 GGTGGTGGTGATGGTGGTGATGG + Exonic
905227390 1:36488130-36488152 GGTGGTGGTGGTGGTGGGGAGGG + Intergenic
905254551 1:36671828-36671850 GGAGGTGGGGGAGGGTGGAAAGG - Intergenic
905364024 1:37439106-37439128 GGTGGTGGTGGGGGATGGAAGGG - Intergenic
905450408 1:38052404-38052426 GGTCTTGGTGAAGGGAAGGAGGG + Intergenic
905676608 1:39830336-39830358 GTTGGAGGTGAAGGAAGGGAAGG - Intergenic
905866492 1:41379719-41379741 GCTGGGGGTGAGGGGTGGGAGGG + Intronic
905895679 1:41544585-41544607 GGTGGTGGTGATGGTAGTGATGG - Intronic
905895770 1:41544990-41545012 GGTGGTGGTGATGGTAGCGATGG - Intronic
905895792 1:41545089-41545111 GGTGGTGGTGATGGTAGCGATGG - Intronic
905895819 1:41545221-41545243 GGTGGTGGTGATGGTAGCGATGG - Intronic
905895887 1:41545551-41545573 GGTGGTGGTGATGGTAGTGATGG - Intronic
905895920 1:41545683-41545705 GGTGGTGGTGATGGTGGTGATGG - Intronic
905895947 1:41545791-41545813 GGTGGTGGTGATGGTGGTGATGG - Intronic
906072769 1:43029163-43029185 GGTGATGATGAAGGGGTGGAGGG + Intergenic
906290141 1:44614412-44614434 AGTTGTGGAGAAGGGTGGCAGGG - Intronic
906321829 1:44822135-44822157 GGCAGTGGTGTGGGGTGGGAAGG + Exonic
906556351 1:46717877-46717899 AGTAGTGGTGAAAGGTGGAATGG - Intronic
906614438 1:47225113-47225135 GGTGGTGGTGTCGTGGGGGACGG - Intronic
906685356 1:47759828-47759850 GCGGGTGGTGAAGCGGGGGATGG + Intergenic
906942808 1:50271285-50271307 GGTGGTGGTGCAGGGGGGTAGGG - Intergenic
906943416 1:50275629-50275651 GGTGGTGGTGGTGGGTGGGGCGG - Intergenic
907032302 1:51184374-51184396 GATGATGGTGAAGGTAGGGAAGG + Intergenic
907283194 1:53363818-53363840 GGTGCTTGTGAAGGGTGAGGTGG - Intergenic
907464227 1:54624366-54624388 GGTGGAGGGGCAGGGTGGGAGGG + Intronic
907720063 1:56963581-56963603 GGGGGTGGTGGGGGGTGGGGAGG + Intronic
907866859 1:58407105-58407127 GGTGGGGGTGAGAGGAGGGAAGG - Intronic
907987910 1:59551106-59551128 GGTGGTGGTGGAGAGAGTGATGG + Intronic
908330497 1:63066202-63066224 GGAGGTGGGGCAGGGAGGGAAGG - Intergenic
908416737 1:63920524-63920546 GGTGGTGGAGAATGGCGTGATGG - Intronic
908544202 1:65148165-65148187 GGAGGTGGAGAAGGGCGGGGAGG + Intronic
908779840 1:67680299-67680321 GCTGGAGGTGAAGGGAGGAAAGG + Intergenic
908942181 1:69448291-69448313 TGTGGTGGTGGGAGGTGGGAGGG + Intergenic
909038425 1:70622177-70622199 GGTGGTGGTGGGGGGAGGGGCGG - Intergenic
909551570 1:76903905-76903927 GCTGGGGGTGATGGGTGGGTAGG + Intronic
909632651 1:77783835-77783857 GGTGGTGGGGAATGACGGGAAGG - Intronic
909924897 1:81427394-81427416 GGTGGTGGTGGAGGATATGATGG + Intronic
910083131 1:83365639-83365661 GGTGGGGGTGAGGGTGGGGAGGG + Intergenic
910114467 1:83716903-83716925 TGTGGTGGTGAGGGGAGGGTGGG - Intergenic
910236104 1:85037999-85038021 GGTGGTAGGGCAGGGTGGGTAGG + Intronic
910276665 1:85456846-85456868 TTTGGTGGTGGAGGGTGGGGGGG - Intronic
910598468 1:89005255-89005277 GGAGGTGGTGGAGGGTGAAATGG + Intergenic
911032692 1:93507158-93507180 GGGGGTGGGGGAGGGAGGGACGG - Intronic
911104736 1:94120888-94120910 GGTGGTGGGGTAGGGTGGTGGGG - Intronic
911449811 1:98048597-98048619 GAGGGTGGAGAAGGGGGGGAGGG - Intergenic
911653014 1:100411082-100411104 GGGAGTGGAGAAGGGTGGGCTGG - Intronic
911702253 1:100967278-100967300 GGAGGTGGTGGTGGGAGGGATGG + Intronic
911750674 1:101493694-101493716 GGTGGTGGTGGTGGTTGGGTAGG - Intergenic
911756517 1:101563256-101563278 GGTGGTGGTAAAGAGTCTGAAGG - Intergenic
911935096 1:103960229-103960251 TGTGCTGGTGGAGGGTGGGAGGG + Intergenic
912495293 1:110087937-110087959 GGACGTGGTGGAGGGCGGGAGGG - Intergenic
912500734 1:110120465-110120487 GGTGGTGGTGATGGTGGTGATGG - Intergenic
912826179 1:112905583-112905605 GGGGGTAGGAAAGGGTGGGAAGG + Intergenic
912960426 1:114191075-114191097 GGTTGTGGGGTAGGGAGGGAAGG + Intergenic
913075575 1:115338332-115338354 GGTGGTGGGGAGGGGAGGGATGG - Intergenic
913206887 1:116547154-116547176 ACTTGTGGAGAAGGGTGGGATGG - Intronic
913228386 1:116720580-116720602 GGTGGCGGGGAAGGGAGGGGAGG - Intergenic
913671761 1:121103619-121103641 GGTGATGTAGAAGGGTGGTAGGG - Intergenic
913688711 1:121257985-121258007 GGAGTTGAGGAAGGGTGGGAAGG + Intronic
914023539 1:143891064-143891086 GGTGATGTAGAAGGGTGGTAGGG - Intergenic
914148889 1:145022291-145022313 GGAGTTGAGGAAGGGTGGGAAGG - Intronic
914234819 1:145799610-145799632 GGGGGTGGGTGAGGGTGGGAAGG + Intronic
914422480 1:147541884-147541906 GGTGGGGGAGAAGGGGTGGATGG + Intronic
914662014 1:149799009-149799031 GGTGATGTAGAAGGGTGGTAGGG - Intronic
914815180 1:151057960-151057982 GGTGGTGGTGGCAGGTGGTAAGG + Exonic
915581555 1:156816057-156816079 GAAGGTGCTGAAGGTTGGGATGG + Exonic
915741118 1:158119015-158119037 GGTGGTGGTGAATGGGAGGCGGG + Intergenic
915896394 1:159814448-159814470 GGTGGTAGTGAAGGAGGAGATGG - Intronic
915915406 1:159937645-159937667 GGTGGTGGAGAAGGACGGGGAGG - Intronic
915935991 1:160090669-160090691 GGTGAAGCTGAAGGGTGGGAGGG + Intergenic
916001723 1:160623044-160623066 GGTAGTGGGGAATTGTGGGATGG + Intronic
916040953 1:160961000-160961022 GGTGGTAGTGAAGGTTGTGAAGG - Intergenic
916045961 1:161000113-161000135 GGTGGTGGTGAAAGATGTGTGGG - Intronic
916148946 1:161767056-161767078 GGTGGTCAGGAAGGGTGGAATGG + Intronic
916665223 1:166960759-166960781 AGTGGTGGTGAAGGGAAGCATGG - Intronic
916705315 1:167343156-167343178 GGTGGGGGTCAAGGGGGAGAAGG + Intronic
917057837 1:171003639-171003661 GGAGGTGGTGGAGGGTGCAATGG + Intronic
917242733 1:172966578-172966600 GGGGAGGGTGAAGGCTGGGATGG - Intergenic
917441407 1:175072241-175072263 GGTGGTGTGGGAAGGTGGGAGGG - Intronic
917598567 1:176553376-176553398 GGGGCTGTTGAGGGGTGGGATGG + Intronic
917980706 1:180267246-180267268 GGTTGTGGTGAAGGGGGTGGGGG - Intronic
917991009 1:180378826-180378848 GGTGGTGGTGGTGGCTGTGATGG - Intronic
918008897 1:180568009-180568031 TGGGGTGGTGAAGGCTGGGGTGG - Intergenic
918015759 1:180631414-180631436 GTTGGGGGTGAGGGTTGGGAGGG - Intergenic
918022020 1:180703298-180703320 AGTGGTGGTGATGGGTGGAGTGG + Intronic
918178981 1:182069897-182069919 GGAGGTGGTGACAGGTGGGTGGG - Intergenic
918205047 1:182300709-182300731 TGTGTTGGTGGAGGGTGGGTGGG + Intergenic
918278161 1:182974564-182974586 GGTAGTGGTGAAGGAAAGGAAGG + Intergenic
918944658 1:191047966-191047988 ACTTGTGGGGAAGGGTGGGAAGG - Intergenic
919738597 1:200969294-200969316 GGTGGTGGTGGTGGGTGGGTGGG - Intergenic
919801922 1:201359415-201359437 GGTGGGGGTGAAATGTGGGGCGG - Intronic
919813195 1:201421829-201421851 TGTGTGTGTGAAGGGTGGGAGGG - Intronic
919836920 1:201581242-201581264 GGTGGTGGAGATGGGTTGCAGGG + Intergenic
920041064 1:203097661-203097683 TGTGCTGGTGAAAGGTGGAAGGG + Intronic
920047109 1:203140434-203140456 GGGGATGGGGAAGGGTGGGGAGG + Intronic
920120275 1:203650832-203650854 GGTGGTGGTAGAGGGAGGAAGGG - Intronic
920160851 1:203996712-203996734 GGTGGGGCTGTAGGTTGGGAGGG + Intergenic
920313810 1:205064108-205064130 GGTGGTGGTGAGGGGCGGAGGGG + Intronic
920334649 1:205236792-205236814 CGAGGTGGTGAAGGATGGGTAGG + Intronic
920476034 1:206276485-206276507 GGAGTTGAGGAAGGGTGGGAAGG + Intronic
920499636 1:206478030-206478052 GATGGTGGGGCAGGGTGGGTTGG - Intronic
920727584 1:208450589-208450611 GTTGGTGGTGGAGAGAGGGAGGG + Intergenic
920963396 1:210683221-210683243 GGTGGTGGTGACGGCAGGGTTGG + Exonic
920966395 1:210704963-210704985 TGTGGGGTTGAAGGTTGGGAGGG + Intronic
920978536 1:210809170-210809192 GGAGGTGGGGGAGGGAGGGAGGG + Intronic
921201881 1:212814861-212814883 GGTGGGGATGAGGGCTGGGAGGG - Intronic
921267197 1:213431012-213431034 GGGGGTGGGGGAGTGTGGGAAGG + Intergenic
921278203 1:213540080-213540102 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
921335948 1:214086514-214086536 GGTTGTGGTGGAGGATGAGAAGG - Intergenic
921337019 1:214098386-214098408 TTTGAGGGTGAAGGGTGGGAGGG + Intergenic
922219929 1:223550746-223550768 GGTGGAGGTGAAGGCGGGGCTGG - Intronic
922399049 1:225232945-225232967 GGTGGTGGTCAGGGGAGGAAGGG - Intronic
922657958 1:227402255-227402277 GGTGGAGGTGGAGGGTGCCAGGG - Intergenic
922658485 1:227407415-227407437 ACTTGTGGGGAAGGGTGGGATGG + Intergenic
922673344 1:227532094-227532116 GGAGGTGGTGGAGGGTGCAATGG + Intergenic
922778180 1:228227131-228227153 GGCCGTGGTGCAGGGTGGGAGGG + Intronic
922806297 1:228391675-228391697 TGTGGTGGGCAAGGGTGAGATGG + Intergenic
923011370 1:230090519-230090541 TGTGGAGGTGAAGAATGGGAAGG + Intronic
923203382 1:231733860-231733882 GGTGGTGGTGACAGTTGTGATGG + Intronic
923228707 1:231963520-231963542 GGTGAGGGTGAGGGGTGGGCTGG - Intronic
923401126 1:233615726-233615748 GGTGGTGGAGGGGGGTGGGGAGG - Intronic
923504881 1:234596615-234596637 GGTGTTGGGCGAGGGTGGGAGGG + Intergenic
923514387 1:234682227-234682249 GTTTGTGGTGAAGGGTGAGATGG + Intergenic
923616790 1:235544908-235544930 GGTGGTGGTGGAGGGTGGGGTGG + Intergenic
923845687 1:237729063-237729085 GGTGGTGATGGAGGGAAGGATGG - Intronic
924205814 1:241710516-241710538 ACTGGTGGAGATGGGTGGGAGGG + Intronic
924277110 1:242400247-242400269 GGGGGTGGGGGTGGGTGGGAAGG - Intronic
924700213 1:246443959-246443981 TGTGGTGGTGATGGGTGGTGAGG - Intronic
1062912433 10:1220287-1220309 GGTGGTGGTGATGGTGGTGATGG + Intronic
1063113074 10:3053492-3053514 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113095 10:3053546-3053568 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113103 10:3053564-3053586 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113111 10:3053582-3053604 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113119 10:3053600-3053622 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113140 10:3053654-3053676 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113148 10:3053672-3053694 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113156 10:3053690-3053712 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063113190 10:3053780-3053802 GCTGGAGGGGAAGGGTGGGCTGG - Intergenic
1063534461 10:6869870-6869892 GGGGGTGGAGAATGGTGGGATGG + Intergenic
1063614511 10:7590256-7590278 GGTGGTGTTGAAGGATGTGAGGG - Intronic
1063674194 10:8125226-8125248 GGTGGTGGGGAAGGGAGAAAAGG + Intergenic
1064147121 10:12834353-12834375 GGTGGCGGGGAAGTCTGGGAAGG - Exonic
1064283527 10:13971953-13971975 GGTGGTGGTGAGGGTAGGTAGGG - Intronic
1064316133 10:14258991-14259013 GGGGATGGTGAGGGGTGTGAGGG + Intronic
1064731188 10:18332265-18332287 AGTGGTGGTGAGAGGTGGCAAGG + Intronic
1064950869 10:20848713-20848735 GGTGGTGGTGTTGGAGGGGATGG - Intronic
1065312188 10:24427201-24427223 GATGGGGGTGTGGGGTGGGAGGG - Intronic
1065327611 10:24563068-24563090 GGGGATGGAGAAGGGTGGGGAGG - Intergenic
1065383847 10:25115161-25115183 GGAGGTAGAGAAGGGAGGGAGGG - Intergenic
1065383878 10:25115242-25115264 GGAGGTAGAGAAGGGAGGGAGGG - Intergenic
1065383909 10:25115323-25115345 GGAGGTAGAGAAGGGAGGGAGGG - Intergenic
1065589698 10:27252041-27252063 AGTGGTGGGGTAGGGTGGGGTGG + Intergenic
1065846094 10:29744773-29744795 GCTGGTGAAGAAGGGTGGAAAGG + Intergenic
1065854340 10:29817275-29817297 GAGGCTGGTGAATGGTGGGAAGG + Intergenic
1066467565 10:35667178-35667200 GGTGGTGATGATGGTGGGGATGG - Intergenic
1066696931 10:38087429-38087451 GCTGGGGTGGAAGGGTGGGAGGG - Intergenic
1067233623 10:44428336-44428358 GGAGGAAGGGAAGGGTGGGAGGG + Intergenic
1067298617 10:44990477-44990499 TGGGGAGGCGAAGGGTGGGAAGG + Intronic
1067701561 10:48576899-48576921 GGTGGCGGTGTGGGGAGGGATGG - Intronic
1067719835 10:48719923-48719945 TGGGCTGGTGAAGGGTGGCATGG + Intronic
1068372255 10:56131950-56131972 GGTGGGGGTGAGGGGAGGGAGGG + Intergenic
1068893984 10:62179512-62179534 GGGGGAGGTGCAAGGTGGGAAGG - Intergenic
1069034167 10:63630357-63630379 GGTTGCGGTGCAGGGTGGGTGGG + Intergenic
1069034244 10:63630580-63630602 GGTGGTGGTGGAGGGAGGGGCGG + Intergenic
1069301339 10:66912212-66912234 GGTGGTGGTGTGGTGTGTGAGGG - Intronic
1069361760 10:67650971-67650993 GTGGGTGGTGAAGAGTGGGGAGG - Intronic
1069373031 10:67767142-67767164 GAAGGAGGAGAAGGGTGGGAAGG - Intergenic
1069560866 10:69428398-69428420 GTTGGTGGTGACGGGTAGGGAGG - Intergenic
1069873531 10:71547643-71547665 AGGGGTGGTGGTGGGTGGGAGGG + Intronic
1069892627 10:71661762-71661784 GGAGGGGGCGCAGGGTGGGAGGG - Intronic
1069892651 10:71661817-71661839 GGAGGGGGCGCAGGGTGGGAGGG - Intronic
1070049743 10:72876615-72876637 GGAGAAGGTTAAGGGTGGGATGG - Intronic
1070118928 10:73556878-73556900 GGTGCTGGTAGAGGGTGGGTGGG - Intronic
1070420666 10:76233436-76233458 GTTGTTGCTGAAGGTTGGGATGG + Intronic
1070550356 10:77486256-77486278 GGTGGTGGGGAAGGGGAGGGAGG - Intronic
1070565827 10:77603295-77603317 GGGGGTGGAGATGGGTGGGGGGG - Intronic
1070568202 10:77619904-77619926 GGAGGAGGTGGAGGGTTGGAAGG + Intronic
1070596249 10:77834984-77835006 GGTGGTGGTGATGTTTGGGGTGG - Intronic
1070638102 10:78145397-78145419 GGTGGTGGTGATGGGAAGGGGGG + Intergenic
1070708377 10:78657954-78657976 GGTGGGGGTGGGGGGTGGGGGGG + Intergenic
1070762736 10:79034864-79034886 GGTGGGGGTCCAGCGTGGGATGG - Intergenic
1070773503 10:79096567-79096589 CGTGGAGGTGAGGGGTGGGAAGG + Intronic
1070986439 10:80693672-80693694 GGTTGGGGTGGAGGCTGGGAAGG - Intergenic
1071367464 10:84913611-84913633 AGTGGTGGTGAAGGCTGGGATGG + Intergenic
1071488164 10:86116971-86116993 GATGGTGATGAAGGTTGTGATGG - Intronic
1071520409 10:86328763-86328785 GGTGGGGGTGGAGGGGGGAACGG - Intronic
1072380410 10:94863208-94863230 ATTTGTGGGGAAGGGTGGGAAGG - Intergenic
1072647150 10:97265829-97265851 TGTGTTTGTGAAGGGTGGGCAGG - Intronic
1072657048 10:97337040-97337062 GGTGGTTGTGAGGAGTGGGTGGG + Intergenic
1073051110 10:100668033-100668055 TGAGGAGGTGAAGGGTAGGAAGG - Intergenic
1073289380 10:102405823-102405845 CCTGGTGGAGAAGGGTGTGAGGG - Intronic
1073348473 10:102802012-102802034 GGGTGGGGGGAAGGGTGGGAAGG - Intronic
1073382878 10:103094110-103094132 ACTGGTGGTGGGGGGTGGGATGG - Intronic
1073440157 10:103547720-103547742 GGTGGAGGTGAAGGGAGGGATGG + Intronic
1073568746 10:104558055-104558077 GGTGCTGGTGAAGGATGGTGAGG + Intergenic
1074228800 10:111513425-111513447 GGTGGCAGGGAAGGGTGGGAAGG + Intergenic
1074381463 10:112984232-112984254 GGGGCTGGGGAAGGGTGGGAAGG - Intronic
1074485544 10:113874350-113874372 GGTGGTGGGGAGGAGTGGGAAGG - Intronic
1074516040 10:114170861-114170883 GGAGTTGGTGGAGGGTGGGGGGG - Intronic
1074606376 10:114972723-114972745 GGTGGTGAAGAAGGGAGTGAGGG - Intronic
1074704092 10:116116060-116116082 AGTGCTGGTGAAAGGTGTGATGG - Intronic
1074778694 10:116785196-116785218 GATGGTGGCGGTGGGTGGGAGGG - Intergenic
1074853351 10:117456020-117456042 GGGGGTGGGGAAGGGAGGGAAGG + Intergenic
1075069747 10:119313079-119313101 GGTGGTGGTGATGGTGGTGATGG + Intronic
1075069800 10:119313328-119313350 GGTGGTGGTGATGGGGAGGGTGG + Intronic
1075277839 10:121111060-121111082 GGAGGTAGGGAGGGGTGGGAAGG - Intergenic
1075310902 10:121412683-121412705 GGTGGGGGTGAGTGGAGGGACGG - Intergenic
1075548239 10:123372502-123372524 GGTGGTGGTGGAGAGTGCAAGGG + Intergenic
1075797142 10:125128633-125128655 GGTGGTGGAGTGGGATGGGAGGG - Intronic
1076566683 10:131404004-131404026 GGTGGTGGGGGAGGCTGGCATGG + Intergenic
1076714791 10:132358350-132358372 GGTGGTGGAGCAGCGTGGGGAGG + Intronic
1076714806 10:132358408-132358430 GGTGGTGGAGCAGCGTGGGGAGG + Intronic
1076714828 10:132358495-132358517 GGTGGTGGAGCAGCGTGGGGAGG + Intronic
1076714836 10:132358524-132358546 GGTGGTGGAGCAGTGTGGGGAGG + Intronic
1076714844 10:132358553-132358575 GGTGGTGGAGCAGTGTGGGGAGG + Intronic
1076714867 10:132358637-132358659 GGTGGTGGAGCAGTGTGGGGAGG + Intronic
1076714875 10:132358666-132358688 GGTGGTGGAGCAGTGTGGGGAGG + Intronic
1076714890 10:132358724-132358746 GGTGGTGGAGCAGCGTGGGGAGG + Intronic
1076714912 10:132358805-132358827 CGAGGTGGTGGAGCGTGGGAAGG + Intronic
1076714926 10:132358863-132358885 GGTGGTGGAGCAGTGTGGGGAGG + Intronic
1076714934 10:132358892-132358914 GGTGGTGGAGCAGTGTGGGGAGG + Intronic
1076714956 10:132358973-132358995 CGAGGTGGTGGAGCGTGGGAAGG + Intronic
1076714964 10:132359002-132359024 GGTGGTGGAGCAGCGTGGGGAGG + Intronic
1076714979 10:132359060-132359082 GGTGGTGGAGCAGCGTGGGGAGG + Intronic
1076714993 10:132359115-132359137 CGAGGTGGTGGAGCGTGGGAAGG + Intronic
1076715001 10:132359144-132359166 GGTGGTGGAGCAGCGTGGGGAGG + Intronic
1076733277 10:132448625-132448647 GGGGCTGGGCAAGGGTGGGAGGG - Exonic
1076733481 10:132449088-132449110 GGGGCTGGGCAAGGGTGGGAGGG - Exonic
1076869852 10:133187943-133187965 CATGGAGGGGAAGGGTGGGACGG - Intronic
1076875537 10:133213885-133213907 GCTGCTGGTGCAGGGTGGGCTGG - Intronic
1076888621 10:133273677-133273699 GGGGGTGGGGAAGGGAGGCAGGG - Intronic
1076948531 10:133666843-133666865 GGTGGTGGTGTGGGGTGGGGGGG - Intergenic
1076951489 10:133676751-133676773 GGTGGTGGTGTGGGGTGGGGGGG - Intergenic
1076952479 10:133680061-133680083 GGTGGTGGTGTGGGGTGGGGGGG - Intergenic
1076955435 10:133743022-133743044 GGTGGTGGTGTGGGGTGGGGGGG - Intergenic
1076956425 10:133746332-133746354 GGTGGTGGTGTGGGGTGGGGGGG - Intergenic
1076957413 10:133749641-133749663 GGTGGTGGTGTGGGGTGGGGGGG - Intergenic
1076959386 10:133756250-133756272 GGTGGTGGTGTGGGGTGGGGGGG - Intergenic
1077037413 11:502163-502185 GGTGGAGGTGAAGAGTGGCCTGG + Exonic
1077052132 11:571649-571671 GGTGGGGGGCAGGGGTGGGAAGG + Intergenic
1077075120 11:697004-697026 GGTGGTGGTGGTGGGGGGGGTGG + Intronic
1077156785 11:1095657-1095679 GGTGGTGGTGATGGGTGTCGGGG - Intergenic
1077156840 11:1095864-1095886 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077156879 11:1096002-1096024 GGTGGTGGTGATGGGTGTTGGGG - Intergenic
1077156917 11:1096140-1096162 GGTGGTGGTGATGGGTGTCAGGG - Intergenic
1077156938 11:1096209-1096231 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077156976 11:1096347-1096369 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077156996 11:1096416-1096438 GGTGGTGGTGATGGGTGTCGGGG - Intergenic
1077157034 11:1096554-1096576 GGTGGTGGTGATGGGTGTCAGGG - Intergenic
1077157104 11:1096800-1096822 GGTGGTGGTGATGGGTGTCATGG - Intergenic
1077157162 11:1097007-1097029 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157180 11:1097076-1097098 GGTGGTGGTGATGGGTGTCAGGG - Intergenic
1077157222 11:1097214-1097236 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157281 11:1097421-1097443 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157384 11:1097766-1097788 GGTGGTGGTGATGGGTGTCATGG - Intergenic
1077157443 11:1097973-1097995 GGTGGTGGTGATGGGTGTCGGGG - Intergenic
1077157485 11:1098111-1098133 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157503 11:1098180-1098202 GGTGGTGGTGATGGGTGTCAGGG - Intergenic
1077157568 11:1098397-1098419 GGTGGTGGTGATGGGTGTCATGG - Intergenic
1077157608 11:1098535-1098557 GGTGGTGGTGATGGGTGTCATGG - Intergenic
1077157650 11:1098673-1098695 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157668 11:1098742-1098764 GGTGGTGGTGATGGGTGTCAGGG - Intergenic
1077157710 11:1098880-1098902 GGTGGTGGTGATGGGTGTCATGG - Intergenic
1077157769 11:1099087-1099109 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157811 11:1099225-1099247 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157891 11:1099501-1099523 GGTGGTGGTGATGGGTGTCGTGG - Intergenic
1077157926 11:1099639-1099661 TGTGGTGGTGATGGGTGTCACGG - Intergenic
1077213328 11:1383380-1383402 GGTGGCGGGGAGGGGAGGGAGGG + Intergenic
1077264489 11:1642162-1642184 GGAGGTGGTCTGGGGTGGGATGG - Intergenic
1077264540 11:1642300-1642322 GGAGGTGGTCTGGGGTGGGATGG - Intergenic
1077349925 11:2088088-2088110 GGTGGGGGTTCAGTGTGGGAAGG + Intergenic
1077357257 11:2124103-2124125 GGTGGTGGTGATGGGTAGTGTGG + Intergenic
1077382029 11:2248539-2248561 GGTGGTGGTGATGGTGGCGATGG + Intergenic
1077404743 11:2377894-2377916 TGTGGTGGTGATGGGTGCGGTGG + Intronic
1077484840 11:2833924-2833946 GGTGGGGGAGCAGGCTGGGAGGG - Intronic
1077551051 11:3200510-3200532 GGAGGTGGTGAAGAGTCGGGCGG - Intergenic
1077785514 11:5379314-5379336 GGTGGGGGTGCAGGGAGGGATGG + Intronic
1077820097 11:5729026-5729048 GGTGGGGGTGAGGGGAGGGATGG - Intronic
1078345756 11:10546406-10546428 TGTTGTGGAGATGGGTGGGAGGG + Intergenic
1078384331 11:10874604-10874626 GGGGTGGGGGAAGGGTGGGAGGG - Intergenic
1078570359 11:12452644-12452666 GGTAGGGGTGAAGGCTGGGCTGG - Intronic
1078599547 11:12718027-12718049 GGTGGTGGTGAAGGTAGAGGAGG + Intronic
1078898893 11:15622972-15622994 AGTGGAGGTGAGGGGTGGGCTGG - Intergenic
1079026112 11:16949206-16949228 TGTAGTGGTGAATGGTGGGGAGG - Intronic
1079097593 11:17520794-17520816 GGTGGTGGTGAGGGGAGGGAGGG + Intronic
1079115806 11:17639898-17639920 GGTGGTGGTGATGGTGAGGATGG + Intronic
1079990562 11:27242169-27242191 GGTGGGGGTTTGGGGTGGGAAGG - Intergenic
1079998382 11:27320408-27320430 GGTGGTGGTAGAGGGTGGGTGGG + Intergenic
1080121609 11:28684443-28684465 GGGGATGGTGGAGGGTGGGAGGG + Intergenic
1080244485 11:30164059-30164081 GGTGGGGGTGAAGGGCAGGATGG + Intergenic
1080478375 11:32619877-32619899 GGGGGAGGGGAAGGGAGGGAGGG + Intronic
1081152150 11:39646184-39646206 ACTGGTGATGAGGGGTGGGAAGG - Intergenic
1081280803 11:41207570-41207592 AGTGGAGGAGATGGGTGGGAGGG - Intronic
1081487554 11:43543596-43543618 AGTGGTGGTGAAGAGAGGAAAGG - Intergenic
1081614671 11:44583551-44583573 AGAGGTGTGGAAGGGTGGGACGG + Intronic
1081651170 11:44825086-44825108 GGTGGTGGGGGGTGGTGGGAGGG - Intronic
1081692025 11:45085249-45085271 GGTGGTGGTGAGGGGCGTGGGGG - Intergenic
1081696261 11:45111213-45111235 GGTGGAGGGACAGGGTGGGATGG - Intronic
1081794982 11:45812765-45812787 GGGTGTGGTGAAGGGTGGTATGG - Exonic
1081842281 11:46211405-46211427 GGTGGGGGTGCAGGGTGTGGTGG - Intergenic
1082824681 11:57568688-57568710 GGGGGTAGGGAAGGGTGAGAAGG - Intergenic
1082863980 11:57881710-57881732 GGGGGTGGTGTAGGGAGGTAGGG + Intergenic
1083207404 11:61161117-61161139 GGTGGCGGTGAGTGGTGGGGCGG + Intronic
1083231902 11:61327009-61327031 AGTGATGGATAAGGGTGGGAGGG - Intronic
1083311022 11:61783792-61783814 GGTGGGGGTGGGGGGTGGCAGGG + Intronic
1083586519 11:63863757-63863779 GGTGGTGGTGTGGGGCGGGGGGG - Intronic
1083720071 11:64599628-64599650 GGTGGGGGTGGGGGGTGGGGGGG - Intronic
1083803677 11:65060972-65060994 GGAGGTGAAGGAGGGTGGGACGG - Intergenic
1084038761 11:66529769-66529791 GGTGGAGGTGGGGGGTGGCAGGG - Intronic
1084120437 11:67065994-67066016 AGGGGTGGGGCAGGGTGGGAGGG + Intronic
1084194905 11:67518986-67519008 GGTGGGGGTGAAGGCAGGCAAGG + Exonic
1084358753 11:68656209-68656231 GGTGGTGGTGGTAGGTGGGGGGG + Intergenic
1084364720 11:68690152-68690174 GGAGGTGGTGGAGGGGAGGAGGG + Intronic
1084466079 11:69323819-69323841 GGTGGTGGAGATGGGGGTGATGG + Intronic
1084466166 11:69324246-69324268 GGTGGTGGAGATGGGGGTGATGG + Intronic
1084559706 11:69896252-69896274 TGGGGTGGGGAGGGGTGGGAGGG - Intergenic
1084569473 11:69950782-69950804 TATTGTGGTGAAGGGTGGGAAGG - Intergenic
1084610892 11:70202396-70202418 GGCGCAGGTGAAGGCTGGGAGGG - Intergenic
1084730201 11:71068058-71068080 GGTGATGGTGATGGTTGTGATGG - Intronic
1084988500 11:72900226-72900248 GGTGTGGGTCAAGGGCGGGAGGG - Intronic
1085026912 11:73241709-73241731 GGTGTTGGGGCAGGGTGGGGAGG + Intergenic
1085096102 11:73761492-73761514 GGAGGGGGAGAAGGGTGGGGCGG + Intergenic
1085122736 11:73977666-73977688 GGTGGTGTTGAAGACTGTGATGG + Intronic
1085127471 11:74011388-74011410 GGTGCTGGGGAGGGGTGGGCTGG + Intergenic
1085165603 11:74397350-74397372 GGTGGGGGCGGAGGGTGGGTGGG + Intronic
1085241310 11:75058628-75058650 GGTGGTGGTGAATGAGGTGATGG + Intergenic
1087096858 11:94327398-94327420 TGTGGTGGTGGGGGGTGGGACGG + Intergenic
1087642898 11:100774611-100774633 GGTGGTGGGAATGGGTAGGAAGG + Intronic
1087707743 11:101514126-101514148 GGTGGTGGTGGTGGGTGTGAGGG - Intronic
1088275936 11:108085414-108085436 GGGGATGGGGAAGGGGGGGATGG + Intronic
1088863286 11:113821891-113821913 GTGGGTGGTGGAGGGTGTGAGGG + Intronic
1089045422 11:115498157-115498179 GATGGTGGTGAAGGATGGTGGGG - Intronic
1089184448 11:116605443-116605465 GGGGGGGGGGAAGGGTGGGGGGG - Intergenic
1089192428 11:116662606-116662628 GGAGGTGGTGAAGGCTGGGGAGG + Intergenic
1089579569 11:119473018-119473040 GCTGGTGGTGTCGGGAGGGAAGG + Intergenic
1089607189 11:119648297-119648319 GGTGGTGGTGATGGTGGTGATGG + Intronic
1089607208 11:119648384-119648406 GGTGGTGGTGATGGTGGTGATGG + Intronic
1089607214 11:119648411-119648433 GGTGGTGGTGATGGTGGTGATGG + Intronic
1089700360 11:120240588-120240610 GGGGCTGGTGAAGGGCGGGAGGG + Intronic
1089826237 11:121280824-121280846 GGAGGTGGTGGAGAGTGCGATGG + Intergenic
1089846310 11:121461249-121461271 GGTGGTGGTGATGGGTGGGCTGG + Intronic
1089858163 11:121565544-121565566 TATGGTGCTGAAGTGTGGGAGGG + Intronic
1090270099 11:125379997-125380019 GTAGGGGGTGGAGGGTGGGATGG + Intronic
1091054715 11:132407230-132407252 GGAGGTGGCCAAGGCTGGGAGGG - Intergenic
1091242407 11:134062651-134062673 GCGGGAGGTGAGGGGTGGGAAGG + Intergenic
1091270485 11:134308241-134308263 GGTGGTGGTGATGGTGGTGATGG - Intronic
1091397304 12:161878-161900 GGTGGTGGGGTTGGGAGGGAGGG - Intronic
1091399528 12:173770-173792 GGTGGAGGAGATGGGTGGAAGGG - Intronic
1091668789 12:2437946-2437968 GGTGGTGGTGATGGTTGGGATGG + Intronic
1091668844 12:2438211-2438233 GGTGGTGGTGGTGGTTGTGATGG + Intronic
1091668848 12:2438220-2438242 GGTGGTTGTGATGGTGGGGATGG + Intronic
1091668867 12:2438310-2438332 GGTTGTGGTGATGGTGGGGATGG + Intronic
1091797739 12:3306899-3306921 GGTGGTAGGCAAGGGTGGGGTGG - Intergenic
1092077437 12:5685354-5685376 CATGGTGGGGAAGGATGGGAGGG + Intronic
1092968491 12:13669001-13669023 GGAGGTGGGGAGGGGAGGGAGGG + Intronic
1093172624 12:15876290-15876312 GGAGGTGGTGGAGGGTGCAATGG - Intronic
1094339225 12:29392111-29392133 GGTGGTGGAGAGGAGTTGGAAGG + Intergenic
1094347019 12:29481910-29481932 AGAGGTGGTGAAGAGTGGTAGGG - Intronic
1094408148 12:30140912-30140934 GGTGGTGGTGATGGGTACCAAGG - Intergenic
1095354986 12:41261944-41261966 GGTGGTGGGCAAGAATGGGAAGG + Intronic
1095742862 12:45625835-45625857 TGGGGTAGTGAGGGGTGGGAAGG + Intergenic
1095949761 12:47775488-47775510 GGTGGTGGTGGATGGTGGCAGGG + Intronic
1095953024 12:47791746-47791768 GGTGGTGGTGATGGGAGGGAAGG - Intronic
1095967945 12:47882174-47882196 GCTGGGGGTGAAGGCTGGAAAGG + Intronic
1096026970 12:48374759-48374781 GTTGGTTGTGAAGGTGGGGAAGG + Intergenic
1096256291 12:50064062-50064084 GGTGGTCTTCATGGGTGGGAAGG + Intronic
1096406925 12:51350760-51350782 GGTGGTGGAGAAGAGGGAGAAGG - Intergenic
1096426208 12:51505610-51505632 GGTGGTGCTGAAAGCTGGGCTGG - Intronic
1096464652 12:51841597-51841619 GTTGGTGGCTAAGTGTGGGAGGG - Intergenic
1096470602 12:51873280-51873302 GTTGGTGGTGATGGGTGGAAGGG + Intergenic
1096490101 12:52008403-52008425 GGTGGTGGTGGGGGGTGTGGAGG - Intronic
1096622411 12:52872934-52872956 GGTGGTTGTGGTTGGTGGGAGGG - Intergenic
1096755886 12:53799159-53799181 GGTGGTGGTTAAGGTTGAGGAGG + Intergenic
1096772167 12:53942413-53942435 GCGGGTGGTCAAGGGTGGGTGGG + Intronic
1096838886 12:54369359-54369381 AGTGGAGGTGACTGGTGGGAGGG + Exonic
1096871554 12:54595714-54595736 TGTGTTGGTGAGGGGTGGGGTGG + Intergenic
1097053893 12:56238923-56238945 AGAGGTGGAGAAGGGAGGGAAGG + Exonic
1097182979 12:57181342-57181364 GGTGGGGCTGTAGGGTAGGAGGG - Intronic
1097190167 12:57216034-57216056 GCTGGTGGTGAAAGATGGGACGG + Intergenic
1097227743 12:57488470-57488492 GGTGTAGGAGAAGGTTGGGAAGG - Intronic
1097282412 12:57852993-57853015 GGCGGCGGGGAAGGGAGGGAGGG - Intergenic
1097323101 12:58246849-58246871 GGTGGTGGTGGGGGGTGGGAGGG + Intergenic
1097348819 12:58525071-58525093 GGTGGTGGTAAAAGTGGGGATGG + Intergenic
1097363803 12:58688409-58688431 GGTGGTGGGGAGGGGAGAGAGGG + Intronic
1097836134 12:64274248-64274270 GGTGGTGGTGGGGAGAGGGATGG + Intronic
1098356743 12:69619475-69619497 AGTGGGAGGGAAGGGTGGGAAGG + Intergenic
1098360833 12:69653128-69653150 GGAGTTGGTGAAGGGAAGGAGGG + Intronic
1098416837 12:70243688-70243710 GGCGGCGGTGGAGGGAGGGAGGG + Intronic
1098574029 12:72020456-72020478 GGTTGTGATGGAGGGTAGGAAGG + Intronic
1099203947 12:79707024-79707046 GGAGGTGGAGACTGGTGGGAGGG - Intergenic
1099373235 12:81864494-81864516 AGAGGTGGGGAAGGGTGTGAGGG - Intergenic
1099562032 12:84191088-84191110 GAGGATGGTGAAGGGTTGGAAGG - Intergenic
1100221208 12:92506215-92506237 GGTAGGGGTGAGGGATGGGAGGG + Intergenic
1100774707 12:97961439-97961461 GGTGGGGGTGAGGGGAGGGATGG - Intergenic
1100874419 12:98947102-98947124 GGTGGGAGTGAAGTGAGGGAGGG + Intronic
1101312282 12:103592850-103592872 GGTGGTTGTTAAGGGTTGGAAGG - Intronic
1101348153 12:103905238-103905260 GATGGAGGAGAAGGGGGGGAGGG + Intergenic
1101797975 12:107993843-107993865 GGTGGTGGGGAAGGGTGGAGGGG - Intergenic
1101863677 12:108503515-108503537 GGTGGTGGTGAGGGGCTGGAGGG + Intergenic
1101872512 12:108577625-108577647 GGTGGTGGTGATGGTGAGGATGG - Intergenic
1101872520 12:108577667-108577689 GGTGGTGGTGATGGTGAGGATGG - Intergenic
1102013692 12:109634455-109634477 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1102013718 12:109634578-109634600 GGTGGTGGTGACGGTTGTGGTGG - Intergenic
1102013749 12:109634734-109634756 GGTGGTGGTGACGGTTGTGGTGG - Intergenic
1102013827 12:109635109-109635131 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1102013867 12:109635301-109635323 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1102013898 12:109635433-109635455 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1102394476 12:112574908-112574930 GGTGGTGGAGGAGGGAGAGAGGG + Intronic
1102543896 12:113641200-113641222 GGTGGAGGTGGAGGAAGGGATGG - Intergenic
1102625010 12:114227905-114227927 GGTGAGGGTGAAGGATGGGGAGG + Intergenic
1102816564 12:115870587-115870609 GGTGGTGGTGGGGGGAGGGGTGG + Intergenic
1102880458 12:116481192-116481214 CGTGGGGGCGGAGGGTGGGATGG - Intergenic
1102907626 12:116688858-116688880 GGTGGTGGGGTGGGGTGGGTGGG + Intergenic
1102916698 12:116759758-116759780 GGAGGTGGTGGAGGGTGCAATGG + Intronic
1103136740 12:118513970-118513992 GCTGGTGGTGAGGGGTGTGGAGG + Intergenic
1103519753 12:121530524-121530546 AGGGGTGGGGTAGGGTGGGAGGG - Intronic
1103871189 12:124093411-124093433 GGTGGTGGTGATGAATGTGATGG + Intronic
1103910401 12:124349114-124349136 GGCAGTGGTGAGGGGTGGCAGGG + Intronic
1104050579 12:125191041-125191063 GGTGGTGGTGGTGGTGGGGAAGG + Intronic
1104183098 12:126401269-126401291 GGTGGTGGTGAGGGTAGTGATGG + Intergenic
1104286068 12:127426120-127426142 GCTGGGGTTGAAGGGTGGGTGGG + Intergenic
1104421420 12:128638886-128638908 GGTGGTGGTGATGGTGGTGATGG + Intronic
1104591057 12:130084942-130084964 GCTGGTGGGGTAGGGTGAGAGGG + Intergenic
1104605584 12:130185207-130185229 GGTGGGGGTGTGGGGTTGGAGGG + Intergenic
1104756361 12:131272021-131272043 GGTGATGGTGATGGTTGTGATGG - Intergenic
1104805872 12:131588683-131588705 GGGGGTGGGGTAGGGTGGGGTGG + Intergenic
1104892868 12:132148744-132148766 GGTGGGGGTGAGGGGCGGGTGGG - Intronic
1105067620 12:133214621-133214643 GGTGGTTGTCAAGGGTCGGAGGG + Intergenic
1105452260 13:20510481-20510503 GGTTGGGGGGAAGGGAGGGATGG + Intronic
1105475543 13:20725419-20725441 GGTGGTGGCTAAGCTTGGGAAGG + Intergenic
1105583872 13:21725981-21726003 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1105676658 13:22679387-22679409 GGTGGTGGTGAAGGTGGTGGTGG - Intergenic
1106002643 13:25738552-25738574 ATTTGTGGTGAAGGGTGGGAAGG + Intronic
1106187720 13:27423978-27424000 CGGGGTGGGGAAGGGTAGGATGG + Intergenic
1106281062 13:28271839-28271861 GGAGGTGGTGTGGGGTAGGATGG + Intronic
1106719533 13:32424394-32424416 GTTGGTGGTGAAGGCTGGGGAGG - Intronic
1106799093 13:33237654-33237676 GATGGTGGTGAGGGGGGAGATGG - Intronic
1106956467 13:34943180-34943202 CCTGGGGGTGAAGGGTGGGAGGG - Intronic
1107443410 13:40448457-40448479 GGTGGTCAGGAAGGGTGTGAAGG - Intergenic
1107445082 13:40463347-40463369 ACTTGTGGGGAAGGGTGGGAGGG - Intergenic
1107817107 13:44254139-44254161 GGTGGAGGTCATTGGTGGGAGGG + Intergenic
1107831488 13:44377398-44377420 GGTGGTGGAAGAGGGTGGGAAGG + Intronic
1108158259 13:47610917-47610939 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1108336074 13:49443744-49443766 GGTGGTGGTGATGGTTGTGGTGG - Intronic
1109225189 13:59685136-59685158 TGTAGGGGTGAAGGGTGGGAAGG + Intronic
1110238365 13:73240144-73240166 GATGGAGGTGTAGGGTGAGAGGG + Intergenic
1110316474 13:74114185-74114207 GGTGGTTCTGAAGGTTGGGGTGG - Intronic
1110383910 13:74886065-74886087 TGTGGTGGTGGTGGGTGGGTGGG + Intergenic
1110442800 13:75544104-75544126 TGTGGTGGTGGTGGGTGGGGGGG + Intronic
1110685703 13:78371465-78371487 GGAGGTTGAGAAGGGTGTGAGGG - Intergenic
1110847249 13:80203939-80203961 GGTGGCGGTGGAGGGTGGGGGGG + Intergenic
1110847862 13:80209933-80209955 GGTGGTGGGGAGTGGTGGGGAGG - Intergenic
1110865964 13:80396684-80396706 GGTGATGTTGAAGGTTGGGGTGG + Intergenic
1110995711 13:82106437-82106459 GGTGGTGCTGAAGGTAAGGATGG + Intergenic
1111256329 13:85673983-85674005 GCTGGTGGAGAAGGGAGAGAGGG + Intergenic
1111464030 13:88584556-88584578 GGTGGAGGACAAGGGAGGGATGG + Intergenic
1111978970 13:94997041-94997063 GGTGGAGGTGAAGGTGGAGAGGG + Intergenic
1112265761 13:97921820-97921842 CGTGGGGATGAAGAGTGGGAAGG - Intergenic
1112308604 13:98297768-98297790 GGTGGGGGTGAAGCGGTGGAGGG - Intronic
1112377875 13:98860671-98860693 GGTGAGGGTGGAGGGTGGGATGG + Intronic
1112391322 13:98987051-98987073 GGTGGTGGTGAAGATGGTGATGG - Intronic
1112597168 13:100817915-100817937 GGTGGTGGTAAATTGTGGGAAGG + Intergenic
1112781238 13:102903265-102903287 GGTGGTGGTGGGGGGTGGCTCGG + Intergenic
1112900707 13:104353887-104353909 AGTGGTGGGGAAGGGAGTGAGGG + Intergenic
1113026077 13:105942830-105942852 GGAGGTGGGGACTGGTGGGAGGG + Intergenic
1113059817 13:106310403-106310425 GGTGGTGGTTCAGGGTAGTATGG + Intergenic
1113064371 13:106358691-106358713 GGTGGTTTTGGAGGATGGGAGGG - Intergenic
1113487223 13:110663105-110663127 GGTGGTGGGTGAGGGCGGGAAGG + Intronic
1113699124 13:112370794-112370816 GGTGGTGGGGTGGGGTGGGGCGG - Intergenic
1113699771 13:112375816-112375838 GAGGGTGGGGGAGGGTGGGAGGG + Intergenic
1113772692 13:112920703-112920725 GGTGCTGGTGGTGGGTGGGCGGG + Intronic
1113916063 13:113874841-113874863 GTTGATGGTGATGGGCGGGAGGG + Intergenic
1113966352 13:114155682-114155704 TGTGGGGGTGGAGGGTGGGGAGG + Intergenic
1114601832 14:23962212-23962234 GGTGTTGCTGAAGGCTGGGGTGG + Intronic
1114606007 14:23997334-23997356 GGTGTTGCTGAAGGCTGGGGTGG + Intronic
1114611602 14:24045290-24045312 GGTGTTGCTGAAGGCTGGGGTGG + Intergenic
1114820002 14:26007230-26007252 GTTGGGGGGGAAGGGGGGGAAGG + Intergenic
1115011689 14:28555773-28555795 GGGGGAGGTGGAAGGTGGGATGG + Intergenic
1115399583 14:32941220-32941242 GGAGGAGGGGAAGGGAGGGAGGG - Intronic
1115517961 14:34205162-34205184 GGTAGTGGAGGTGGGTGGGAAGG - Intronic
1115787528 14:36842906-36842928 GGATGGGGTGGAGGGTGGGAAGG + Intronic
1115819194 14:37195964-37195986 GGTGGTGGTGGAGGGGAGTAGGG + Intergenic
1115844419 14:37510887-37510909 GGTGGCAGTGAGGGGAGGGAGGG - Intronic
1116890142 14:50259939-50259961 GGGGGTGGGGAGGGGAGGGAGGG + Intronic
1116958444 14:50946259-50946281 GGTGGTGGTGGGGGGGGGGGGGG + Intergenic
1117000498 14:51366282-51366304 GGTGGTGGTGATGAGGGGCAGGG + Intergenic
1117203000 14:53411619-53411641 TGTTGTGGGGGAGGGTGGGAAGG - Intergenic
1117211849 14:53509042-53509064 GGTGGTGGTGGAGGTAGGGGTGG + Intergenic
1117292247 14:54344986-54345008 GGTGGGGGTTAAGGGGGGTAGGG - Intergenic
1117377753 14:55130742-55130764 GGTGGTGGTGGTGGGGGGGGGGG + Intronic
1117378421 14:55136798-55136820 GGTAGTGAGGGAGGGTGGGAGGG - Intronic
1117881415 14:60316668-60316690 GCTGGTGGGGAGGGGTGGCAGGG + Intergenic
1118315800 14:64725375-64725397 GATGGTGGTGGTGGGTGGGTGGG + Intronic
1118331072 14:64816427-64816449 GGTGGTGGTGATAGGAGGGCAGG - Intronic
1118362630 14:65069225-65069247 GCTGTTGGTGAAGGGAGGGTGGG - Intronic
1118943057 14:70356205-70356227 GGCGGGGGTGGGGGGTGGGATGG + Intronic
1119025206 14:71147078-71147100 GGTGGTGGTGGTGGGAGGGGTGG + Intergenic
1119124518 14:72113184-72113206 GGTGGTGGTGATGGTAGGAATGG + Intronic
1119218939 14:72891448-72891470 GGTGGTGGTGCAGGGAGGAGGGG - Intronic
1119421048 14:74508260-74508282 GGTGGGGGTGAGGGGTGAGGTGG + Intronic
1119536042 14:75403136-75403158 AGTGGTTGTAAAGGGAGGGAGGG + Intergenic
1119613226 14:76081388-76081410 GGTGGGGGAGAAGGGAGGGATGG - Intronic
1119621856 14:76137411-76137433 GGTGGTGGAGTGGGCTGGGAGGG - Intergenic
1119645382 14:76344420-76344442 GCTTGTGGGGAAGAGTGGGAGGG - Intronic
1119673835 14:76539173-76539195 GGGGGAGGGGAAGGGAGGGAAGG - Intergenic
1119748834 14:77063549-77063571 GGTGGTGGTGGAGATTGGGGAGG - Intergenic
1119773618 14:77235973-77235995 GGAGATGGTGATGGGTGGGGGGG + Intronic
1119995813 14:79252575-79252597 GGTGGTGGTGGGAGGTGGGTAGG + Intronic
1119996306 14:79257405-79257427 GGTGGTGGTGATGGTGGTGATGG + Intronic
1119996321 14:79257462-79257484 GGTGGTGGTGATGGTGGTGATGG + Intronic
1120049016 14:79843434-79843456 GTGGGTGCTGAAGGTTGGGATGG + Intronic
1120426468 14:84353896-84353918 GAGGGTGGAGAAGGGTGGGAGGG + Intergenic
1120577251 14:86198608-86198630 GGGGGTGGGGAACGGGGGGACGG - Intergenic
1120701693 14:87705469-87705491 GGAGGGGGAGAAGAGTGGGAGGG + Intergenic
1120911288 14:89669271-89669293 GGAGGTGGTGCAGGAAGGGAAGG + Intergenic
1121010757 14:90518788-90518810 AGGGCTGGTGAAGGGTAGGACGG + Intergenic
1121081942 14:91115330-91115352 GAAGGAGGTGATGGGTGGGAAGG + Intronic
1121127054 14:91414860-91414882 CGGGGTGGTGTGGGGTGGGAGGG - Intronic
1121324657 14:93012947-93012969 GGTGTGGGTGCAGGGTGGGAAGG - Intronic
1121401424 14:93681302-93681324 GCTGGTGTTCAAGTGTGGGAGGG - Intronic
1121512048 14:94519747-94519769 GGTGGTGGTGATGGTAGTGATGG + Intergenic
1121512064 14:94519825-94519847 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1121586516 14:95066664-95066686 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1121760306 14:96439316-96439338 GGAGGTTGAGAAGGGTGGGCAGG + Intronic
1121887918 14:97561720-97561742 GCTGGGAGTGGAGGGTGGGAAGG - Intergenic
1122176939 14:99927920-99927942 GGTGGTGGTGATGGTGGTGATGG + Intronic
1122270704 14:100567489-100567511 GGTGGTGGTTGGGGGTGGGGTGG + Intronic
1122316439 14:100828332-100828354 GGTGGAGGAGAGGAGTGGGAGGG - Intergenic
1122342608 14:101038229-101038251 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1122770844 14:104097044-104097066 GGTGGGGGTGAGGGGTGGGTGGG - Intronic
1122905294 14:104798887-104798909 GGTCGTGCTCAAGGTTGGGAGGG + Intergenic
1122983928 14:105203611-105203633 GGGGGAGGTGAAGGGAGGGGTGG + Intergenic
1202901229 14_GL000194v1_random:41190-41212 GGTGGTGGTGGTTGGTGGGAAGG + Intergenic
1202852349 14_GL000225v1_random:29797-29819 GGTGGTGGTGTGGGGTGGGAGGG - Intergenic
1202860906 14_GL000225v1_random:80309-80331 TGTGGTGGAGTGGGGTGGGAGGG + Intergenic
1202923172 14_KI270724v1_random:3183-3205 GGTGGTGGGGTGGTGTGGGAGGG + Intergenic
1123901350 15:24880297-24880319 GGTGGTGGTGGAGGGATGGGAGG + Intronic
1123911516 15:24972874-24972896 GGTGGTGGGGAAGAGAGAGAAGG - Intronic
1123991500 15:25687026-25687048 GGAGGTGGGAGAGGGTGGGAAGG + Intronic
1124127114 15:26945987-26946009 GATGGTGGGGAAGGCGGGGACGG + Intronic
1124426788 15:29570044-29570066 GGTGGGGGTGGGGGGTGGGGTGG - Intronic
1124467143 15:29949599-29949621 GGTGGTGGTGAAGGTGGAGGTGG - Intronic
1124467165 15:29949671-29949693 GGTGGTGGTGAAGGTGGAGGTGG - Intronic
1124467230 15:29949911-29949933 GGTGGTGGTGAAGGTGGAGGTGG - Intronic
1124467260 15:29950019-29950041 GGTGGTGGTGAAGGTGGAGGTGG - Intronic
1124710783 15:32008339-32008361 GGAGGAGGAGAAGGGAGGGAGGG - Intergenic
1124876912 15:33603283-33603305 GGAGGTGGAGAAGGATGGGGAGG + Exonic
1124971968 15:34496555-34496577 GGTGGTGGTGGCGGGGGGGTAGG + Intergenic
1125138246 15:36369431-36369453 TGTTGTTGTGCAGGGTGGGAAGG - Intergenic
1125579255 15:40774089-40774111 GGTGCAGGTGGAGGGTGTGAAGG + Intronic
1125605102 15:40935640-40935662 GGAGCTGGAGAGGGGTGGGAAGG + Intronic
1125783299 15:42291030-42291052 GGAGGCAGTGAAGGGTGGTAGGG - Intronic
1125832237 15:42725200-42725222 GCTGGTGGAGAAGGGTCTGATGG - Exonic
1125968232 15:43891352-43891374 GGGAGTGGAGAAGGGAGGGAAGG + Intronic
1126144203 15:45461833-45461855 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1126155007 15:45557782-45557804 GGTGCTGGTGAAGGGTTGTTGGG - Intergenic
1126949984 15:53870418-53870440 TGTGGGGGTGGGGGGTGGGAAGG - Intergenic
1127123375 15:55789940-55789962 GCAGGTGGTGGAGGGTGGGGGGG - Intergenic
1127234664 15:57036040-57036062 GCTGGGGGTGGGGGGTGGGATGG - Intronic
1127556281 15:60090508-60090530 GGTGGTTGTAAGGGGTGGGCTGG + Intergenic
1127609635 15:60624028-60624050 GGGGGTGGGAAAGGGTGGGGAGG + Intronic
1127672266 15:61206577-61206599 GGTCGGGGTGAAGGGCGGGATGG - Intronic
1127723521 15:61725736-61725758 GGGGGTGGGGATGGGTGGGAGGG + Intergenic
1128301138 15:66567094-66567116 TGTGGAAGTGCAGGGTGGGAGGG - Intergenic
1128331195 15:66756821-66756843 GGTGAGGGTGGAGGATGGGAGGG + Intronic
1128333783 15:66773211-66773233 GGGGGTGGGGAGGGGTGGGTGGG + Intronic
1128552822 15:68609218-68609240 GGTGGTGGTGGTTGGGGGGATGG + Intronic
1129336238 15:74853806-74853828 AGTGGTGGTGGTGGGTGGGATGG + Intronic
1129506975 15:76089524-76089546 CGTGGGGTTGAAGGGTGAGAGGG + Intronic
1129692677 15:77722737-77722759 GGTGGTGGTGGAGAGTGCGTGGG + Intronic
1130271773 15:82455002-82455024 GGTGGAAGTGAAGGGAGAGATGG + Intergenic
1130297435 15:82657057-82657079 GCTGCTGGTGAAGGCTGGGCTGG - Intergenic
1130464122 15:84182391-84182413 GGTGGAAGTGAAGGGAGAGATGG + Intergenic
1130474923 15:84256321-84256343 GGTGGAAGTGAAGGGAGAGATGG + Intergenic
1130482339 15:84370374-84370396 GGTGGAAGTGAAGGGAGAGATGG + Intergenic
1130488563 15:84412444-84412466 GGTGGAAGTGAAGGGAGAGATGG - Intergenic
1130500144 15:84491150-84491172 GGTGGAAGTGAAGGGAGAGATGG - Intergenic
1130586418 15:85187023-85187045 GGTGGAAGTGAAGGGAGAGATGG + Intergenic
1130748913 15:86688263-86688285 GGAGGAGGAGAAGGGTGGGGAGG + Intronic
1130821620 15:87502138-87502160 GGAGGAGGTGGAGGGTGAGAGGG - Intergenic
1131035917 15:89221925-89221947 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
1131053431 15:89362422-89362444 GGTCGGGGTGAAGGGGGGGGCGG + Intergenic
1131123414 15:89837683-89837705 GGAGGTGGTGATGGGTGGGATGG - Exonic
1131264208 15:90906141-90906163 AGTGATGGTGGAGGGAGGGAAGG + Intronic
1131356594 15:91750832-91750854 GGTGGTGGTGGTGGTAGGGATGG + Intergenic
1131675592 15:94667317-94667339 GGTGGTGGTGGAGGTGGAGATGG - Intergenic
1131696513 15:94882595-94882617 GGCGCTGGTGGAGGGTAGGAGGG + Intergenic
1131887813 15:96937442-96937464 GGTGGTGGTGAAGGGGATGAGGG - Intergenic
1131908336 15:97168845-97168867 GGTGCTGGTGAAGGGATAGAGGG - Intergenic
1132291928 15:100710014-100710036 GGTGGTGGTGAAGACTGTGGAGG + Intergenic
1132291975 15:100710313-100710335 GGTGGTGGTGGAAGTTGTGATGG + Intergenic
1132600111 16:769371-769393 GGAGGCGGGGATGGGTGGGACGG + Intergenic
1132680483 16:1138968-1138990 GGAGGGGCTCAAGGGTGGGACGG - Intergenic
1132689189 16:1174941-1174963 GGTGGAGGTGGGGGGTGGGGGGG - Intronic
1132729864 16:1356009-1356031 GGGGGTTGTGGAGGTTGGGAGGG + Intronic
1132772937 16:1574697-1574719 GTTGGTGGTGGGAGGTGGGAAGG - Intronic
1132855889 16:2044373-2044395 GGCGGTGAGGAAGGGTGGGCAGG + Intronic
1132884530 16:2176802-2176824 GGTGGGGATGGAGGGTGGGCCGG - Exonic
1133532889 16:6672321-6672343 TGTGGTGGGGAAGGGTGGCAGGG + Intronic
1133732894 16:8591230-8591252 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1133732930 16:8591419-8591441 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1133732939 16:8591455-8591477 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1133853069 16:9524283-9524305 GGTGGGGAGGAAGGGAGGGAGGG - Intergenic
1134100670 16:11449445-11449467 GGTGATGGTGCAGGGAGAGAAGG - Intronic
1134170816 16:11968132-11968154 GGTGGGAGAGAAAGGTGGGAGGG + Intronic
1134240573 16:12503093-12503115 GGTGGGGGTGGTGGATGGGAGGG - Intronic
1134664220 16:16006884-16006906 GGTGGTGGTGATGGTGGCGATGG + Intronic
1134743170 16:16566485-16566507 AGTGGGGGGGAAGGGAGGGAGGG - Intergenic
1134904852 16:17971620-17971642 GGTGGTGGTGGGCGGGGGGAGGG - Intergenic
1134924390 16:18145975-18145997 AGTGGGGGGGAAGGGAGGGAGGG + Intergenic
1135390542 16:22089616-22089638 GGTGGTGGCGGGGGGTGGGGTGG - Intergenic
1135680748 16:24454682-24454704 ATTGGTGGTGAAGGGTGGAGGGG - Intergenic
1136460672 16:30408113-30408135 GCTGCTGGTGAAGGGTGAGGAGG + Exonic
1136778351 16:32883160-32883182 GGTGGTGGTGGTGGTGGGGAGGG + Intergenic
1136892269 16:33978354-33978376 GGTGGTGGTGGTGGTGGGGAGGG - Intergenic
1137041801 16:35620059-35620081 TGTGGTGGAGCAGGGTGGGGGGG + Intergenic
1137576286 16:49602415-49602437 GGTGGGGGTGAAGGTCAGGAGGG + Intronic
1137608242 16:49801250-49801272 GGTGGTGGGGAAGGACGTGAGGG - Intronic
1137637507 16:49999643-49999665 CCTGGCTGTGAAGGGTGGGACGG + Intergenic
1137673941 16:50294615-50294637 GGGGATGGGGCAGGGTGGGAGGG - Intronic
1137785269 16:51133248-51133270 GGTGGGGGGGGAGGGAGGGAGGG + Intergenic
1137788288 16:51154300-51154322 GGAGGTGGAGGAGGGGGGGATGG + Intergenic
1137798171 16:51239360-51239382 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1137798291 16:51239962-51239984 GGTGGTGGTGATGGTGGTGAAGG + Intergenic
1137798344 16:51240226-51240248 GGTGGAGGTGATGGGGGTGATGG + Intergenic
1138386102 16:56636535-56636557 GGCTGTGGTTAAGGTTGGGAGGG + Intergenic
1138498428 16:57423162-57423184 GGTGGGAGGGAAGGGAGGGAGGG + Intergenic
1138520575 16:57568742-57568764 GGTGGTGGTGATGGAGGTGATGG - Intronic
1138520676 16:57569207-57569229 GGTGGTGGTGAAGGAAGTGGAGG - Intronic
1138635980 16:58338784-58338806 GTAGTTGGGGAAGGGTGGGAAGG - Intronic
1138649529 16:58451456-58451478 GGTGGTTCTGGTGGGTGGGACGG + Intergenic
1139118964 16:63992220-63992242 GGAGGTGGTGGAGGGAAGGAAGG - Intergenic
1139310379 16:66023477-66023499 GGTTGGGAGGAAGGGTGGGAAGG - Intergenic
1140388220 16:74561252-74561274 TGTGGTCATGAAGGGTGTGAGGG - Intronic
1140406479 16:74714519-74714541 GATGGAGGTGGGGGGTGGGAGGG - Intronic
1140470863 16:75213581-75213603 GGTGGTGGGGATTGGTGGGGTGG + Intergenic
1140941146 16:79722897-79722919 TGTGGTGGTGATGGTGGGGAGGG + Intergenic
1141013649 16:80427057-80427079 AGTGGTGGGAAAGGGAGGGAGGG - Intergenic
1141181208 16:81754331-81754353 GGAGGTGGGGATGGGCGGGAAGG - Intronic
1141181228 16:81754373-81754395 GGAGGTGGGGAGGGGTGGGGAGG - Intronic
1141181250 16:81754415-81754437 GGAGGTGGGGAGGGGTGGGGAGG - Intronic
1141304636 16:82850726-82850748 GGCGGTTGTGAAGGTTGGGGAGG - Intronic
1141464621 16:84197443-84197465 GGGTGTTGTAAAGGGTGGGAGGG + Intergenic
1141473685 16:84257466-84257488 GGGGAAGGTGGAGGGTGGGAAGG - Intergenic
1141650558 16:85390704-85390726 GGTGGCGGGGAGGGGTGGGGGGG - Intergenic
1141881317 16:86861619-86861641 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1142087701 16:88192993-88193015 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1142087707 16:88193017-88193039 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1142087731 16:88193122-88193144 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1142087768 16:88193239-88193261 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1142102813 16:88284650-88284672 GGTGGTGGTGAATTGTGTGTTGG - Intergenic
1142110942 16:88331054-88331076 GGTGGTCGTGATGGTTGTGATGG - Intergenic
1142110966 16:88331204-88331226 GGTGGTGGTGACGGTTGTGATGG - Intergenic
1142117359 16:88366269-88366291 GGTGGTGGTGAAGGTAATGATGG - Intergenic
1203080773 16_KI270728v1_random:1145269-1145291 GGTGGTGGTGGTGGTGGGGAGGG + Intergenic
1142809253 17:2387528-2387550 GGTGGTGCTGGGGGGTGGCAGGG + Exonic
1143158584 17:4854216-4854238 GGTGGTGGGGGAGGGAGTGAGGG - Intronic
1143200724 17:5111546-5111568 GTAGGGAGTGAAGGGTGGGAAGG - Intronic
1143248155 17:5502801-5502823 GGTGGAATTGAAGGGTGTGAAGG + Intronic
1143276610 17:5715971-5715993 GGGGGTGTTGAAGGATGGAAGGG + Intergenic
1143284790 17:5781064-5781086 GGGGGTGGTGAAAGGGAGGAGGG + Intronic
1143338897 17:6194056-6194078 GGTGGTGGTGATGGGGGTGGTGG + Intergenic
1143338921 17:6194140-6194162 GGTGGTGGTGATGGGGGTGGTGG + Intergenic
1143338935 17:6194185-6194207 GGTGGTGGTGATGGGGGTGGTGG + Intergenic
1143338961 17:6194272-6194294 GGTGGTGGTGATGGGGGTGGTGG + Intergenic
1143338979 17:6194332-6194354 GGTGGTGATGATGGGGGTGATGG + Intergenic
1143338997 17:6194383-6194405 GGTGGTGGTGATGGGGGTGATGG + Intergenic
1143432224 17:6895530-6895552 GGTGGGGGTAATGGCTGGGATGG - Intronic
1143435852 17:6924433-6924455 GGTTGTGGGGAAGGGAGAGATGG - Intronic
1143483165 17:7238640-7238662 GGTGGTGGGGCGGGGTGGGGGGG - Intronic
1143502903 17:7349237-7349259 GGTGGTGGGGAAAGGAGGTAAGG - Intronic
1143556859 17:7667601-7667623 GGTGGTGGAGATGGGTGTTAGGG - Intronic
1143585311 17:7847819-7847841 GGTGGTGGGGCAGGGCGGGGGGG - Exonic
1143706488 17:8701221-8701243 GCTGGTCGTGAAGGGAAGGAAGG - Intergenic
1143768273 17:9151557-9151579 GGTGGTGGTGGGGAGGGGGAAGG + Intronic
1144073952 17:11700466-11700488 GGTGGTGCTAATGGATGGGAAGG - Intronic
1144101465 17:11945629-11945651 GGAGGTGGCAAAAGGTGGGAAGG + Intronic
1144161115 17:12559270-12559292 GCGGGTGGGGAAGGGAGGGAGGG - Intergenic
1144511626 17:15882021-15882043 GGTGGTAGTGAGGGCAGGGAGGG - Intergenic
1144563915 17:16344290-16344312 GATGGTGTTGAAGGGTAGGGAGG - Intronic
1144572332 17:16407716-16407738 GATGGGGGTGAGGGGTGGGGGGG + Intergenic
1144704855 17:17361661-17361683 GAGGGAGGTGAAGGCTGGGAGGG + Intergenic
1144705214 17:17363591-17363613 GGTGGTGGTGATGGGGAAGAGGG + Intergenic
1144739781 17:17575448-17575470 TGAGGTGGTGAAGGGTGAGGAGG - Intronic
1144769707 17:17752704-17752726 TGTGGTGGTGAGGAGAGGGAGGG - Intronic
1144844648 17:18210280-18210302 GGTGCTGGTGAAGGGGGAGATGG + Intergenic
1145015154 17:19391790-19391812 GGTGGGGGGGAGGGGCGGGAGGG - Intergenic
1145315392 17:21728371-21728393 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
1145713822 17:27000308-27000330 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
1145721129 17:27074080-27074102 GGTGGTGGTGCAGGGAGAGGAGG - Intergenic
1145790866 17:27625751-27625773 GGGGATGGAGAAGGCTGGGAGGG + Exonic
1145863500 17:28226415-28226437 GGTGGGAGTGGGGGGTGGGAGGG - Intergenic
1145936700 17:28718318-28718340 GGTGGAGGGGAAGCGTGCGAAGG + Intronic
1145986594 17:29051282-29051304 GCTGGTGGTGAATGCTGGGTAGG + Intronic
1146300580 17:31686073-31686095 GATGGTGGTTATGGGTGGGTTGG - Intergenic
1146356006 17:32134882-32134904 GGTGGGGGTGGAGGTTGGGGTGG + Intergenic
1146381718 17:32334682-32334704 GCTGGTGGGGAAGGGATGGAAGG + Intronic
1146547562 17:33751937-33751959 GGTGGGGGTGAGGGGTGGGGTGG + Intronic
1146705525 17:34998275-34998297 GCTGGTGCTGAAGGATGTGAAGG + Exonic
1146806016 17:35865464-35865486 GGAGGGGGTAAAGGGAGGGAAGG + Intronic
1146969734 17:37062906-37062928 GGTGGAGGTGAAGGGTGTCAGGG + Intergenic
1147187924 17:38722651-38722673 GGTGGGGGTGGGGGGTGGGGGGG - Intronic
1147374537 17:40015961-40015983 GGAGCTGGGGAAGGCTGGGAAGG + Intronic
1147443313 17:40460568-40460590 GGTGGGGGTGAGGGGTGGGGTGG - Intergenic
1147465176 17:40605334-40605356 GGTGGAGGTGAAGGGTGAGAAGG + Intergenic
1147575804 17:41598485-41598507 TGTGGTGGTGATGGTAGGGATGG + Intergenic
1147575966 17:41599180-41599202 GGTGGTGGTGATGGTAGTGATGG + Intergenic
1147976168 17:44249467-44249489 GGGAGTGGGGGAGGGTGGGAAGG - Exonic
1148087776 17:45004771-45004793 GGTGGGGGGGAAGGGTGGTGGGG + Intergenic
1148105248 17:45115304-45115326 TGGGGTGGGGAAGGGGGGGAAGG - Intronic
1148152671 17:45405564-45405586 GGGGGTGGTGATGGGTGGGCGGG - Intronic
1148155772 17:45424659-45424681 GGAGTGGGGGAAGGGTGGGAGGG + Intronic
1148157769 17:45433148-45433170 GGGGGTGGGGGATGGTGGGAGGG - Intronic
1148318891 17:46732340-46732362 GGTGGTGGGGGAGGGGTGGAAGG - Intronic
1148330203 17:46809632-46809654 GGTGGAGGTGAGGGGGGCGAGGG - Intronic
1148370408 17:47095419-47095441 GGAGGGAGTGAAGGGAGGGAGGG + Intergenic
1148564984 17:48627335-48627357 GGTGGTGGTGACGTGGGGGGTGG + Intronic
1148650993 17:49249794-49249816 GAGGGTGGTGAGGGGAGGGAAGG + Intergenic
1148698349 17:49574508-49574530 GGTGTTGGTGGGGGGTGGGGTGG - Intergenic
1148750287 17:49941614-49941636 GGTGGGCGTGAAGGGAGGGTAGG - Intergenic
1148751806 17:49949476-49949498 GGGGGTGGAGAAGGGAGGAAGGG + Intergenic
1148776581 17:50099140-50099162 GGTGGTGTGGAGTGGTGGGAAGG + Intronic
1149502791 17:57167187-57167209 GGTGGTGGGGAAGGGGGGGTGGG + Intergenic
1149664263 17:58354775-58354797 GGTGATGGTGGAGGGTGAGAGGG - Exonic
1150148798 17:62793009-62793031 GGTGGTGGTGATGGTTGTGGTGG - Intronic
1150148824 17:62793133-62793155 GGTGGTGGTGATGGTGGTGATGG - Intronic
1150148901 17:62793439-62793461 GGTGGTGGTGATGGTGGTGATGG - Intronic
1150149080 17:62794184-62794206 GGTGGTGGTGATGGTTGTGATGG - Intronic
1150172122 17:63008840-63008862 TGTGGTGGTGGGGGGTGGGGGGG + Intergenic
1150387462 17:64773326-64773348 GGAGTGGGGGAAGGGTGGGAGGG + Intergenic
1150434198 17:65141336-65141358 GGTGGTGGTACTGGCTGGGATGG - Intronic
1150488286 17:65559104-65559126 GGGGGAGGGGAAGGGAGGGAAGG - Intronic
1150619494 17:66798499-66798521 GGTGGTGGTGACGGTGGTGACGG + Intronic
1150619499 17:66798520-66798542 GGTGGTGGTGATGGTGGTGACGG + Intronic
1150933079 17:69606265-69606287 AGGGGTGGTGAATGGTGGGAAGG + Intergenic
1151153907 17:72111184-72111206 GGGGGTGGGGAAGGATGGGCGGG - Intergenic
1151362700 17:73598163-73598185 GGCAGTGGTGAATGGTGGGAGGG - Intronic
1151438819 17:74115136-74115158 GGTGGCGGTGATGGTGGGGAAGG - Intergenic
1151498320 17:74473098-74473120 GGTGGGTGAGAGGGGTGGGAAGG + Intronic
1151661901 17:75523584-75523606 GGTGGAGGGAAAGGGTGGGATGG + Intronic
1151791240 17:76307348-76307370 GGTGGTGGGGACGGAGGGGATGG - Intronic
1151976117 17:77484328-77484350 GGTGGTGGTGATGGAGGTGATGG + Intronic
1151976169 17:77484600-77484622 GGTGGTGGTGATGGTGGTGATGG + Intronic
1151976199 17:77484735-77484757 GGTGGTGGTGGTGGTTGTGATGG + Intronic
1151976243 17:77484957-77484979 TGTGGTGGTGAAGGGGGTGATGG + Intronic
1151976251 17:77484990-77485012 GATGGTGGTGAAGGGGGTGATGG + Intronic
1151976259 17:77485023-77485045 GATGGTGGTGAAGGGGGTGATGG + Intronic
1151976302 17:77485214-77485236 GATGGTGGTGAAGGGGGTGATGG + Intronic
1151976336 17:77485420-77485442 GGTGGTGGTGATGAGGGTGACGG + Intronic
1152036149 17:77874360-77874382 GGTGATGGTGCAGGGAGGGAGGG - Intergenic
1152120169 17:78413630-78413652 GGTGCTGGTGAAGGGCAGCACGG + Intronic
1152269584 17:79316171-79316193 GGTGATGGTGGAGGGTGGAGGGG + Intronic
1152361326 17:79834465-79834487 GGTGGTGGTGATGGGGGTGCGGG + Exonic
1152441697 17:80313685-80313707 GGTGGTGGTGAAGGGGATGGTGG + Intronic
1152471582 17:80492555-80492577 GGTGGTGGGGCAGGGCAGGAGGG + Intergenic
1152471607 17:80492640-80492662 GGTGGTGGGGCAGGGCAGGAGGG + Intergenic
1152636452 17:81432530-81432552 GGGCCTGGTGATGGGTGGGAGGG - Intronic
1152658582 17:81531368-81531390 GGTGGTGGTGATGGTGGTGATGG + Intronic
1152658649 17:81531827-81531849 GGTGGTGGTGATGGTGGTGATGG + Intronic
1152699153 17:81810668-81810690 GGTGGAGGTCAAGTGGGGGAGGG + Intronic
1152831710 17:82501348-82501370 GGTGGAGGTAGAGGGTGGGGAGG - Intergenic
1153137520 18:1933743-1933765 GGTGGTGGTGCAGGCAGGGAAGG + Intergenic
1153310856 18:3675660-3675682 GGAGGTGGGGATGGGTGGCATGG - Intronic
1153476680 18:5505649-5505671 GGTGGAGGTGAAGGTGTGGATGG - Intronic
1153476695 18:5505703-5505725 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476704 18:5505730-5505752 GGTGGAGGTGAAGGTGTGGATGG - Intronic
1153476712 18:5505757-5505779 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476721 18:5505784-5505806 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476738 18:5505838-5505860 GGTGGAGGTGAAGGTGTGGAGGG - Intronic
1153476747 18:5505865-5505887 GGTGGAGGTGAAGGTGTGGAAGG - Intronic
1153953545 18:10076787-10076809 GGTGGAGGTGACCGGTGGGCAGG - Intergenic
1154169605 18:12041444-12041466 GGTGGTGGTGCAGGTGGGGGTGG + Intergenic
1155507345 18:26547024-26547046 GGCGGTGGTGGTGGGAGGGATGG + Intronic
1155889281 18:31246643-31246665 GGTTGTCGGGGAGGGTGGGAGGG - Intergenic
1156390709 18:36648202-36648224 GCTTGTGGTCAGGGGTGGGAAGG + Intronic
1156458379 18:37307477-37307499 GGTGGTGGGGGAGCGGGGGACGG - Intronic
1156497668 18:37536730-37536752 GGTGATGGCGGAGTGTGGGAGGG - Intronic
1156625948 18:38909376-38909398 GGTGGCGGGGGAGGGGGGGAAGG - Intergenic
1156688381 18:39676987-39677009 TATAGTGGTAAAGGGTGGGAAGG - Intergenic
1157356678 18:46941488-46941510 GGAGGTGGGGAGGGGTGGGGAGG + Intronic
1157376800 18:47174858-47174880 GGTGAAGGTGAAGGGTTGGGAGG - Intronic
1157383972 18:47247194-47247216 GGTGGTGGTGAGGGTGGTGATGG + Intronic
1157409868 18:47454588-47454610 GGTGGAGGTGGTGGGAGGGATGG + Intergenic
1157664107 18:49470830-49470852 CTTGGTGGGGAAGGTTGGGAGGG - Intergenic
1157710759 18:49848244-49848266 GCTGGTGGTGATGGGCTGGAAGG + Intronic
1157911639 18:51622592-51622614 GCTGGTGGAGAAGGGTGAGTAGG + Intergenic
1158017163 18:52797751-52797773 AGCAGTGGTGATGGGTGGGATGG + Intronic
1158063888 18:53381557-53381579 GGTGGTGGTGGGGGGGGGGTGGG - Intronic
1158126924 18:54110415-54110437 CTTGAGGGTGAAGGGTGGGAGGG - Intergenic
1158319647 18:56248882-56248904 GGTGGGGGTGGAGGGGGGCAGGG + Intergenic
1158441659 18:57479993-57480015 GGCAGTGGTGTTGGGTGGGATGG + Exonic
1158566239 18:58556568-58556590 GCTGGTGGAGGAAGGTGGGAGGG + Intronic
1158640382 18:59198316-59198338 GATGGTAGGGAAGGGCGGGAAGG + Intergenic
1158650062 18:59276165-59276187 GGTGGTGGTGATGGGGGTGGGGG + Intronic
1158708863 18:59819082-59819104 GGTGGTGTTGAAGGTTTGAAGGG + Intergenic
1158811777 18:61046547-61046569 GATTGTGGGGAAGGATGGGAAGG + Intergenic
1159236085 18:65674102-65674124 GGTAGGGTGGAAGGGTGGGAGGG + Intergenic
1159590766 18:70332729-70332751 GGTGGTGGTTGGGGGTGGGGAGG - Intergenic
1160025908 18:75215985-75216007 TGTGGTGGGGGAGGGTTGGAAGG + Intronic
1160026780 18:75224748-75224770 GGTGGTGGGGAGGGGTGCGGCGG + Intronic
1160256668 18:77252947-77252969 GGTGGTGGTGATGGTGGTGATGG - Intronic
1160256675 18:77252977-77252999 GGTGGTGGTGATGGTGGTGATGG - Intronic
1160256688 18:77253022-77253044 GGTGGTGGTGATGGTGGTGATGG - Intronic
1160257282 18:77258617-77258639 GGTGGTGGTGATGGTGGTGATGG + Intronic
1160542651 18:79633607-79633629 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1160542698 18:79633856-79633878 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1160542718 18:79633952-79633974 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1160676656 19:394747-394769 GATGATGGAGAAGGATGGGAAGG + Intergenic
1160676681 19:394857-394879 GATGATGGAGAAGGATGGGAAGG + Intergenic
1160777133 19:861526-861548 GGTGGGGGTGCAGGTGGGGATGG - Intronic
1160872137 19:1282386-1282408 GGGAGGGGAGAAGGGTGGGAAGG + Intergenic
1160872204 19:1282550-1282572 GGAGGGGGAGGAGGGTGGGAGGG + Intergenic
1160920047 19:1515337-1515359 GGTGGTGGTGAAGATGTGGAGGG + Intergenic
1160977980 19:1803153-1803175 GGTGTTGGTGAATGGGGGGCTGG - Intronic
1161025285 19:2033948-2033970 GGGGGAGGTGAAGGGTGGGCCGG - Intronic
1161106465 19:2446139-2446161 GGTGGGGGTGACTGGTGGGGGGG - Intronic
1161117297 19:2504990-2505012 GGTGAGGGGGAAGGGAGGGAGGG - Intergenic
1161133008 19:2602741-2602763 GGTGGTGGTGAGGGGAGGGCCGG - Intronic
1161139594 19:2639708-2639730 GGAGGGGGGGAAGGGAGGGAAGG + Intronic
1161339664 19:3734365-3734387 GGTGGTGGTGGGATGTGGGATGG - Exonic
1161579384 19:5072321-5072343 GGTGGTGGGGACGGAGGGGAAGG + Intronic
1161583187 19:5091746-5091768 GGGGCTGGGGAAGGGTGGGAGGG + Intronic
1161727162 19:5936194-5936216 GGCGCTGGTGCAGGGTGGGGAGG + Intronic
1161989974 19:7679003-7679025 GGAGGTGGAGGAGGGTGGGTGGG + Intronic
1162186741 19:8911036-8911058 GATGGTGGTGGAGGTTGTGATGG - Intronic
1162217865 19:9151057-9151079 GTTGGTGGGGAAAGGTGGAATGG + Intronic
1162362151 19:10226933-10226955 GGTGGAGGGGAGGGATGGGAGGG - Intronic
1162452534 19:10763702-10763724 GGAGGTGGTGAGGCTTGGGAGGG + Intronic
1162500502 19:11050805-11050827 GGTGCAGGTGGAGGGTGGGCAGG + Intronic
1162525610 19:11204423-11204445 GGAGGTGATGGAGGGTGGGTAGG - Intronic
1162728019 19:12701464-12701486 GGTGGTGGTGAGGGGTAGGCAGG + Intronic
1162780076 19:13002369-13002391 GGTGGTGAGGAAGGGGGGGTTGG - Intronic
1163020693 19:14479594-14479616 GGTGGTGGTGAAAGCCAGGAAGG - Intronic
1163090399 19:15015535-15015557 GGTGCAGGAGAAGGGTGGAAGGG - Intronic
1163148552 19:15398363-15398385 GGGGGTGGTGTCGGGAGGGATGG + Intronic
1163208976 19:15826405-15826427 GGTGGTGGTGGTGGTTGGCAGGG - Intergenic
1163213056 19:15856079-15856101 CTTGGGGGTAAAGGGTGGGAAGG + Intergenic
1163337147 19:16680517-16680539 GGTAGTGGTGATGGGCGTGATGG - Exonic
1163366933 19:16880711-16880733 GGTGGTCGTGTGGGGTGGGTGGG - Intergenic
1163432027 19:17273997-17274019 GGTGGTGGTGAACGATGACACGG + Exonic
1163655456 19:18542979-18543001 GGTTGGGGTGGGGGGTGGGAGGG - Intronic
1163659519 19:18568444-18568466 GGTCGTGGTGCTGGGTGGGATGG - Exonic
1163732128 19:18955273-18955295 GGGATTGGTGAATGGTGGGATGG - Intergenic
1163775368 19:19214168-19214190 GGTGGGGGTGAAGTGAAGGAGGG + Intronic
1163878838 19:19900313-19900335 TGTGGTTTTGAAGGGTGGGAAGG - Intergenic
1164305948 19:24003959-24003981 GGGGGTGGGGAAGGTTGGGGGGG - Intergenic
1164320129 19:24137149-24137171 GGAGGTGGTGAAGGGTGCAGTGG + Intergenic
1164658716 19:29943191-29943213 CGAGGTGGGGAAGGGTAGGAGGG - Intronic
1164868713 19:31625900-31625922 GGTGGTGGAGGAGAGGGGGATGG - Intergenic
1164895176 19:31870610-31870632 GGCAGTGGTCAAGGGTGGGCAGG - Intergenic
1164985134 19:32642914-32642936 CGTGCTGGTGCAGTGTGGGAGGG + Intronic
1165135078 19:33662677-33662699 GGAGGTGGTGAAGGGAGGAGGGG + Intronic
1165144244 19:33721379-33721401 TGTGGTGATGCAGTGTGGGAAGG - Intronic
1165233798 19:34404570-34404592 GGTGCTGCTGAAGGGTGCGGAGG + Intronic
1165390333 19:35534921-35534943 GGGGGTGGAGAAGGGCTGGAAGG - Intronic
1165796741 19:38524073-38524095 GGTGGTGGGGAGGGAAGGGAAGG - Intronic
1165838572 19:38773586-38773608 GGTGTGGGTGGTGGGTGGGAAGG - Intergenic
1165840987 19:38789111-38789133 GGTGTGGGTGGTGGGTGGGAAGG + Intergenic
1165921043 19:39298065-39298087 GGATGTGGTGCAGGGTGTGAAGG - Exonic
1166101760 19:40575774-40575796 GGTGGGGGTGGTGAGTGGGAAGG - Exonic
1166219896 19:41357640-41357662 GGTGGGGGGTCAGGGTGGGAGGG - Intronic
1166316492 19:41992523-41992545 GGGGGAGGTCAAGGGAGGGATGG - Intronic
1166346045 19:42166597-42166619 GCTGGAGGTGAAGGAGGGGAAGG + Intronic
1166500818 19:43339947-43339969 GGTGGTGGAGAGGGCTGGGCTGG - Intergenic
1166505278 19:43367626-43367648 GGTGGTGGAGAGGGCTGGGCTGG - Intergenic
1166509281 19:43393469-43393491 GGTGGTGGAGAGGGCTGGGCTGG + Intergenic
1166580008 19:43888182-43888204 AGGGTTGCTGAAGGGTGGGATGG + Intronic
1166734308 19:45075521-45075543 GGTGGCGGTGGAGGGGGGGCGGG - Intronic
1166739150 19:45103710-45103732 GGTGGTGGTGATGGAGGTGATGG + Intronic
1166862896 19:45819957-45819979 GGGCGTGTTGAAGGGTGGGGTGG + Intronic
1166938687 19:46350191-46350213 GGTGGGGCTGGAGGGTGAGAAGG + Intronic
1166965727 19:46528514-46528536 GGTGGGGCTGGAGGGTGAGAAGG - Intronic
1167087637 19:47321044-47321066 GGGGGGGGTGGGGGGTGGGAGGG - Exonic
1167299173 19:48669417-48669439 GGTGGTGGTGATGGTGGTGATGG - Intronic
1167299236 19:48669703-48669725 GGTGGTGGTGATGGTGGTGATGG - Intronic
1167340960 19:48915786-48915808 GGGGGTGGTGCCCGGTGGGATGG - Intronic
1167397839 19:49243229-49243251 GGTGGGGGTGAGGGTGGGGAGGG + Intergenic
1167665984 19:50823060-50823082 GCTGGGGGTGCTGGGTGGGAAGG + Intronic
1167667971 19:50833633-50833655 TGTGGTGGTGTAGGGTGGGGTGG + Intronic
1167711715 19:51115755-51115777 GGTGGTGCAGCAGGGTGGGTGGG + Intergenic
1168100649 19:54139208-54139230 GGCAGGGGTGAAGGGAGGGAGGG - Intronic
1168144572 19:54413762-54413784 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1168144580 19:54413800-54413822 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1168144637 19:54414115-54414137 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1168144653 19:54414196-54414218 GGTGGTGGTGATGGTGGTGACGG - Intergenic
1168238385 19:55077548-55077570 GGCGGTGGTGCTGGGTGGTAGGG - Intronic
1168322346 19:55517881-55517903 GATGGTGGTGAAGGGTTGAGGGG - Exonic
1168400536 19:56083769-56083791 GGTGGGGGTGGGGGGTGGGGTGG + Intergenic
1168501499 19:56897093-56897115 GGTGGTGGTGGAGGTGGGTAAGG + Intergenic
1168710086 19:58494630-58494652 GGTGGTGGGGAAGGGAGAAAAGG - Intronic
925223967 2:2166309-2166331 GATGGTGGTGGAGGCTGGGAGGG - Intronic
925284221 2:2705440-2705462 GCTGCTGTTGAAGAGTGGGAGGG - Intergenic
925330916 2:3057998-3058020 GGTGGTGGTGATGGTGGTGATGG + Intergenic
925339342 2:3125491-3125513 GGCGGTGTTGAAGGGTGGGGTGG - Intergenic
925425941 2:3748670-3748692 GGTTGAGGTGCTGGGTGGGATGG + Intronic
925449542 2:3957009-3957031 CGTGGTGCTGCAGGGTGGCATGG - Intergenic
925498738 2:4481186-4481208 TGTGGTTTTGAAGGGTGGAATGG + Intergenic
926112108 2:10190058-10190080 GGTGGTGGTGATGGTTATGATGG + Intronic
926112126 2:10190166-10190188 GGTGGTGGTGATGGTTATGATGG + Intronic
926112170 2:10190392-10190414 GGTGGTGGTGATGGTGGTGATGG + Intronic
926112176 2:10190401-10190423 GATGGTGGTGATGGGGGGGTTGG + Intronic
926112216 2:10190631-10190653 GGTGGTGGTGATGGTGGGGTTGG + Intronic
926112239 2:10190781-10190803 GGTGGTGGTGATGGTGGGGTTGG + Intronic
926332665 2:11838139-11838161 GGTGGTGGTGACAGATGGGAGGG + Intergenic
926473676 2:13294056-13294078 GTTGGGGGTGAGTGGTGGGAGGG + Intergenic
926693827 2:15756434-15756456 GGTGGGGCTGATGGGTGGGTGGG - Intergenic
926819587 2:16838145-16838167 GGTGGTGGCCAAGTGTGGGGAGG - Intergenic
926853466 2:17226655-17226677 GGGGGTGGTGAGGAGAGGGAGGG + Intergenic
926886762 2:17605342-17605364 GGTTCTGGGGAAGGCTGGGAAGG - Intronic
927512044 2:23649941-23649963 GGTGGTGCAGCAGGGAGGGAGGG - Intronic
927543500 2:23932550-23932572 GGTGGGGGTGCAGGGTTGGGAGG + Intronic
927596695 2:24403289-24403311 GGGGGTGGTGAAGGGAGGCCTGG - Intergenic
927752979 2:25686422-25686444 GGTGGTGGGGGAGGGAGGGGAGG + Intergenic
927857427 2:26536259-26536281 GGGGTTGGTGATGGGTGTGAAGG - Intronic
927864709 2:26580981-26581003 GGTTTTGATGAAGGGAGGGAAGG + Intergenic
927999162 2:27507792-27507814 GGGAGTGGTGAGGGGTGGGGAGG + Intronic
928227292 2:29462428-29462450 GTGGATGCTGAAGGGTGGGATGG - Intronic
928559841 2:32469523-32469545 TGTGGTGGTGAAAGGTGGTGGGG + Exonic
928651457 2:33408019-33408041 GGTGGTGGGGAAGTGAGGGAGGG - Intergenic
928683798 2:33727950-33727972 GGTGGTCGTGACGGTTGGGTGGG + Intergenic
929078445 2:38097733-38097755 GGTGCTGGGGAAGGCTGGGAAGG - Intronic
929191002 2:39139597-39139619 GGGGGTGGTGATGGGGGAGAGGG - Intergenic
929444493 2:41991928-41991950 GGAGGAGGGGAAGGGAGGGAGGG + Intergenic
929562573 2:42964917-42964939 GCTGGTGGTGATGGTGGGGAGGG - Intergenic
930218918 2:48726012-48726034 GGTGGGGGAGAGGGGTGGGAGGG - Intronic
930358133 2:50346476-50346498 GTTGGTGGTGAGGGGTGGGAGGG - Intronic
930399762 2:50868383-50868405 GGTGACTGGGAAGGGTGGGATGG + Intronic
930537648 2:52664612-52664634 GGTGGCAGTGAAGGGTGTGGAGG + Intergenic
930789831 2:55313708-55313730 GGTGGTGGTGTAGGCAGGGCGGG - Intronic
931242686 2:60467191-60467213 GGTGGTGGTGATGGCGGTGATGG + Intronic
931246810 2:60498943-60498965 GGTGGTGGTGGTGGGTGGTGGGG + Intronic
931246813 2:60498946-60498968 GGTGGTGGTGGGTGGTGGGGGGG + Intronic
931348880 2:61470943-61470965 GGCGGCGGGGAAGGGGGGGAAGG + Intergenic
931664488 2:64600414-64600436 GGAGGTGGTGCAGGGAGGGTAGG + Intergenic
932049601 2:68385543-68385565 GAGGGAGGTGAAGGGTGGGTGGG - Intronic
932371071 2:71188394-71188416 GGTGGAGCTGAAGAGGGGGATGG - Exonic
932417794 2:71584189-71584211 AATGGGGGTGAAGGGTGGGTGGG + Intronic
932715930 2:74100838-74100860 GCTGGTGGTGAGGAGTGGGGTGG - Exonic
932892811 2:75611325-75611347 GGTGGTGGGGGATGGTTGGAGGG - Intergenic
933708474 2:85308481-85308503 GGAGGGGGGGAAGGGAGGGAAGG - Intronic
933776102 2:85772170-85772192 GGTGGTAGCGAGGGGTGGGTTGG + Intronic
933936570 2:87208928-87208950 GGAGGAGGGGAAGGGAGGGAAGG - Intergenic
934505555 2:94889902-94889924 GGTGGTGGTGGTTGGTGGGAAGG - Intergenic
934605379 2:95691186-95691208 GGTGTTGGTGCAAAGTGGGAAGG + Intergenic
934718666 2:96558048-96558070 GTGGGTGGTGGAGGGTGGGGTGG - Intergenic
934751997 2:96799557-96799579 GGTGGAGGTGGAGGCAGGGAAGG + Exonic
935640687 2:105287190-105287212 GGTGGGGGTGTAGGGTGGGGAGG + Intronic
935692778 2:105745357-105745379 GGTGGGGGTTAGGGATGGGAAGG - Intronic
935759012 2:106301170-106301192 GGTGGTGGTCGGGGGTTGGAGGG + Intergenic
935957996 2:108397854-108397876 GGTGGTGGTGGTGGGGAGGAGGG - Intergenic
936069735 2:109358047-109358069 GGTGGTGGAGGAGGGAGGGATGG - Intronic
936087407 2:109478681-109478703 TGTGGTGGGGAAGGGAGAGAGGG + Intronic
936356574 2:111756898-111756920 GGAGGAGGGGAAGGGAGGGAAGG + Intergenic
936414115 2:112288989-112289011 GGTGGTGGTGGCGGGGGGGTGGG - Intronic
936418992 2:112346291-112346313 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936419000 2:112346324-112346346 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936419010 2:112346369-112346391 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936419023 2:112346426-112346448 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936419035 2:112346474-112346496 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936419082 2:112346698-112346720 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936419092 2:112346740-112346762 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936419102 2:112346785-112346807 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936524222 2:113232098-113232120 GGCGGTGGGGAAGGTTAGGAAGG - Intronic
936538839 2:113333733-113333755 GGTGTTGGTGAAAAGTGGGAAGG + Intergenic
936542903 2:113366408-113366430 GGTGGTGGTGATGGTGGTGATGG - Intergenic
936696267 2:114952697-114952719 TGTGTTGGGGAAGGGTGAGATGG + Intronic
936915428 2:117635016-117635038 GGTGGTGGTGAATGTTCGGCTGG - Intergenic
937272899 2:120665269-120665291 GGTGGTGGTGGTTGGTGGGGGGG - Intergenic
937277815 2:120696687-120696709 GGGGCTGGGGAAGGGAGGGAGGG + Intergenic
937347070 2:121132609-121132631 GTTGGGGGTGCAGGGGGGGATGG + Intergenic
937692476 2:124771911-124771933 GGTGGTGGTGAGGGGGGTAATGG - Intronic
937890811 2:126937082-126937104 GGTGGGGGTGAGAAGTGGGAGGG + Intergenic
937953957 2:127408664-127408686 GGTGGTGGTGGTGGGGGCGAGGG - Intergenic
938424130 2:131170421-131170443 GGTTGTGCTGAAGGTTGGGGTGG - Intronic
938797710 2:134732125-134732147 GCTTGGGGGGAAGGGTGGGAGGG - Intergenic
938801410 2:134766597-134766619 GGAGATGGTGAAGGCTGGAAGGG + Intergenic
939411736 2:141835486-141835508 GGTGGTGGTGGGGGGAGGGGAGG + Intronic
939482102 2:142761982-142762004 GGTGTTGGTGATGGCTGTGATGG - Intergenic
939804435 2:146754828-146754850 GGGGGGAGTTAAGGGTGGGAGGG + Intergenic
939894752 2:147777617-147777639 GGTGGTGGTGGAGGGAAGGTTGG - Intergenic
939968711 2:148636868-148636890 GGGAGTGGGGAGGGGTGGGAGGG + Intergenic
940034664 2:149301459-149301481 GGAGGTGGTGGAGGGTGCAATGG + Intergenic
940618639 2:156083528-156083550 GGAGGTGGTGGAGGGTGCGATGG + Intergenic
940747754 2:157588584-157588606 GGAGGTGGGGGAGGGTGGGAGGG - Intronic
940849073 2:158671375-158671397 GGGGGTGGGGAGGGCTGGGAAGG + Intronic
940984565 2:160039743-160039765 GGTTGTGGTAAAGGGCAGGAGGG + Intronic
941115992 2:161472715-161472737 GGTGGGGGTGCAGGGGGTGATGG + Intronic
941713864 2:168743916-168743938 GGTGGTGGTGGGGGGTGGGGTGG - Intronic
941919991 2:170840648-170840670 GGAGGTAGGGAAGGGAGGGAGGG + Intronic
942034012 2:171993122-171993144 AGTGGAGGTGGAGAGTGGGAGGG + Intronic
942083607 2:172424881-172424903 GGTGGTGGGGTTGGGTGGGGGGG + Intergenic
942110427 2:172676886-172676908 GGTGTTGCTGAAGGATGGGGTGG - Intergenic
943105755 2:183544029-183544051 GGGGGTGGTGGGGGGTGGGGGGG + Intergenic
943286632 2:186009495-186009517 GATGGTGGGGAAGAGGGGGAAGG + Intergenic
943400072 2:187397697-187397719 GGTGGTTTAGAAGGGTGGGAGGG - Intronic
943520331 2:188941707-188941729 GGTAGTGATGACGGGTGGGTGGG + Intergenic
943708286 2:191059829-191059851 ATTGGTGGTGAATGGTGAGAAGG + Intronic
944168029 2:196743555-196743577 GGTGGGGGTGGGGGGTGGGAGGG - Intronic
944274369 2:197818934-197818956 GGGGCTGGTGAGGGATGGGAGGG + Intronic
944391111 2:199220542-199220564 GGTGGTGGTGATGGGGGGTGGGG + Intergenic
944551808 2:200851047-200851069 GGACTTGGGGAAGGGTGGGAGGG - Intergenic
944599650 2:201290371-201290393 AGTGGTGGGGTAGGGTGGGGTGG + Intronic
944874000 2:203943552-203943574 GGAGGTGGCGAAGGGTGCAATGG + Intronic
944877057 2:203972935-203972957 GGAGTTGGAGAAGAGTGGGAAGG - Intergenic
944890663 2:204114244-204114266 GGGAGTGGTGAAGGCTGGGAAGG + Intergenic
945516509 2:210768827-210768849 TGGGGCGGTGAATGGTGGGAGGG + Intergenic
945699146 2:213149747-213149769 TGTGGTGGTGAAGAAGGGGAGGG - Intronic
945859189 2:215101368-215101390 GGAGGTGGTGGTGAGTGGGATGG - Intronic
946009110 2:216550456-216550478 GATGGCCGTGAAGGGTGGGGAGG - Intronic
946039065 2:216768501-216768523 GCTGGGGCTGGAGGGTGGGAAGG + Intergenic
946092843 2:217246113-217246135 GGTGCTGGAGAAGAGTGTGAGGG - Intergenic
946248468 2:218399985-218400007 GGGGGAGGGGAGGGGTGGGAGGG - Exonic
946248646 2:218400532-218400554 GGTGGGGGTGGGGGGTGGGGCGG - Intronic
946449705 2:219769306-219769328 GGGGGAGGAGAAGGGAGGGAGGG - Intergenic
947162887 2:227231945-227231967 AGGGGTAGTGAAGGGTTGGATGG - Intronic
947619378 2:231579588-231579610 GGTGGTGGTGATGGTGGTGATGG - Intergenic
947633267 2:231666906-231666928 GGAAGGGGTGAAGGGTGGGCTGG + Intergenic
947654015 2:231810802-231810824 GGAGGTGGTGAAGGCAGCGAAGG + Intergenic
947983271 2:234427579-234427601 GGTGGGGGTGGAAGGTGGGGTGG - Intergenic
948158400 2:235803015-235803037 GATGGTGGTGATGGTTGTGATGG + Intronic
948273106 2:236688799-236688821 GGGGGTGGGGAGGGGTGGGAAGG + Intergenic
948284746 2:236774698-236774720 GGGGGTGGTGAGGGGTGGAGTGG + Intergenic
948512305 2:238476719-238476741 GGTGGTGGTGAATGGCGGAGGGG + Intergenic
948518414 2:238520682-238520704 GGTGGTGGTGATGGTGGTGATGG + Intergenic
948656649 2:239480393-239480415 GGTGGTGGAGAAGGGAGCGCCGG + Intergenic
948912714 2:241012393-241012415 GGTGGCGATGCAGGGTGGGGCGG - Intronic
948976500 2:241466687-241466709 GGTGGTGGTGGGGGGGGGGGTGG - Intronic
948976501 2:241466690-241466712 GGTGGTGGTGGTGGGGGGGGGGG - Intronic
1168787971 20:556306-556328 GGAGAGGGTGGAGGGTGGGAGGG + Intergenic
1169404922 20:5315171-5315193 GGTGGTGGTGGGGTGGGGGAGGG + Intergenic
1169598282 20:7226149-7226171 GGTGGTGGTGGCAGGTGGGTAGG + Intergenic
1170045701 20:12083191-12083213 GGTGGAGGTGAGGGGTGGGAAGG - Intergenic
1170184046 20:13567265-13567287 ACTGAGGGTGAAGGGTGGGAGGG + Intronic
1170375831 20:15699471-15699493 GGAGGTGGTGGAGGGTGCAATGG + Intronic
1171035577 20:21710077-21710099 GGTGGTGGTGGTGGGCGGGTGGG + Intronic
1171165643 20:22967789-22967811 GGAGGTGGTGGAGGGTGCAATGG - Intergenic
1171251045 20:23647813-23647835 GGTGGTTGTAAAGGTTGGGGTGG + Intergenic
1171253676 20:23669641-23669663 GGTGGTGGTGATGGTAGTGATGG - Intergenic
1171313303 20:24164227-24164249 GTGGGTGCTGAAGGTTGGGATGG - Intergenic
1171321605 20:24249023-24249045 GGAGGTGGGGATGGGTGGGGTGG + Intergenic
1171376218 20:24695923-24695945 GGTGGTGCTTAGGGATGGGATGG - Intergenic
1172125860 20:32624850-32624872 GGGGGTGGTAAGGGGTGGGTTGG - Intergenic
1172144110 20:32744179-32744201 GGTGGTGGTGAGGTGGGTGAGGG + Intergenic
1172266425 20:33618963-33618985 GGTGGTGGTGAAGGGAATCAAGG + Intronic
1172520222 20:35561200-35561222 GGTGGTGGGGAGGGGTGGTTGGG - Intergenic
1172581003 20:36048081-36048103 GGTGGTGGAGAGGAGTTGGAAGG - Intergenic
1172606845 20:36219810-36219832 GGTGGTGGTGGAGGTTGAGAGGG - Exonic
1172860547 20:38046769-38046791 GGGGGTGGGGAAGAGTGGGTAGG + Intronic
1172898146 20:38315005-38315027 GGTGATGGTGATGGTGGGGATGG + Intronic
1173089020 20:39952478-39952500 GGGGGTGAGGAAGGGAGGGAGGG + Intergenic
1173441038 20:43076655-43076677 GGTGGGGGTAATGGGTGGTATGG - Intronic
1173501935 20:43560084-43560106 GGTGATGGGGGAGGGTGTGATGG + Intronic
1173527885 20:43746823-43746845 GGAGGTGGTGGAGGGAGAGAGGG + Intergenic
1173632233 20:44525276-44525298 GGGGTGGGGGAAGGGTGGGAAGG - Intergenic
1173826482 20:46051048-46051070 GGTGGTGGTTAAGAGTGTGGGGG + Intronic
1173845768 20:46187559-46187581 GGTGGTGGTGAGGGTAGTGATGG - Intronic
1174064098 20:47852254-47852276 CCTGGTGGTCCAGGGTGGGATGG + Intergenic
1174127475 20:48317587-48317609 GGTGTTGGAGAAGGCTGGGCAGG + Intergenic
1174353283 20:49982919-49982941 GGGGGTGGTGGGGGGTGGGAGGG - Intergenic
1174506644 20:51021851-51021873 GGTGATGGGGTAGGGTGGGGAGG - Intronic
1174570886 20:51500647-51500669 GGTGGGGGTGGAGGGGGGGGTGG - Intronic
1174570894 20:51500659-51500681 GGTGGTGGTGAGGGTGGGGGTGG - Intronic
1174570926 20:51500747-51500769 GGTGGTGGTGAGGGTGGGGGTGG - Intronic
1174682487 20:52422075-52422097 GCTGGAGGTGGGGGGTGGGAAGG + Intergenic
1174740306 20:53006820-53006842 GGTGGTGGGGTAGGGTGCTATGG + Intronic
1174858347 20:54067769-54067791 GGTGGTTTTGAAGGGTGGAATGG + Intronic
1174913335 20:54630207-54630229 GGTGGTGGTGATGGAGGTGAGGG + Intronic
1175199786 20:57268896-57268918 TGAGGTGATGGAGGGTGGGAAGG + Intergenic
1175239633 20:57537380-57537402 GGAGGTGGTGAAGCATGGGAGGG + Intergenic
1175245711 20:57580799-57580821 GGTGGCCATGAAGGGTGGAATGG - Intergenic
1175249098 20:57598174-57598196 GGGGGTGGGGAAAGGGGGGAGGG - Intergenic
1175277388 20:57781420-57781442 GGTGGTGGTGAAGATGGTGATGG + Intergenic
1175278578 20:57788012-57788034 GGAGGGGATGGAGGGTGGGATGG + Intergenic
1175298831 20:57928582-57928604 GGAGGAGGAGAAGGGTGGGGGGG - Intergenic
1175319982 20:58078678-58078700 GGTGGTGGTGATGGTTGGGTGGG - Intergenic
1175501845 20:59456342-59456364 GGTGGTGGAGAAGGGTGCTGGGG - Intergenic
1175638150 20:60602680-60602702 GCTGGGGGTGAAGGGGGGCAAGG + Intergenic
1175712954 20:61235637-61235659 GGCGGTGGCGGAGGCTGGGAAGG - Intergenic
1175762626 20:61571758-61571780 AGGGGTGGGGAAGGGTGGGAAGG - Intronic
1175863032 20:62160257-62160279 GGGGGTGGGGAGAGGTGGGATGG + Intronic
1175873121 20:62217639-62217661 GCTGGTGGGGGAGGGTGGCAGGG - Intronic
1175909484 20:62397928-62397950 GGTGGTGGTGATGGTGGTGACGG + Intronic
1175909562 20:62398278-62398300 GGTGGTGGTGATGGTGGCGATGG + Intronic
1175930319 20:62490726-62490748 GGTGAGGGTGAGGGGTGGGCAGG - Intergenic
1176118306 20:63442887-63442909 GGTGGTGGTGATGGTGGTGATGG - Intronic
1176118395 20:63443331-63443353 GGTGGTGGTGATGGTGGTGATGG - Intronic
1176131997 20:63500151-63500173 GGTGGGGGGGCAGCGTGGGAGGG - Intergenic
1176299219 21:5090740-5090762 GCTGGGGCTGGAGGGTGGGAGGG + Intergenic
1176426231 21:6550092-6550114 GGAGGTGAGGAAGGGAGGGAGGG - Intergenic
1176550536 21:8219056-8219078 GGTGGTGGGGGTGGGGGGGAGGG + Intergenic
1176577378 21:8446326-8446348 GGTGGTGGGGGTGGGGGGGAGGG + Intergenic
1176620604 21:9055968-9055990 GGTGGTGGTGGTTGGTGGGAAGG + Intergenic
1177067336 21:16456313-16456335 TGTGGAGGTTGAGGGTGGGAGGG - Intergenic
1177154264 21:17485631-17485653 GGTGACGGTGAGGAGTGGGAAGG - Intergenic
1177780289 21:25614965-25614987 GATGGTGGGGAGGGGAGGGAAGG - Intergenic
1177995307 21:28089695-28089717 GGAGGTGGTGGAGGGTGCAATGG + Intergenic
1178171780 21:30049339-30049361 TGAGTTGGTCAAGGGTGGGATGG + Intergenic
1178287050 21:31334650-31334672 GGGGGCTGTGAAGGGAGGGATGG - Intronic
1178340969 21:31785138-31785160 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1178340981 21:31785189-31785211 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1178341001 21:31785276-31785298 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1178540093 21:33442226-33442248 AGTGGCAGTGAAGGGTGGGGAGG - Intronic
1179017976 21:37610179-37610201 GATGGTGGTGTAGGTTGGAATGG + Exonic
1179419275 21:41222769-41222791 GGAGGAGGTGAGGGGTGGGCCGG + Intronic
1179568010 21:42261189-42261211 GGGGGTGGTGGAGAGGGGGAAGG - Intronic
1179590215 21:42403213-42403235 GGGGGTGGTGGTGGGTGGGGTGG - Intergenic
1179701722 21:43158409-43158431 GGAGGTGAGGAAGGGAGGGAGGG - Intergenic
1179710957 21:43262685-43262707 GGTGGTGGTGGTGGGAGTGAAGG + Intergenic
1179710968 21:43262727-43262749 GGTGGTGGTGGTGGGAGTGAAGG + Intergenic
1179724779 21:43336072-43336094 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179724812 21:43336225-43336247 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179724828 21:43336309-43336331 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179724836 21:43336342-43336364 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179724899 21:43336624-43336646 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179724907 21:43336657-43336679 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179724983 21:43336996-43337018 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179725089 21:43337545-43337567 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1179835082 21:44026008-44026030 GGTGGTGCAGAACTGTGGGAGGG + Intronic
1179857807 21:44171207-44171229 GCTGGGGCTGGAGGGTGGGAGGG - Intergenic
1179905357 21:44419820-44419842 GGTGGTGGTGATGGTGGTGATGG + Intronic
1179953459 21:44724437-44724459 GGTGGTGGGGCCAGGTGGGAAGG + Intergenic
1179999264 21:44987720-44987742 AGGGGTGGTGAGGAGTGGGAGGG - Intergenic
1180041649 21:45283273-45283295 GGTGGTGGGGAGGAGTGGGCGGG + Intronic
1180094529 21:45549807-45549829 GGGGGTGGTGGACGGTGGGGAGG + Intergenic
1180161941 21:46002094-46002116 GGTCGGGGCGAGGGGTGGGAGGG - Intronic
1180176151 21:46090944-46090966 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1180176156 21:46090965-46090987 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1180176206 21:46091190-46091212 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1180614602 22:17119494-17119516 GGAGGTGGTGGAGGGGCGGAGGG + Exonic
1180746216 22:18090775-18090797 GGTGGGGGAGAGGGGTGGAATGG + Exonic
1181034472 22:20163284-20163306 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1181184826 22:21095483-21095505 GGTTGTGGTGAAGGGTGCACCGG + Intergenic
1181220807 22:21363804-21363826 GGTGTTGGTGAGGGGTGGACAGG + Intergenic
1181387728 22:22557921-22557943 GGGGGTGGGGAAGGGGGGGCGGG + Intronic
1181495845 22:23287079-23287101 GGTGGTGGGGATGGATGGAATGG + Intronic
1181509131 22:23381162-23381184 GGTGATGGTGATGGTGGGGATGG + Intergenic
1181601274 22:23953222-23953244 GGTGGTGGTGCAGGGTTGCGGGG + Intergenic
1181607237 22:23988115-23988137 GGTGGTGGTGCAGGGTTGGTGGG - Intergenic
1181876820 22:25946055-25946077 GGAGGTGGGGAGGGGAGGGAAGG - Intronic
1182008940 22:26984404-26984426 GGTGGTCTTGAAGGTTGAGAGGG + Intergenic
1182297010 22:29315763-29315785 GGCGGTGGGGGAAGGTGGGAGGG - Intronic
1182652265 22:31861595-31861617 TGTGGCGGCGAAGGGGGGGATGG + Intronic
1182686287 22:32123282-32123304 GGTGCTGGTGATGGGGGGCAGGG + Intergenic
1182720023 22:32390119-32390141 GGTGGTAAGGAAAGGTGGGAAGG - Intronic
1182829634 22:33294573-33294595 GGAGGTGGGGAAGGGAGGTACGG - Intronic
1182885922 22:33774078-33774100 GGTGGGGGTGGAGGGGCGGATGG + Intronic
1183082047 22:35462987-35463009 GGTGGAGGAGAAGGGAAGGAGGG - Intergenic
1183244095 22:36680267-36680289 GGTGGTGGTGATGGTGGTGATGG - Intronic
1183365931 22:37406793-37406815 GGTGGTGGTGCAGGGGGACAGGG + Intronic
1183378158 22:37477045-37477067 GTTGGGGGTGAAGGGTGGCCTGG - Intronic
1183587550 22:38761495-38761517 GTTGATGCTGAAGGGAGGGACGG + Intronic
1183721628 22:39566121-39566143 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1183721647 22:39566193-39566215 GGTGGTGGTGATGGTGGGGGTGG + Intergenic
1183750880 22:39719661-39719683 TGTGGCGGTGAAGTGTGTGATGG + Intergenic
1183786535 22:40032169-40032191 GGTGGTGGTGTGGGGTGGGAGGG - Exonic
1183951870 22:41356945-41356967 GGTGGTGGGGAAGGGTGGATGGG + Intronic
1184131291 22:42518262-42518284 GGGGTTGGTGAAGGGATGGATGG - Intronic
1184141513 22:42580474-42580496 GGGGTTGGTGAAGGGATGGATGG - Intergenic
1184210869 22:43034920-43034942 GGGGGAGGGGAGGGGTGGGAAGG + Intergenic
1184241606 22:43214044-43214066 GGTGGGGGTGGGGGGTGGGCGGG - Intronic
1184290369 22:43495583-43495605 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290396 22:43495685-43495707 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290423 22:43495778-43495800 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290487 22:43496006-43496028 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290496 22:43496036-43496058 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290521 22:43496123-43496145 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290530 22:43496153-43496175 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184290598 22:43496393-43496415 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184291234 22:43499090-43499112 GGTGGTGGTGGAGGTGGTGATGG + Intronic
1184291282 22:43499277-43499299 GGGGGTGGTGATGGATGTGATGG + Intronic
1184291307 22:43499380-43499402 GGGGGTGGTGATGGATGTGATGG + Intronic
1184291381 22:43499643-43499665 GGTGGTGGTGATGGGGGTGGCGG + Intronic
1184291386 22:43499658-43499680 GGTGGCGGTGATGGGGGTGATGG + Intronic
1184291605 22:43500429-43500451 GGTGGTGGTGGAGGTGGTGACGG + Intronic
1184369819 22:44075157-44075179 GCAGGTGGTGAAGGAAGGGAAGG + Intronic
1184502862 22:44884398-44884420 GGTGGTGGTGATGGTGGTGATGG - Intronic
1184502874 22:44884464-44884486 GGTGGTGGTGATGGTGGTGATGG - Intronic
1184528541 22:45040088-45040110 GGTGGAGGTGAGGGGTTAGAGGG - Intergenic
1184584756 22:45440406-45440428 CATGGTGGTGAGGGGTGGGGTGG + Intergenic
1184636114 22:45833234-45833256 GTCGGTGGTCAAGGGTGGGGAGG - Intronic
1184747431 22:46464525-46464547 GGTGGTGGTCATGGGGGGCAGGG - Intronic
1184754484 22:46508333-46508355 GATGGGGGTGGAGGGTGGGATGG + Intronic
1184927627 22:47654588-47654610 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1185039739 22:48497904-48497926 GGCGGGGCTGAAGGGTGGGGTGG + Intronic
1185188057 22:49414866-49414888 GTTGGTGCTTAAAGGTGGGAGGG + Intronic
1185325720 22:50225056-50225078 GGGGGTGGGGGAGGGTGGGCGGG - Intronic
1185386308 22:50532619-50532641 GGTGGTGGGGAAGGGGGAGGCGG - Intergenic
949204666 3:1423657-1423679 GCTGGGGGTGGGGGGTGGGAAGG + Intergenic
949667616 3:6358646-6358668 GGTGGAGGAGAAAGGTGGGGAGG - Intergenic
949810684 3:8003349-8003371 GATGGTGGTGATGGGAGTGAGGG - Intergenic
950199720 3:11034500-11034522 GGTGGAGGGGAGGGGAGGGAGGG - Intronic
950404694 3:12797168-12797190 GGTGGTGGGGGCGGGGGGGAGGG - Intronic
950424413 3:12917018-12917040 GCAGGTGGGGCAGGGTGGGAAGG + Intronic
950508526 3:13411545-13411567 GGGGGTGGTGACAGGGGGGATGG - Intronic
950522510 3:13505350-13505372 TGTGGGGGTGAAGGTGGGGAAGG + Exonic
950533631 3:13567192-13567214 GGTGGTGGGGCAGGGTGGGCTGG + Intronic
950616818 3:14166500-14166522 GGTGGGGGTGAAGGGAGGGTGGG - Intronic
950630406 3:14278442-14278464 GGTTGTGGTGAAATGTGGGATGG - Intergenic
950960846 3:17105197-17105219 GGTGTTGGGGAAGGTGGGGATGG + Intergenic
951317232 3:21203012-21203034 GGTGGTGGTGTTGGCTGTGATGG + Intergenic
951472021 3:23066782-23066804 GGTGGTGATTCAGGGTAGGATGG - Intergenic
951478728 3:23136314-23136336 GGTGGTAGTGATGGGTGTTAGGG - Intergenic
951889613 3:27556136-27556158 AGAGGTGGTGGGGGGTGGGAGGG - Intergenic
952184313 3:30952448-30952470 GTTGGTGGTGAGGGCTGGTATGG + Intergenic
952184955 3:30958544-30958566 TGTGGAGATGAAGGGAGGGAGGG - Intergenic
952269703 3:31818871-31818893 GGTGGTGGTGGAGTGGGGGGAGG - Intronic
952810192 3:37395655-37395677 GGTGGTTGTGAAGGCTGGGGTGG - Intronic
953139159 3:40211443-40211465 GATGGTTATGGAGGGTGGGATGG - Intronic
953166598 3:40470369-40470391 GGTGGTGGTGGTGGGAGGGGCGG - Intergenic
953353050 3:42230333-42230355 GGGGGTGGTGGAGGGGGGAAAGG + Intergenic
953409800 3:42684321-42684343 GGTGGTGGGGCGGGGTGGGGAGG + Intergenic
953464717 3:43109487-43109509 GGTGATGGTAAAGATTGGGATGG + Intergenic
953495760 3:43385756-43385778 GATGGGGGGGAAGGATGGGAGGG + Intronic
953642120 3:44718349-44718371 CGTAGTGGTGAGGAGTGGGAGGG - Intronic
953674767 3:44992275-44992297 GGTGGTGGTGATGGTGGTGAGGG + Intronic
953786479 3:45915350-45915372 GGTGAGGGAGAAGGGTGGGGCGG - Intronic
953902857 3:46853009-46853031 GCTGGTAGAGAGGGGTGGGAGGG - Intergenic
953905426 3:46866105-46866127 GTTGGGGGTGGAGGGAGGGAGGG + Intronic
954579543 3:51695828-51695850 GGTGTTGGTGCAGGGTGGGGTGG + Intronic
954665190 3:52247810-52247832 GAGGGTGGGCAAGGGTGGGATGG + Intronic
954690065 3:52391060-52391082 GGTGGTGGTGCCTGGTGGGTGGG - Intronic
954800022 3:53181629-53181651 GGTGGTGGTGCAGGGTAGTGGGG + Intronic
954925634 3:54231864-54231886 GGTCCTGGGGCAGGGTGGGAGGG + Intronic
954980505 3:54741138-54741160 GGTGGGGGTGGATGGCGGGAAGG + Intronic
955029061 3:55199036-55199058 GGTGGAGGTGAAGGATGTGAAGG + Intergenic
955070335 3:55567583-55567605 GTGGGTGGTGAATGGTGAGATGG + Intronic
955114566 3:55984577-55984599 GGCGGTAGGGAAGGGTGGGATGG - Intronic
955201581 3:56856535-56856557 GGTGGTGGGGAAGGGGGAGGGGG - Intronic
955330259 3:58041515-58041537 GGTGGTGGTGGTTGGTGGGGAGG - Intronic
955417244 3:58703993-58704015 GGTGGTGGTGATGATTGTGATGG - Intergenic
955503099 3:59604628-59604650 GGTGGGGGTGAGGGTGGGGAAGG - Intergenic
955579811 3:60406677-60406699 GGGGGTGGTGTGGGGTGGGGTGG + Intronic
955813633 3:62819019-62819041 GGTGGTGGAGGTGGGTGGGCAGG + Intronic
956035332 3:65084661-65084683 GGTGGGGGTGGGGGGTGGGGTGG - Intergenic
956143158 3:66165918-66165940 GGTGGTGGGGAGAGGTGGGGTGG - Intronic
956165191 3:66393040-66393062 GGTGATGGTGAAGGTAGGGGTGG + Intronic
956752996 3:72359745-72359767 AGTGGAGGTGAATGGTGGGGAGG + Intergenic
956832709 3:73069282-73069304 GGTGGTGGCGCAGGGTCGGGGGG - Intergenic
957181055 3:76877906-76877928 GGTGGAGGAGAAGGGAGAGAAGG + Intronic
957198787 3:77105405-77105427 GGTGGTGATGGTGGGTGGTAGGG + Intronic
958183050 3:90084334-90084356 GGCTGTGGTGAAGGGTGCAAAGG - Intergenic
958192018 3:90195807-90195829 GGTGGTGGGGAGAGGGGGGAGGG - Intergenic
958734074 3:97989275-97989297 GGTGGTGGTGGATGTGGGGATGG + Intronic
958853628 3:99358303-99358325 TGTGTTGATGAAGGGAGGGAAGG + Intergenic
958924611 3:100144448-100144470 GGTGGTGGTGAAGTTGGGGATGG + Intronic
959551035 3:107657685-107657707 GGGGGAGGTGAAGTTTGGGATGG + Intronic
959595210 3:108122101-108122123 GGTGGTGGGGAAGGGGAGGCTGG + Intergenic
959999512 3:112715885-112715907 AGTTGTGATGAGGGGTGGGAGGG + Intergenic
960209175 3:114938672-114938694 GGTGGTGGGGAAGTAGGGGAGGG + Intronic
960289254 3:115863412-115863434 GGTGGTGGTGGAGGGGTGGGAGG + Intronic
960384618 3:117007162-117007184 TGTGGGGGTGGAGGGAGGGAGGG - Intronic
960586570 3:119325656-119325678 GTTGGGGGGGAAGGGGGGGACGG + Intronic
960852553 3:122071284-122071306 GGGGTTGGGGAGGGGTGGGAAGG - Intronic
960960169 3:123065064-123065086 GGATGTGGTGAGGGGTTGGATGG + Intergenic
961055655 3:123786525-123786547 GGTGGGGGAGGAGGGGGGGATGG + Intronic
961093430 3:124135368-124135390 GCTTGTGGGGAAGAGTGGGAGGG + Intronic
961223817 3:125220948-125220970 GGTAGTAGTAAAGGGAGGGAGGG + Intergenic
961390241 3:126548363-126548385 GGGTGTGGTGAAGTGGGGGAAGG + Intronic
961393527 3:126570551-126570573 GGTGGAGGACAAGGGTCGGAAGG + Intergenic
961476210 3:127147803-127147825 GGTGATGGTGAAGAGTGGAGTGG - Intergenic
961656625 3:128445950-128445972 GGTGGTGGTGATGGCGGCGATGG + Intergenic
961668692 3:128510662-128510684 GGGAATGGTGAAGGGTGGGCAGG - Intergenic
961718561 3:128876080-128876102 GATGGTGGTGTAAGGTGGAAGGG + Intergenic
961807792 3:129501734-129501756 GTTGGGTGTGATGGGTGGGAAGG + Intronic
961924303 3:130460926-130460948 GGTGGTGGTGATGGCTGTGGTGG + Intronic
962077369 3:132096845-132096867 GGTGGAGGTGGAGGGAGGGTGGG + Intronic
962630353 3:137269552-137269574 GGTGGTGGTGATGGGGGTGGAGG + Intergenic
962698681 3:137975807-137975829 GGTGGGGGTCAATGGTGAGAGGG - Intergenic
963041739 3:141075199-141075221 GGTGATGCTGATGGGTTGGAGGG + Intronic
963073010 3:141320552-141320574 GGAGCTGGGGAAGAGTGGGAGGG + Intergenic
963133147 3:141876684-141876706 GACGGCAGTGAAGGGTGGGACGG - Exonic
963867693 3:150379868-150379890 GGTGGTGGTGAGGTGGGGGTTGG - Intergenic
964051238 3:152396318-152396340 GGTGGTGGTGGAGTGGCGGATGG - Intronic
964319448 3:155479592-155479614 TGTGGTGGTGGGTGGTGGGAGGG - Intronic
964485963 3:157185666-157185688 GGTGGGGGTGGAAGGAGGGAGGG - Intergenic
964729221 3:159847148-159847170 GGTGGTGATGGGGGGTGGGAAGG + Intronic
964790166 3:160446683-160446705 GGTGGGGGCGCAGGGTGGGTAGG - Intronic
965421037 3:168458416-168458438 GGAAGTGGGGAAGGGAGGGAAGG - Intergenic
966020787 3:175206550-175206572 CTTGGTGGGGAAGAGTGGGAGGG + Intronic
966091031 3:176136554-176136576 CTTGGGGGTGGAGGGTGGGAAGG - Intergenic
966126279 3:176580471-176580493 GGAGGTGATGGAGGGTGGAAGGG + Intergenic
966170490 3:177074670-177074692 GGTGGCGGTGAGGGTTGGGGAGG - Intronic
966183411 3:177207224-177207246 GGTGATGGTGGATGGTGAGAGGG - Intergenic
966221829 3:177558938-177558960 ACTCGTGGGGAAGGGTGGGAGGG - Intergenic
966440351 3:179937997-179938019 GGTGGTGGTGGAGGTAGAGATGG - Intronic
966769865 3:183494162-183494184 GATGGTGGTGTTGGGTGGCAAGG - Exonic
966942584 3:184756298-184756320 GCTGGAGGTGGAGGGTGGGGTGG - Intergenic
967350343 3:188507680-188507702 GGAGGTGGGGAAGGCAGGGAAGG + Intronic
967757984 3:193191778-193191800 GGTGGTGGTGTATGTTGGGAGGG + Intergenic
967773471 3:193359828-193359850 GGTGGTGGTGCAGGGGGGCTGGG + Intronic
967943556 3:194784694-194784716 GAGGGTGGGGAAGGGTGGGAAGG - Intergenic
968067628 3:195767618-195767640 GGTGGTGGTGATGGTGGTGATGG - Intronic
968067688 3:195767853-195767875 GGTGGTGGTGTTGGGGGTGATGG - Intronic
968067695 3:195767874-195767896 GGTGGTGGTGATGGTGGTGATGG - Intronic
968074740 3:195810118-195810140 GGGGGTGCTGGAGGGTGGGGAGG + Intronic
968107890 3:196015298-196015320 GGGGGTGGGGAAGGGAGGGTGGG - Intergenic
968292672 3:197550741-197550763 GGTGGAGGTGGAGGGAGGGAGGG + Intronic
968661817 4:1801786-1801808 GGTGGTGGTGAGGGAGGGGGTGG + Intronic
968663572 4:1809091-1809113 GGTGGTGGTGGTGGTGGGGAGGG + Intergenic
968797340 4:2716354-2716376 GTTGGCGGGGAAGGGTGGGGGGG - Intronic
969087430 4:4666872-4666894 GGGGGAGGTGAAAGGGGGGATGG + Intergenic
969208789 4:5670475-5670497 GGTGATGGTGATGGTGGGGATGG - Intronic
969280828 4:6169949-6169971 GGTGGTGGTGATGAGAGTGATGG - Intronic
969336134 4:6511587-6511609 GGTGGTGGTGATGGGGGTGGTGG + Intronic
969336151 4:6511656-6511678 GGTGGTGGTGATGGTGGTGATGG + Intronic
969336267 4:6512103-6512125 GGTGGTGGTGATGGTGGGGGTGG + Intronic
969336297 4:6512223-6512245 GGTGGTGGTGATGGTGGGGGTGG + Intronic
969336309 4:6512259-6512281 GGTGGTGGTGATGGTGGGGGTGG + Intronic
969336349 4:6512409-6512431 GGTGGTGGTGATGGTGGGGGTGG + Intronic
969347565 4:6579039-6579061 GGTGGTGGTGATGGTGGTGATGG - Intronic
969347615 4:6579244-6579266 GGTGGTGGTGATGGTGGTGAAGG - Intronic
969502718 4:7563136-7563158 GCTGGGGGTGAAGGGTGAGATGG + Intronic
969529767 4:7724153-7724175 GGTGGTGGTGATGGTGGTGATGG + Intronic
969548548 4:7848446-7848468 GGAGGTGGGGAAGTGCGGGAGGG + Intronic
969633322 4:8351100-8351122 GGACGTGGGGAAGGGTGGGGAGG + Intergenic
970170098 4:13280827-13280849 GGTGGTGCTGGAGGGTGGGAGGG - Intergenic
970673423 4:18421111-18421133 TGTGGTGGTGATGGCTAGGAGGG + Intergenic
970715460 4:18916781-18916803 GGTGGAGGTGAAGGGGGAGCAGG - Intergenic
970932670 4:21531327-21531349 GGGGGAGGGGAAGGGAGGGAGGG - Intronic
972188534 4:36562777-36562799 GATTGTGGGGGAGGGTGGGATGG - Intergenic
972453624 4:39230350-39230372 GGTGGTGGGGAAGTCGGGGAAGG - Intronic
972740331 4:41881620-41881642 GGGGGTGGGGAAGGGAGAGAAGG + Intergenic
972778663 4:42266268-42266290 GGTGGGGGGGAAGGTTGGGAGGG - Intergenic
972807023 4:42539252-42539274 GGGGGAGAGGAAGGGTGGGAGGG + Intronic
972873495 4:43329244-43329266 GGGGGTGGGGGAGGATGGGAGGG + Intergenic
973745149 4:53956766-53956788 GGGGGTGGGGAAGGGGAGGAAGG + Intronic
973876651 4:55226817-55226839 GGTGGGGGTGACAGGTGGCATGG - Intergenic
974385528 4:61199975-61199997 GGAGGTGATGGAGAGTGGGAGGG + Intergenic
974385943 4:61201919-61201941 GGTCGTGGTGCGGGGCGGGAAGG + Intronic
974412656 4:61562300-61562322 GGTGGTGGTGAAGGCTGGAACGG + Intronic
974833416 4:67216467-67216489 GGGGGAGGGGAAGGGAGGGAAGG + Intergenic
974876329 4:67707632-67707654 GGGGGTGGGGTAGGTTGGGATGG + Intergenic
975162087 4:71135736-71135758 GGTGGTTGTCAGGGGTGGGGTGG - Intergenic
975631199 4:76404209-76404231 GGTAGTGGTGTTGGGTGGGAAGG - Intronic
975821027 4:78270544-78270566 GGTGGTGGTGGCGGGGGGGCGGG - Intronic
975822895 4:78289823-78289845 TGTGGTGGGGAAGGTGGGGAGGG - Intronic
976117986 4:81748763-81748785 GGTGGGGGTGGAGGTGGGGAAGG - Intronic
976688107 4:87838335-87838357 GGTGGGGGAGTAGGGAGGGATGG - Intronic
977567940 4:98600262-98600284 GGTGGCGCTGAAGGTTGGGGTGG + Intronic
977806840 4:101309484-101309506 GGGGGTGGTAGAGGGTGGGGAGG + Intronic
977963387 4:103111383-103111405 GGAGGTGAGGTAGGGTGGGAGGG + Intronic
978110946 4:104963610-104963632 GGTGGTGGTGATGGGCTGGGTGG + Intergenic
978125686 4:105132449-105132471 GGGGTTGCTGAAGGGTGGGGTGG + Intergenic
978174187 4:105709103-105709125 GATGCGGGGGAAGGGTGGGAAGG + Exonic
978376356 4:108078496-108078518 GGTGGTGGTCTGGGGTGAGAGGG - Intronic
978576605 4:110196427-110196449 GGTGGTGCTGGAGGCGGGGAGGG - Intronic
978617859 4:110613876-110613898 GGGGGCAGGGAAGGGTGGGAGGG + Intergenic
979013265 4:115397567-115397589 GGTGGTGGGGCAGGGGTGGAGGG - Intergenic
979177161 4:117679386-117679408 TGTGGTGGGGAAGTGTGGAAGGG + Intergenic
979357439 4:119721614-119721636 ACTCGTGGGGAAGGGTGGGAGGG + Intergenic
979688299 4:123535540-123535562 GGATGTGGAGCAGGGTGGGAGGG + Intergenic
980017539 4:127669710-127669732 GGAGATTTTGAAGGGTGGGAGGG - Intronic
980024194 4:127745699-127745721 GGTGGTGGGGCAGGGTGAGGGGG + Intronic
980941396 4:139278924-139278946 GTTGGTGGTGGTGGGAGGGAAGG - Intronic
981010277 4:139918320-139918342 TGTGGTGGTGAAGGGGAGAAGGG - Intronic
981077370 4:140604630-140604652 TGTGGTGGTGTTGGGTGGGTGGG + Intergenic
981449921 4:144885150-144885172 GGTGGGGGGTAAGGGTGGGTTGG - Intergenic
981535610 4:145796414-145796436 GTTGGTGGGGAAGGGTGGAAGGG + Intronic
981552866 4:145959445-145959467 GGTGGTGGTGGTGGGTGGATGGG + Intergenic
981627637 4:146777009-146777031 GGCGGTGGTGCAGGGAGGGGTGG + Intronic
981760742 4:148192377-148192399 GGAGGTGGTGAAGGGTGCAATGG + Intronic
982221546 4:153129523-153129545 GGTGGTGGTGATGGTGGTGATGG - Intergenic
982221551 4:153129544-153129566 GGTGGTGGTGATGGTGGTGATGG - Intergenic
982221619 4:153129807-153129829 GGTGGTGGTGATGGTGGTGATGG - Intergenic
982221669 4:153130012-153130034 GGTGGTGGTGATGGTGGTGATGG - Intergenic
982221683 4:153130083-153130105 GGTGGTGGTGATGGTGGTGATGG - Intergenic
982221697 4:153130154-153130176 GGTGGTGGTGATGGTGGTGATGG - Intergenic
982510321 4:156274718-156274740 GGTTGTGGTTGGGGGTGGGATGG + Intergenic
982746801 4:159112218-159112240 GTTGGTGGTAAAAGGTGAGATGG + Intronic
983099776 4:163610827-163610849 GGTTGTGGTGAATAGGGGGATGG - Intronic
983144466 4:164196809-164196831 GGGGGTTGTGGAGGGAGGGAGGG - Intronic
983221521 4:165048414-165048436 GGTGGTCATTAAGTGTGGGAGGG - Intergenic
983554910 4:169051334-169051356 TGTTTTGGTGCAGGGTGGGAAGG - Intergenic
983595052 4:169457064-169457086 GGTGGTGGTGGTGGGTGGTGGGG + Intronic
983663711 4:170158439-170158461 GATGGTGGGGAAGGGTGGGAGGG - Intergenic
983855735 4:172641639-172641661 GGTGGTGGGATAGGGTGGGCAGG - Intronic
984084229 4:175288382-175288404 GGTGGTTCTGAAGGTTGGGGTGG + Intergenic
984377590 4:178953311-178953333 GGTGGTGGTGATGGGGGTGGTGG - Intergenic
984377642 4:178953509-178953531 GGTGGTGGTGATGGTGGTGATGG - Intergenic
984377686 4:178953682-178953704 GGTGGTGGTGATGGTGGTGATGG - Intergenic
984377742 4:178953916-178953938 GGTGGTGGTGATGGTGGCGATGG - Intergenic
984768754 4:183419674-183419696 GGTGGAGGTGAAGGAAGAGAGGG - Intergenic
984839378 4:184053673-184053695 CGTGGTGCTGAAGGGGGGGTTGG - Intergenic
984931471 4:184851263-184851285 TGTGCTGGTGAAGGGTGGATGGG + Intergenic
984992809 4:185397058-185397080 GCTGGTTGTGAAGGGCGGGGAGG + Intronic
985295462 4:188432779-188432801 GGTGGTGGTGTAGATTGGGACGG + Intergenic
985451986 4:190067645-190067667 GGTGGTGGTGGGGGGGGGGGGGG - Intergenic
985451989 4:190067648-190067670 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985452972 4:190070939-190070961 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985453961 4:190074232-190074254 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985454949 4:190077525-190077547 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985455937 4:190080822-190080844 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985456920 4:190084116-190084138 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985457908 4:190087412-190087434 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985458896 4:190090709-190090731 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985463146 4:190173468-190173490 GGTGGTGGTGGGGGGGGGGGTGG - Intergenic
985463147 4:190173471-190173493 GGTGGTGGTGGTGGGGGGGGGGG - Intergenic
985469828 5:33365-33387 GGGGGTGGGGAAGGGAGGGTGGG - Intergenic
985511931 5:318163-318185 GGGGGAGATGCAGGGTGGGAGGG - Intronic
985523459 5:389903-389925 GGGGGAGGGGAAGGGAGGGAGGG + Intronic
985523474 5:389929-389951 GGGGGAGGGGAAGGGAGGGAGGG + Intronic
985606408 5:860477-860499 GGTGGTGGAGGAGGGTGTGCAGG - Intronic
985648213 5:1095077-1095099 GGAGGTGGTGAGGTGTGGAAGGG + Intronic
985776802 5:1848559-1848581 GGTGGTGGGGGAGGCTGGGTGGG + Intergenic
985978896 5:3446181-3446203 GGTGGTGGTGATGGTGGTGATGG + Intergenic
985978980 5:3446787-3446809 GGTGGTGGTGATGGTGGTGAAGG + Intergenic
985978981 5:3446796-3446818 GATGGTGGTGAAGGTTATGATGG + Intergenic
986424006 5:7612645-7612667 GATGGGAGTGAAGGGTGAGAAGG + Intronic
986672575 5:10156068-10156090 GGTGGTGGCCAAAGGTTGGATGG + Intergenic
986950697 5:13080896-13080918 AGTGCTGGTGGAGGTTGGGAGGG - Intergenic
988459432 5:31419566-31419588 GGTGGGGGAGTGGGGTGGGAGGG + Intronic
988696378 5:33626364-33626386 GGTGGTGGTGATGGGGGTGATGG + Intronic
988853927 5:35208123-35208145 GGTGGTGGTCAAGTGTGAGCAGG - Intronic
988976451 5:36521254-36521276 GGTGGTGGTGGAGGTGGTGATGG + Intergenic
989291288 5:39769355-39769377 GGTGGTGGCAGAGGGAGGGATGG + Intergenic
989453368 5:41612970-41612992 GGTGCTGGTGAAGTATGGGTGGG - Intergenic
989494113 5:42091170-42091192 GGTGGTGGTGATGGGTGGCAGGG - Intergenic
990008110 5:50966052-50966074 GATGGAGGTGAAGGTGGGGATGG - Intergenic
990312465 5:54553048-54553070 GGAGTGGGAGAAGGGTGGGAGGG + Intergenic
990542680 5:56790244-56790266 CTTAGTGGAGAAGGGTGGGAAGG + Intergenic
990805283 5:59653881-59653903 GGGAGAGGAGAAGGGTGGGAGGG + Intronic
990835655 5:60016394-60016416 GGGGGTTGTGAAGGTTGGGGTGG + Intronic
990974321 5:61544340-61544362 GGGGGTGGGGATGGGAGGGATGG + Exonic
991118217 5:62979177-62979199 GGTGATGGTGAAGGAAGAGAAGG + Intergenic
991289559 5:65019661-65019683 GGTGGTAGTGGTGGGTGGCATGG - Intergenic
991490423 5:67177575-67177597 GGTGGTGGTGGAGAATGGAAGGG - Intergenic
991632523 5:68670682-68670704 GGTGATGGTGATGGGTGTCATGG + Intergenic
991915037 5:71597254-71597276 GGTTGTGGTGGAGGGAGTGAGGG + Intronic
992095567 5:73359452-73359474 GGTGAGGGTGAAGCGTGAGAGGG - Intergenic
992546493 5:77818850-77818872 GATGGTAGAGAATGGTGGGATGG + Intronic
992636340 5:78729001-78729023 GGTGGTAGGGCAGGCTGGGAGGG + Intronic
992639328 5:78755246-78755268 GGTGTTGGGGGAAGGTGGGAGGG - Intronic
993264688 5:85709896-85709918 GGCAGTGGTGATGGGTGGGTGGG - Intergenic
993563646 5:89444961-89444983 GGTGGTGGTGGAGGTTGGTGGGG - Intergenic
993592936 5:89818000-89818022 GGTGCAGGAGAAGGGTGGGAAGG - Intergenic
993807743 5:92433484-92433506 TGTGGTGGTGGTGGGTGGGTGGG - Intergenic
993892508 5:93490904-93490926 GGTGGTGGTGATGGGAGTGGTGG + Intergenic
993993620 5:94691386-94691408 GGCGGGGGTGGGGGGTGGGAAGG - Intronic
994267997 5:97740147-97740169 GGAGGTGGTGATGGTTGGGAGGG + Intergenic
994817225 5:104599350-104599372 GGAGGTTGAGAAGGGTGAGAAGG - Intergenic
994871945 5:105362543-105362565 GGTGGTTGTGGTGGGTTGGATGG - Intergenic
995022031 5:107377837-107377859 GCTGGTGGAGAAGGGAGGGTGGG + Exonic
995188736 5:109298486-109298508 GGTGGTGGTGGTGGGCGGGGGGG - Intergenic
995341935 5:111070414-111070436 GGCGGGGGTGAGGGGTGCGATGG + Intronic
995492396 5:112707090-112707112 GGTGGTAGTGAGAGGTGGTAGGG + Intergenic
996626489 5:125576185-125576207 GGTGGAGGTGCAGGGGAGGAAGG - Intergenic
997219579 5:132149762-132149784 GTGGGTGATGAAAGGTGGGATGG - Intergenic
997285083 5:132672272-132672294 GGGGGTGGTGAGGGGGGGGCGGG + Intergenic
997373058 5:133374314-133374336 GGTGGAGCTGAAGGGAGGAAAGG + Intronic
997379270 5:133423648-133423670 GGTAGTGGTGACGGCAGGGATGG + Intronic
997613023 5:135228337-135228359 GGTGGTGGTGGAGGGGGCTAGGG + Intronic
997735779 5:136211655-136211677 GGTGGTGGTGCAGATTGGGTTGG + Intergenic
998134221 5:139666305-139666327 GATGGGGGTGAAGGGGGTGAAGG - Intronic
998166813 5:139848761-139848783 GGGGGTGGGGTAGGGTGGGAGGG + Intronic
998169791 5:139865830-139865852 GGTGGTGGGGAAGGTGGGGTGGG + Intronic
998531901 5:142892963-142892985 GGGGGTGGGGTGGGGTGGGAAGG - Intronic
998728897 5:145051272-145051294 GCTGGTGGTGAAAGTGGGGATGG + Intergenic
998774222 5:145581042-145581064 GGTGGAGGTAAATGGTAGGAAGG - Intronic
998899143 5:146833741-146833763 GGTGGGGGAGGAGGATGGGATGG - Intronic
999120105 5:149202838-149202860 GGTGATGGTGAAGGTTGTGGTGG - Intronic
999162807 5:149518793-149518815 GGTTGTGGGGGAGGGGGGGAAGG + Intronic
999244278 5:150145046-150145068 GGAGGAGTGGAAGGGTGGGAAGG - Intronic
999268807 5:150284488-150284510 GGTGGGGAGGAAGGGAGGGAGGG + Intronic
999467516 5:151821821-151821843 GGTGCTGGTGAAGGGTGAGTGGG + Intergenic
999658080 5:153829990-153830012 GGTGGGGGGGAAGGTTGGGGAGG + Intergenic
1000185281 5:158851976-158851998 GGAGGGGGAGAAGGGAGGGAAGG + Intronic
1000275227 5:159728445-159728467 GATGGTTTTGAAGGGTGGAAAGG - Intergenic
1000330486 5:160201405-160201427 GGTGGGGGGGTAGGGTGGAAGGG + Intronic
1000338459 5:160259420-160259442 GGTGGTGGGGAAGGGGTGGGAGG + Intronic
1000395110 5:160766584-160766606 ACTTGGGGTGAAGGGTGGGAGGG + Intronic
1000718707 5:164679493-164679515 GGTGGGGGTGAGGGGTGGGGAGG - Intergenic
1000779034 5:165456532-165456554 CCTGAGGGTGAAGGGTGGGAGGG - Intergenic
1000780247 5:165471452-165471474 AGTTGTGCGGAAGGGTGGGAGGG + Intergenic
1000990152 5:167903530-167903552 GGTGGGGGTGGAGGGTGGAAGGG + Intronic
1000991523 5:167916599-167916621 GCTGGGGGAGAAGGGAGGGAGGG - Intronic
1001132887 5:169079478-169079500 GGTGGGGGAGGAGGGGGGGAGGG + Intronic
1001339967 5:170834159-170834181 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1001395742 5:171418955-171418977 GGAGGGGGCGAGGGGTGGGAAGG + Intergenic
1001482591 5:172098885-172098907 GGTGGTGGTGATGGTGGTGAAGG - Intronic
1001526045 5:172429605-172429627 ACTGGTGGTGAAGGGAGGGTGGG + Intronic
1001537132 5:172506009-172506031 GGAGGTGGGGATGGGTGAGATGG - Intergenic
1001665964 5:173433964-173433986 GGTGGTGGTTAGAGGTGGGGTGG + Intergenic
1001726146 5:173902495-173902517 GGTGGTGGTGGTGGGTAGCATGG + Intronic
1001780420 5:174364081-174364103 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1001809775 5:174618789-174618811 GGGGGTGGTGAAATGGGGGAAGG + Intergenic
1001883045 5:175261588-175261610 GGTGGTGGGGAGGGGTCTGAAGG - Intergenic
1001965836 5:175909242-175909264 GCTGGAGGTGAGAGGTGGGATGG - Intergenic
1002051954 5:176576281-176576303 GCTGGTGGTGCAGGGTGTGATGG + Intronic
1002052121 5:176577103-176577125 GGGGGATGTGAAGGGTGGGTGGG + Intronic
1002054643 5:176591720-176591742 GGTGATGGTGATGGTTGTGATGG + Intronic
1002054657 5:176591803-176591825 GGTGATGGTGATGGTTGTGATGG + Intronic
1002054665 5:176591856-176591878 GGTGATGGTGATGGTTGTGATGG + Intronic
1002054673 5:176591909-176591931 GGTGATGGTGATGGTTGTGATGG + Intronic
1002251110 5:177929958-177929980 GCTGGAGGTGAGAGGTGGGATGG + Intergenic
1002277585 5:178113815-178113837 GGGGGTGGGGAGGGGTGGGGCGG + Intronic
1002371173 5:178756046-178756068 GGTGGTGGTGATGGTGGGGGTGG + Intergenic
1002371180 5:178756064-178756086 GGTGGTGGTGATGGTGGGGTGGG + Intergenic
1002473927 5:179453351-179453373 GATGATGGTGACGGGTGGGAGGG - Intergenic
1002473942 5:179453393-179453415 GATGATGGTGATGGGTGGGAGGG - Intergenic
1002473957 5:179453435-179453457 AGCGATGGTGACGGGTGGGAGGG - Intergenic
1002500998 5:179647563-179647585 GTGGGTGGGGAAGGGAGGGAAGG + Intergenic
1002661788 5:180796267-180796289 GTTGGTGGTGAATGCTGGCAGGG - Intronic
1002671175 5:180868630-180868652 GCTGGAAGAGAAGGGTGGGAAGG + Intergenic
1002810157 6:620815-620837 CGTAGAGGTTAAGGGTGGGATGG + Intronic
1002897787 6:1389499-1389521 GGTGGGGGGGGAGGGAGGGAGGG + Intergenic
1002898366 6:1391907-1391929 GAAGGCGGTGAAAGGTGGGAGGG + Intronic
1002926670 6:1609384-1609406 GGCGTTGGAGAAGGGAGGGAAGG + Intergenic
1002939658 6:1704861-1704883 GGCGGGGGTGAGGGGTGTGAGGG + Intronic
1003106711 6:3222231-3222253 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1003274916 6:4641651-4641673 GTGGTTGCTGAAGGGTGGGAAGG + Intergenic
1003595938 6:7474164-7474186 AGTGTTGGTGTGGGGTGGGAGGG + Intergenic
1003837215 6:10084746-10084768 GGTGGTGGAGGAGGGATGGATGG - Intronic
1003870411 6:10398375-10398397 GGGGCTGGTGAGGCGTGGGAGGG + Exonic
1004002241 6:11606003-11606025 GCAGGTGGGGCAGGGTGGGAGGG + Intergenic
1004036110 6:11925831-11925853 GGGGCAGGTGAAGGGTGGGTAGG - Intergenic
1004080397 6:12386770-12386792 GGTGGTGGGGGAGGGTGAGGGGG + Intergenic
1004183293 6:13399170-13399192 GGTGGTGGGGGAGGGAGGGGTGG + Intronic
1004216632 6:13710757-13710779 GGTCGCGGTGAAGGGTCCGAGGG - Intronic
1004301688 6:14464187-14464209 GGTGGTGATGGGGGGTGGGAAGG - Intergenic
1004982530 6:21042257-21042279 GGTGGTGGAGTAGGGTGGGTGGG - Intronic
1005024387 6:21448755-21448777 GGTAGGGATGGAGGGTGGGAGGG - Intergenic
1005512602 6:26524559-26524581 GGTGGTGGAGAGGAGTTGGAAGG + Intergenic
1005981736 6:30841870-30841892 GCTGGGGGTTAAGGGTGGCAGGG - Intergenic
1006301152 6:33194086-33194108 GGTGGTGGTGAAGGGGCTGGTGG - Exonic
1006303600 6:33206856-33206878 GGAGGTGGGGAAGGGTCTGAGGG - Intergenic
1006378176 6:33683333-33683355 GGTGGGGGTGACGCGGGGGAAGG - Exonic
1006592645 6:35169715-35169737 GGTAGTGGTGATGGTTGTGATGG - Intergenic
1006673612 6:35746150-35746172 GGTGGTAAGGAAGGCTGGGATGG + Intronic
1006793557 6:36718407-36718429 GGTGGAGGTGGAGTGTGAGAAGG + Intronic
1007073155 6:39050552-39050574 GGTGGTAGAGAAGGATAGGAGGG + Intronic
1007138567 6:39547543-39547565 GGTGGAGGGGAATGGTGGCAGGG - Intronic
1007219449 6:40266909-40266931 GGTGGTGGGGAAGAGTGTGGTGG + Intergenic
1007252849 6:40508125-40508147 GGTGGAGGTGAGGGCTTGGAGGG - Intronic
1007272779 6:40650893-40650915 GGTAAGGGTGAAGGGTGGCAGGG - Intergenic
1007369551 6:41417362-41417384 GGTCCTGGAGAGGGGTGGGATGG - Intergenic
1007380780 6:41488812-41488834 GGTGGTGGCGGGGGCTGGGAGGG + Intergenic
1007409405 6:41653290-41653312 GGTGGCGGTGGAGAGGGGGACGG - Intronic
1007557977 6:42782639-42782661 GGTGGTGGGGAGGGGAGGGGAGG + Intronic
1007752117 6:44076991-44077013 GGTGGTGGTGAGGCCAGGGAAGG - Intergenic
1007768117 6:44173161-44173183 GATGGAGGTGAGGGGAGGGAGGG - Intronic
1007819095 6:44547466-44547488 GGTGGGGGTGGGGGGTGGGGTGG - Intergenic
1007892701 6:45310523-45310545 GGAGGTGGTGGAGGGTGCAACGG - Intronic
1008051407 6:46903467-46903489 GGTGGTGGGGCAGGGTGGCCTGG + Intronic
1008197471 6:48542182-48542204 GTTGTTGTTGAAGGTTGGGATGG + Intergenic
1008897569 6:56575206-56575228 GTTGGGGGAGAGGGGTGGGAAGG + Intronic
1009279450 6:61728290-61728312 GGGGGTTGTGGAGGGAGGGAGGG + Intronic
1009620683 6:66072046-66072068 GGTGGTGGGGAAAGGAGGGCTGG + Intergenic
1009988669 6:70813598-70813620 TGTGGTGGGGATGGGTGAGAGGG - Intronic
1010164511 6:72899799-72899821 ACTTGGGGTGAAGGGTGGGAAGG - Intronic
1010318828 6:74483184-74483206 GAAGGAGGTGAAAGGTGGGAGGG - Intergenic
1010538645 6:77063529-77063551 GGTGGTAGTGAAAGGTGGCATGG + Intergenic
1010875171 6:81095073-81095095 GGGGGTGGGGAAGGGTGAAATGG - Intergenic
1011190521 6:84723162-84723184 GGTGGTGGTCAGGGGTTGGAAGG - Intronic
1011507818 6:88067658-88067680 GGTGGGGGTGTAGGGGGCGATGG + Intergenic
1011731522 6:90269241-90269263 GCTGGGGGTGAGGGGTGGGAAGG + Intronic
1012267688 6:97166525-97166547 GTTGGTGGTGGCGGGTGGGTTGG - Intronic
1012695454 6:102376431-102376453 GGTGTTGCTGAAGGCTGGGATGG - Intergenic
1012785039 6:103613975-103613997 GGTGAGGGAGCAGGGTGGGAGGG - Intergenic
1012922723 6:105235716-105235738 GGAGGTGGTGGAGGGTGCAATGG - Intergenic
1012976458 6:105785551-105785573 GCTGGGTGTGAAGGGTGGCAGGG - Intergenic
1013436564 6:110115906-110115928 GGTGGGGATGAAGCGTGGCAAGG + Intronic
1013836910 6:114343600-114343622 GGAGGCGGTGAAGGGTCGGGCGG + Intergenic
1015089527 6:129338956-129338978 AGTGGTGGTGAAGGCGGGGGTGG + Intronic
1015184432 6:130398118-130398140 CTTGATGGAGAAGGGTGGGAGGG - Intronic
1015325796 6:131922028-131922050 GGTGCTGGTGAGGGCAGGGAGGG + Intergenic
1015638065 6:135299472-135299494 GGTGGTGGTGATGGGATGGGAGG + Intronic
1015717426 6:136206732-136206754 GGTGGTGGGGGAGGGGGAGAAGG + Intergenic
1015877922 6:137842765-137842787 GGAGGTGGTGGAGGGTGAAATGG + Intergenic
1016188774 6:141233983-141234005 GGTGGTGGTGAGGGGTGGTGGGG - Intergenic
1016447120 6:144145781-144145803 GGTGGTTGCTAAGGGTGAGAGGG + Intergenic
1016464580 6:144313008-144313030 GTGGGTGATGGAGGGTGGGAAGG + Intronic
1016741313 6:147532285-147532307 GGAGGTGGGGGAAGGTGGGAGGG - Intronic
1016753605 6:147659782-147659804 GGTGATGGGGAGGGGTGGAATGG - Intronic
1017230628 6:152069574-152069596 TGGGGTGGTGTAGGGTGGGGTGG + Intronic
1017759366 6:157556251-157556273 GTGGGGGGTGGAGGGTGGGAAGG + Intronic
1017947926 6:159110923-159110945 GATGGTGGAGATGGTTGGGAGGG + Intergenic
1018343387 6:162876253-162876275 GGAGGAGGTCAAGAGTGGGAAGG + Intronic
1018699481 6:166415501-166415523 ACTGGTGGTGAAGGGCAGGAAGG + Intronic
1018851237 6:167641526-167641548 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1018852748 6:167653003-167653025 GGTGGTGTTGCAGGAAGGGACGG + Intergenic
1019224216 6:170496820-170496842 AGCGGTGGTGAAGAGGGGGACGG + Intergenic
1019292700 7:258218-258240 GGTGCTGGAGATGGGTGGGGTGG + Intronic
1019292721 7:258290-258312 GGTGCTGGAGATGGGTGGGATGG + Intronic
1019292769 7:258434-258456 GGTGCTGGAGATGGGTGGGATGG + Intronic
1019292781 7:258470-258492 GGTGCTGGAGATGGGTGGGATGG + Intronic
1019318329 7:401779-401801 GGGGGTGGGGAGGGGTGGGGAGG + Intergenic
1019416513 7:929635-929657 GGCGGTGGTGATGGGAGGGGTGG + Intronic
1019478669 7:1256111-1256133 GGTGGAGGTGAAGTGGGGGCAGG - Intergenic
1019827030 7:3292947-3292969 GGTGGAGGGGAAGGTTTGGAGGG - Intergenic
1019936811 7:4263018-4263040 GGTGGAGGTGAGGGGTGGGGAGG - Intronic
1020085632 7:5308840-5308862 GGTGGTGGTGGTGGGCGGGTTGG - Intronic
1020087731 7:5320579-5320601 CGTGGTGGTGGAGGGTGAGCGGG - Exonic
1020139823 7:5606132-5606154 GGTGGTGGTGGCGGGCGGGTAGG + Exonic
1020393960 7:7692214-7692236 GGTGGTGGTGGAGGGTGATGGGG + Intronic
1020434972 7:8152542-8152564 GGTGGTGGTGGAGGTGGTGATGG - Intronic
1020937876 7:14490525-14490547 GGTGGTAATGAAGGGTGGAATGG - Intronic
1021560061 7:21960863-21960885 GGGGGTGGGAAATGGTGGGAGGG - Intergenic
1021664543 7:22962756-22962778 GGTGGTGGGGTTGGGTGGGGGGG - Intronic
1022199405 7:28102080-28102102 GGTGGTGGCACAGGCTGGGAGGG - Intronic
1022274473 7:28841935-28841957 GGAGGAGGGGAAGGGAGGGAAGG + Intergenic
1022339695 7:29456612-29456634 GGTGGTGGTGGTGGGGGGGAGGG - Intronic
1022388915 7:29926745-29926767 GGTGTGGGTGACGGGTGGGTGGG + Intronic
1022405810 7:30088902-30088924 GGGGGTGTTGTAGGGTGGGGTGG + Intronic
1022472763 7:30691846-30691868 GGTGGTGGTGATGGGTGGGCAGG + Intronic
1022505221 7:30905481-30905503 GCTGGAGGTGCGGGGTGGGAGGG + Intergenic
1022770432 7:33466322-33466344 GGTGGTTGTCAAGGGCTGGAAGG - Intronic
1022900699 7:34807885-34807907 GGTGGTGGTGGTGGGGGGTAGGG - Intronic
1023232771 7:38051486-38051508 AGTGGTGGTTAAGGCTGGGCTGG + Intergenic
1023340638 7:39215683-39215705 GGAGGTGGGGAAGCGTGGCAGGG + Intronic
1023416101 7:39934307-39934329 GATGGTGGTGAAGGTTGAAAAGG - Intergenic
1023534089 7:41189831-41189853 GATGGTGGTGTGGGGTGGGCAGG - Intergenic
1023625225 7:42108886-42108908 ACTGCTGGTGGAGGGTGGGATGG - Intronic
1023710143 7:42983502-42983524 GGTGGTTCTGAAGGCTGGGGTGG + Intergenic
1024030213 7:45454357-45454379 GGCGGTTGTGAAGGGTGAGCCGG + Intergenic
1024478061 7:49834895-49834917 GGTGGTGGTGGAGGCCAGGATGG + Intronic
1024569791 7:50714028-50714050 GGTGGTGGTGGAGGGGGAGGAGG - Intronic
1024644837 7:51362472-51362494 GGTGGTGGTGATGGTAGTGATGG - Intergenic
1024966940 7:55031952-55031974 GGTGGTGGTCACAGGTGAGAGGG + Intronic
1024982264 7:55167256-55167278 GGTGGTGGTGATGGTGGTGATGG + Intronic
1025208675 7:57008318-57008340 GGTGGTGGTGGTGGGTGGGTTGG + Intergenic
1025231651 7:57206841-57206863 GGTGGAGGGGAGGGGAGGGAGGG - Intergenic
1025663272 7:63568560-63568582 GGTGGTGGTGGTGGGTGGGTTGG - Intergenic
1025790216 7:64681493-64681515 GGTTGGGGAGAAGGGTGGCAAGG - Intronic
1026040738 7:66865895-66865917 GGAGGAGGTAAAGGGAGGGAGGG - Intergenic
1026954828 7:74370594-74370616 GGGGGTGGTGGTGGGGGGGAGGG - Intronic
1027189448 7:75988807-75988829 GGTGGAGGGGAAGGCGGGGAGGG + Intronic
1027189581 7:75989083-75989105 GGTGGAGGTTGAGGGGGGGAGGG + Intronic
1027299963 7:76821837-76821859 GGTGGGGGTGAGGGTGGGGAGGG + Intergenic
1027490424 7:78817514-78817536 GGTGTTGCTGAAGTTTGGGATGG - Intronic
1027855188 7:83502237-83502259 GGTGGTGGTCGAGGGAGGCACGG - Intronic
1028029063 7:85886218-85886240 GTGGTTGCTGAAGGGTGGGATGG + Intergenic
1028041314 7:86058284-86058306 TGTGATGGGGAGGGGTGGGATGG + Intergenic
1028086866 7:86646001-86646023 GGGGGTGGGGGGGGGTGGGAGGG + Intronic
1028174222 7:87634479-87634501 CGTGGTGGTGGGGGGTGGGGGGG + Intronic
1028479900 7:91293159-91293181 AGTGGGGTTGAAGGGTGGAATGG - Intergenic
1028504289 7:91554744-91554766 AGTGGTGGTGGGGGGTGGGGGGG - Intergenic
1028847366 7:95497031-95497053 GGGTGTGGGGTAGGGTGGGAAGG + Intronic
1029171242 7:98630459-98630481 GGTGGTGGTGGGCGGTGGGGGGG - Intergenic
1029196917 7:98811544-98811566 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1029552267 7:101243681-101243703 GGTGGTGGTGTTGGGGGGAAGGG + Intronic
1029560657 7:101300467-101300489 GCAGGTGTTGATGGGTGGGAGGG - Intergenic
1029698101 7:102227856-102227878 CGTGGGGGTGCAGGGTGGGGAGG - Intronic
1030105237 7:105981768-105981790 GGTGGGGGTGGAGGGTGGAGAGG - Intronic
1030139903 7:106293723-106293745 GGCGGGGGTGGAGGGTTGGATGG - Intergenic
1031188081 7:118508393-118508415 AGTGTTTGTGTAGGGTGGGATGG + Intergenic
1031630129 7:124034198-124034220 GGGAGAGGTGAAGGGAGGGAGGG - Intergenic
1031701490 7:124931616-124931638 GGTGGGGGGCAGGGGTGGGATGG - Intergenic
1031901770 7:127418665-127418687 GGTGGTGGTGATGGTAGTGATGG - Intronic
1032093795 7:128927367-128927389 GGTGGTGGTGGTGGGTGGTGGGG + Intergenic
1032093798 7:128927370-128927392 GGTGGTGGTGGGTGGTGGGGGGG + Intergenic
1032163919 7:129531120-129531142 GGTGGTGGTGGTGTGTGGGAGGG + Intergenic
1032531688 7:132626121-132626143 GGTGGTGGTGAGTGAAGGGAAGG - Intronic
1032581567 7:133107900-133107922 GGGGGTGGTGGCGGGTGGAAGGG - Intergenic
1032610570 7:133408213-133408235 GGTGGTGATGATGGGTGGGGAGG + Intronic
1032794117 7:135263803-135263825 GGTGCCAGTGGAGGGTGGGACGG + Intergenic
1032815640 7:135471087-135471109 GCTGGTGGTGAAGACTTGGAGGG + Intronic
1032899200 7:136287741-136287763 GGGGGTGGTCATGGGTGGTAAGG + Intergenic
1033098588 7:138451542-138451564 GTTGGTGGTGGTGGGTGGGAGGG + Intergenic
1033174626 7:139112883-139112905 GGTGGTGGCCAAGGGTGAGAGGG - Intergenic
1033331292 7:140418882-140418904 GGTGGGGGAGAAGAGTGGGCTGG - Intronic
1033346797 7:140531862-140531884 TGTGGTGGGGGCGGGTGGGAAGG + Intronic
1033436381 7:141337014-141337036 GGTGGTGGTGATGGTGGTGATGG - Intronic
1033436407 7:141337116-141337138 GGTGGTGGTGATGGTGGTGATGG - Intronic
1033447623 7:141436532-141436554 GGTGTTGGTGAAGGGTAGAGGGG + Intronic
1033461045 7:141547691-141547713 GGAGGTGGTAAAGGCAGGGAGGG + Intergenic
1033510669 7:142057316-142057338 GGTGGTGGTAATGGGTGTGTTGG + Intronic
1033510722 7:142057561-142057583 GGTGGTGGTGACGGTAGTGAAGG + Intronic
1034065805 7:148135865-148135887 GGAGGGGGGGAAGGGAGGGATGG + Intronic
1034422086 7:150995687-150995709 GGCGGGAGTGCAGGGTGGGACGG - Intronic
1034547527 7:151798898-151798920 GGTGGTGGTGAGAGGTGAGGAGG - Intronic
1034883324 7:154778888-154778910 GGTGGTGGTGATGGTGGTGAAGG - Intronic
1034889799 7:154829803-154829825 GGTGGTGGTGAAGGGTGGGAGGG - Intronic
1035035388 7:155891159-155891181 GGAGGTGGTGAAGGTGGTGATGG + Intergenic
1035035636 7:155892263-155892285 GGTGGTGGTGGAGGTGGAGATGG + Intergenic
1035035652 7:155892338-155892360 GCTGGTGGTGAAGGTGGTGATGG + Intergenic
1035076090 7:156178549-156178571 AGAGGAGGTGAAGGCTGGGAGGG + Intergenic
1035264430 7:157683336-157683358 GGCGGTGGAGGAGGGTGGGCAGG + Intronic
1035380978 7:158440826-158440848 GGTGGTGGTGATGGCAGTGACGG + Intronic
1035380996 7:158440877-158440899 GGTGGTGGTGAAGGTGGTGGTGG + Intronic
1035381014 7:158440981-158441003 GGTGGTGGTGATGGCAGTGATGG + Intronic
1035683816 8:1508391-1508413 GGGGGTGGTGAGGGGTGGGGGGG - Intronic
1035758440 8:2051465-2051487 GGCTGTGGTGAAGGGAGGGAGGG + Intronic
1035766730 8:2112401-2112423 GGTGGGGGTCAGGGATGGGAGGG + Intronic
1035783111 8:2244313-2244335 AGGGGTGGTGATGGGGGGGAGGG + Intergenic
1035809014 8:2475273-2475295 AGGGGTGGTGATGGGGGGGAGGG - Intergenic
1036066465 8:5386383-5386405 GCTCGTGGGAAAGGGTGGGAGGG - Intergenic
1036488329 8:9200173-9200195 GGTGTTGGTGGAGCCTGGGAAGG - Intergenic
1036648261 8:10625507-10625529 GGTGGGGGTGGGGTGTGGGAGGG + Intronic
1036892444 8:12605259-12605281 GGAGGTGGGGGAGGGTGGAAGGG - Intergenic
1037313702 8:17581519-17581541 GGTGGTGGTGGTGGGAGGTAGGG + Intronic
1037675033 8:21044013-21044035 GGTGGTGGTGGAAGGTGGAGGGG - Intergenic
1037693981 8:21207868-21207890 GGTGGTAGTGCTGGGAGGGAAGG - Intergenic
1037896148 8:22657692-22657714 GGAAGTGGTGAAAGGTGGCAAGG + Intronic
1037920520 8:22802302-22802324 GGTAGTGGGGATGGGTGGGAAGG - Intronic
1037939730 8:22942489-22942511 GGGGGTGGTGGGGGGTGGGGTGG - Intronic
1038418459 8:27415252-27415274 GGTGGTGGTGGTGGGTGGATGGG + Intronic
1038451092 8:27639418-27639440 GGAGGAGCTGAAGGGTGGGGAGG + Intronic
1038515744 8:28186438-28186460 AGTGGTGATGAAGAGTGAGAAGG - Intronic
1038604059 8:28980651-28980673 GGTGGGGGTGGAGAATGGGATGG - Intronic
1039001487 8:32985277-32985299 GTTGGTGCTGAAGATTGGGAAGG + Intergenic
1039026672 8:33266242-33266264 TGTGGAGGTGAAGAGTAGGATGG + Intergenic
1039172638 8:34765830-34765852 GTTGGTGGGGAAGGTTGGAACGG + Intergenic
1039380274 8:37078534-37078556 GGTGGTGGTTAGGAGTGTGATGG + Intergenic
1039507652 8:38063591-38063613 GGTGATGTTGGAGGGTGGCAGGG - Intergenic
1039554477 8:38466892-38466914 GGTGGTGGTGGGGGGGGGGTGGG - Intronic
1039628454 8:39080876-39080898 GGTGGTGGCCATGGGTGGTAGGG + Intronic
1039947305 8:42140811-42140833 GGTGGTGCTGTTGGGTGTGAGGG - Intergenic
1040030481 8:42819376-42819398 GGTGGTGGGTAAGCGGGGGAGGG - Intergenic
1040306048 8:46212350-46212372 GGTGGTGTGGGAGGGTGGCAAGG + Intergenic
1041043532 8:53870140-53870162 GGTGGTTGGAAAAGGTGGGATGG - Intronic
1041706390 8:60850609-60850631 GATGGTGGTGACGGGTAAGAAGG + Exonic
1041851262 8:62395361-62395383 GGTGGTGGTGGGGGGTGGCCCGG + Intronic
1041989462 8:63968435-63968457 GGTGCATGTGCAGGGTGGGAGGG - Intergenic
1042071186 8:64936426-64936448 AGAGGTGGGGAAGGGTGGGAAGG - Intergenic
1042392969 8:68256989-68257011 GGAGGTGGTGAAGGGAGAGCTGG + Intergenic
1042408414 8:68433138-68433160 GGTGGGGGTGAATGTTTGGAAGG + Intronic
1042505706 8:69557541-69557563 GATGGAGTTGAAGAGTGGGAAGG - Intronic
1042556978 8:70041858-70041880 ACTGGGGGAGAAGGGTGGGAGGG - Intergenic
1042571477 8:70170156-70170178 GGTGGGGGTGACGGGAGGTAGGG + Intronic
1042851959 8:73225789-73225811 GGTGGTGGTGGAGGGCTGGGGGG - Intergenic
1042903334 8:73748893-73748915 GGTGGTGGGGAGGGGCGGGGGGG - Intronic
1042975163 8:74460704-74460726 GGTGGTTATGAAGAGTGGTAGGG + Intronic
1042980314 8:74519102-74519124 AGTGGGAGTGAAGAGTGGGAAGG + Intergenic
1043149110 8:76691139-76691161 GGAGATGGTGAAGAGTTGGAAGG + Intronic
1043286432 8:78537584-78537606 GTTGGCGGTGGGGGGTGGGACGG - Intronic
1043414488 8:80033456-80033478 GGTGCCGGTGAAAGGTGGGAAGG + Intronic
1043424991 8:80139635-80139657 GGTGGGGGTGAGGGCGGGGAAGG + Intronic
1043481881 8:80661777-80661799 GGAGATGGGGAAGGGTGTGATGG + Intronic
1043666821 8:82825407-82825429 CCTGGGGGTGATGGGTGGGAGGG + Intergenic
1043986488 8:86698688-86698710 GGTGGTGGTGGTTGGTGGGAAGG + Intronic
1044071537 8:87766776-87766798 GGTGGTTGTGAGGGGTGGGCAGG + Intergenic
1044515990 8:93139484-93139506 GGAGGTGGTGAAGGGAGTTATGG - Intronic
1045445353 8:102256761-102256783 GGGGGTGGTGGAGGGAAGGAGGG - Intronic
1045541901 8:103094491-103094513 GGGGGTCGGGAAGGGAGGGAGGG - Intergenic
1046698330 8:117369904-117369926 GGTGGTTGTCAGGGGTTGGATGG - Intergenic
1046716256 8:117571004-117571026 GGGGGTGGGGAAGGGTAGGAAGG - Intergenic
1047455353 8:125003886-125003908 GGTGGTGGGGTGGGGTGGGGTGG + Intronic
1047722359 8:127653024-127653046 GGTGTTGGGGAATGGTGGAAGGG - Intergenic
1047813600 8:128437415-128437437 GGTGGTGGGGATGGTAGGGATGG + Intergenic
1048297107 8:133222520-133222542 GCTGGTGGTGATGGCTGGGATGG + Intronic
1048628408 8:136213213-136213235 GGTGGTAGTGATGGTTGTGATGG + Intergenic
1048628420 8:136213286-136213308 AGTGGTGGTGATGGTTGTGATGG + Intergenic
1048628434 8:136213368-136213390 AGTGGTGGTGATGGTTGTGATGG + Intergenic
1048628448 8:136213462-136213484 AGTGGTGGTGATGGCTGTGATGG + Intergenic
1048628464 8:136213556-136213578 AGTGGTGGTGATGGTTGTGATGG + Intergenic
1048681171 8:136843205-136843227 TGTGATGGGGAAGGGTGGGCTGG - Intergenic
1049224762 8:141444910-141444932 CGTGGTGGTGCTGGGTGGCATGG + Intergenic
1049274610 8:141713658-141713680 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1049274620 8:141713703-141713725 GGTGGTGGTGATGGTGGTGATGG + Intergenic
1049356849 8:142193277-142193299 GGGGGTGGCTGAGGGTGGGAGGG - Intergenic
1049397036 8:142405690-142405712 GGTAGAGAGGAAGGGTGGGAGGG - Intergenic
1049402009 8:142432378-142432400 GGTGGTGGTGATGGGAGCGATGG - Intergenic
1049439900 8:142604534-142604556 GGTGGTGGTCGAGGGAGGGCCGG + Intergenic
1049470430 8:142772926-142772948 TGTGGTGTTGAGGGGTGGGGTGG - Intronic
1049925029 9:400274-400296 GGTGGTGGTGAAGGAAGTGGTGG - Intronic
1050057887 9:1674631-1674653 GGTATTGTTAAAGGGTGGGAGGG + Intergenic
1050135092 9:2454466-2454488 ACTTGGGGTGAAGGGTGGGAGGG - Intergenic
1050308599 9:4330542-4330564 GGTGGAGATGAAGGTTGAGATGG + Intronic
1050308618 9:4330642-4330664 GGTGGAGGTGAAGGTTGAGATGG + Intronic
1050308622 9:4330676-4330698 GGTGGAGATGAAGGTTGAGATGG + Intronic
1050461057 9:5877776-5877798 GTTAGTGGTTAAGGGTGTGAAGG - Intergenic
1050538136 9:6647546-6647568 GGTTGTGGGGAAGGATTGGAGGG + Intergenic
1050650553 9:7771256-7771278 GGGGGTTGGCAAGGGTGGGAGGG + Intergenic
1051158980 9:14184348-14184370 TGTATTGGTGAATGGTGGGAAGG - Intronic
1051318779 9:15876438-15876460 GGTGGTGGTGAAGTGTAAAATGG - Intronic
1051667305 9:19477217-19477239 GGGAGTGGTGAAGGGTGGTTAGG + Intergenic
1052351255 9:27460598-27460620 GGTGGTACTGAAGGGTGAGGGGG + Intronic
1052466944 9:28840426-28840448 GGTGATGGTGTAGAGAGGGAAGG - Intergenic
1052512112 9:29435096-29435118 GGTGGTAGTGGAGGGTCGGCGGG + Intergenic
1052528496 9:29652205-29652227 TGTGGTGGGGAATGGTGGAATGG + Intergenic
1052864516 9:33456926-33456948 GGTGCGGGTGAAGGGTGGGGAGG + Intergenic
1053008729 9:34621492-34621514 GGTGGGGGTGCAGGGTTGGTTGG + Exonic
1053089209 9:35258431-35258453 GGTGGTTGTGGTGGGTGGGATGG + Intronic
1053173420 9:35906566-35906588 GGAGGTGGTGAGGGGTGTGGCGG - Exonic
1053173423 9:35906575-35906597 GGTGGTGGTGGAGGTGGTGAGGG - Exonic
1053310396 9:37014708-37014730 GTGGGTGGTGAAGGGAGGGATGG + Intronic
1053828127 9:42047597-42047619 GGTAGTGGGGGAGGGAGGGAGGG - Intronic
1054355481 9:64057316-64057338 GGTGGTGGTAGTTGGTGGGAAGG + Intergenic
1054788677 9:69234579-69234601 GGTGGGGGTGGGGAGTGGGAAGG + Intronic
1054800217 9:69340201-69340223 TTTGGTGGTGGAGGTTGGGAGGG + Intronic
1054877309 9:70110488-70110510 AGTGGAGGTGCAGGGTAGGAAGG + Intronic
1055514133 9:77020059-77020081 GGTGGTGGTGATGGGGGTGAAGG - Exonic
1055579527 9:77692903-77692925 GGTAGTGGGGGTGGGTGGGAGGG - Intergenic
1055647869 9:78377812-78377834 GGGGGTGGGGAAGGAAGGGAAGG + Intergenic
1055947830 9:81707250-81707272 GGTGGTGGTGGCAGGTGGAAGGG + Intergenic
1056259429 9:84833106-84833128 GGTGGTGGTGGTGGGTGGGTAGG + Intronic
1056322679 9:85451793-85451815 GGAGGTGGTGGAGGGTGCAATGG + Intergenic
1056533460 9:87507602-87507624 AGTGGTGGGGAGGGGAGGGAAGG + Intronic
1056719189 9:89058666-89058688 GATGGTGGTGTAGGATGTGATGG + Intronic
1056719548 9:89060203-89060225 GGTGGTGGTGGAGGATGTGGTGG + Intronic
1056728135 9:89140430-89140452 GGCGGTGGTGGTGGGTGGGGGGG + Intronic
1056965520 9:91160751-91160773 GGTGGGGGGGAAGGGGAGGAAGG - Intergenic
1057068493 9:92076158-92076180 GGTGGCGGTGGAGGATGTGAAGG - Intronic
1057177290 9:93009662-93009684 GGAGGTGCTGCAGGGTGCGAGGG + Intronic
1057217308 9:93236196-93236218 GGTGCTGGTGTGGGATGGGAGGG + Intronic
1057483309 9:95462630-95462652 GGTGGAGGAGAAGGAAGGGAAGG + Intronic
1057522645 9:95772335-95772357 GGTGGTGGTGGCGGGGGGCATGG - Intergenic
1058349288 9:104002129-104002151 GGTGGTGGAGAGGAGTTGGAAGG + Intergenic
1058618801 9:106862577-106862599 GGTGGTGGTGGAGGAGGGGGAGG - Intergenic
1058732183 9:107861109-107861131 AGGGTTGGGGAAGGGTGGGAGGG - Intergenic
1058887044 9:109329615-109329637 GGGGGAGATGAAGGGAGGGAGGG - Intergenic
1059283095 9:113151178-113151200 GGGGCTGGTGAAGGGTGTGTTGG + Intronic
1059458020 9:114412028-114412050 GGTGGAGGTGGAGGGTTGGGAGG + Intronic
1059498588 9:114731120-114731142 GGTGGAGGTGGGGGGTGGGTGGG - Intergenic
1059640775 9:116214526-116214548 GGTTGTGGGGAAGGTTGAGAGGG + Intronic
1059763625 9:117362693-117362715 GGTGGTGGTGAAGAGGGAGGTGG - Intronic
1059852905 9:118363925-118363947 GGTGCCAGTGGAGGGTGGGAGGG - Intergenic
1060073937 9:120574973-120574995 GGTGGTGGTTAAGGGCCGAATGG + Intronic
1060209657 9:121701834-121701856 TGTGATGTTGAAGGCTGGGAGGG + Intronic
1060243929 9:121928085-121928107 GATGATGGAGAAGCGTGGGAGGG + Intronic
1060402335 9:123356124-123356146 GGTGGCGGGGAGGGGAGGGAGGG + Intergenic
1060819588 9:126653742-126653764 GCTGGGGATGAAGGGTGGGAGGG - Intronic
1060858216 9:126933027-126933049 GGTGGTGGTGAAGCTGGCGAGGG + Intronic
1060967975 9:127722222-127722244 GGTGTGGGTGGAGGGAGGGAGGG - Intronic
1061023277 9:128030837-128030859 GGTGGTCAGGGAGGGTGGGAAGG - Intergenic
1061060137 9:128246148-128246170 GGGGCTGGTGAGGGGTGGGGAGG - Intronic
1061186725 9:129059296-129059318 GGTGGGCGTGGAGGGTGGCAGGG + Intronic
1061212487 9:129201905-129201927 GGGGGTGGGGTGGGGTGGGAGGG + Intergenic
1061231785 9:129319736-129319758 TGTGGGGGTGCAGGGTGGGGTGG + Intergenic
1061257467 9:129460884-129460906 GGGGGTGGGGAAGGGTGCGAGGG - Intergenic
1061426318 9:130500601-130500623 GGTGGAGGTGACGGAGGGGAAGG - Intronic
1061534775 9:131240742-131240764 GGTGGTGGTCCTGGGTGGCAAGG + Intergenic
1061636235 9:131910906-131910928 GGTGGTTGTGGGGGGTGGGGAGG - Intronic
1061757106 9:132823100-132823122 GGGGGTGGTGTTGGGGGGGAAGG - Intronic
1061772354 9:132935693-132935715 GGTGGTGGGGAGGGTTGGGGAGG - Intronic
1061958033 9:133973757-133973779 GGGGGTGTTGATGGGTGGGTAGG - Intronic
1061981062 9:134103909-134103931 GATGGTGGTGAATGGATGGATGG - Intergenic
1062027466 9:134347112-134347134 GGTGACGGGCAAGGGTGGGATGG + Intronic
1062226684 9:135456347-135456369 GATGGAGGTGAGGGGAGGGATGG + Intergenic
1062403247 9:136381617-136381639 AGTGGTGGGGTAGGGAGGGAGGG + Intronic
1062448077 9:136604079-136604101 GGTGGAGGTGCTGGATGGGACGG + Intergenic
1062495647 9:136830383-136830405 GGTGGTGCTGAAGGCTGGGAGGG - Intronic
1062517329 9:136943246-136943268 GGTGGTGGTGGGGGGGGGGGTGG - Intronic
1062672775 9:137721364-137721386 GGAGGGGGTGAGGCGTGGGAGGG - Intronic
1062676555 9:137748982-137749004 GGTGCTGGTGAAGGGAGAGCTGG + Intronic
1203768007 EBV:36468-36490 GGTGGTGGTGAAGGTGGTGGAGG - Intergenic
1203566299 Un_KI270744v1:93121-93143 GGTGGTGGTGGTTGGTGGGAAGG - Intergenic
1185763941 X:2709099-2709121 GGTGATGGAGGAGGATGGGAGGG + Intronic
1185854853 X:3524566-3524588 GGTGGTGGTGATGGTGGTGATGG - Intergenic
1186654865 X:11601379-11601401 GGATGTGGTGAATGGTGGGAGGG + Intronic
1186850094 X:13571099-13571121 GGTGGTGGTGGGGGGTGGGGTGG - Intronic
1187068377 X:15863543-15863565 TGTGGTAGTGATGGGTGGTAGGG + Intergenic
1187686024 X:21816413-21816435 GCGGGTGGTGTGGGGTGGGAGGG - Intergenic
1188534052 X:31175756-31175778 GAAGGTGGTGGTGGGTGGGATGG - Intronic
1188817109 X:34729203-34729225 GGTGGTGGTGGCGGGGGCGATGG - Intergenic
1188847958 X:35097038-35097060 AGTGGTGGTCAGGGGTTGGATGG + Intergenic
1189280466 X:39817246-39817268 GGTGGTGGAGCCGGGAGGGATGG + Intergenic
1189413643 X:40794817-40794839 GGAGGTGGTGGAGGGTGCAATGG - Intergenic
1189425640 X:40897458-40897480 GTGGGTGGAGAAGGGTGGGGTGG - Intergenic
1189530053 X:41870803-41870825 GGTGGTGGTGGAGGAGGGCATGG + Intronic
1189534897 X:41925390-41925412 GGTGGGGGAGAGGGGTGGGATGG - Intergenic
1189916745 X:45863127-45863149 GGGGGTGGTGGAGGGAGAGATGG - Intergenic
1190055797 X:47180330-47180352 TGGGGAGGGGAAGGGTGGGAAGG - Intronic
1190119628 X:47649822-47649844 GGTGGTGGTGGTGGGGGGGGGGG + Intronic
1190396502 X:49990399-49990421 ACTTGTGGGGAAGGGTGGGAGGG - Intronic
1190455388 X:50622691-50622713 GGTGGTGGGGGAAGGTGTGAAGG + Intronic
1190912379 X:54785227-54785249 GGGGGTGGGGAAGGCAGGGATGG + Intronic
1191192078 X:57678395-57678417 GGAGCTGGTGAAGGGAGTGATGG - Intergenic
1192630541 X:72774516-72774538 GGTGGTGGTGGTGCATGGGAAGG + Intergenic
1192651169 X:72946288-72946310 GGTGGTGGTGGTGCATGGGAAGG - Intergenic
1192667482 X:73102588-73102610 TGTGGTGGTGGGGGGTGGGGTGG + Intergenic
1192979001 X:76318847-76318869 GGAGGTGGTGGAGGGTGCAATGG + Intergenic
1193397354 X:81001332-81001354 GGTGGTGGAGAGGAGTTGGAAGG - Intergenic
1193924159 X:87464823-87464845 GGTGGTGGTGACGGGAGTGATGG - Intergenic
1194121762 X:89971539-89971561 TGTGATGGGGAAGGGTGGGCTGG + Intergenic
1194746612 X:97635356-97635378 GGTGGTGGTGGTGGTTGGGGTGG - Intergenic
1195112719 X:101663958-101663980 GGTGGAGGTGGTGGGAGGGAAGG + Intergenic
1195317633 X:103694220-103694242 GGTGGTGGGTAGGGGTGGGCAGG + Intergenic
1195369481 X:104158762-104158784 GGTGATGGTGAAGGGACTGAAGG + Intergenic
1195511439 X:105720362-105720384 GTTGTTGGAGAAGGGCGGGAGGG - Intronic
1195629030 X:107034391-107034413 GGTGGTGGTGTACGATGGAAAGG + Intergenic
1195884549 X:109625215-109625237 CGTGGTGGGGAAGGGGAGGAGGG - Intronic
1196196894 X:112846277-112846299 TGTGGTTGGGAAGGGTGGAAGGG - Intergenic
1196866790 X:120077804-120077826 GTTGGTGGTGTGGGGGGGGAGGG + Intergenic
1196876309 X:120158477-120158499 GTTGGTGGTGTGGGGGGGGAGGG - Intergenic
1197446058 X:126552954-126552976 GGGCGGGGTGAAGGCTGGGAGGG + Intergenic
1197475032 X:126911681-126911703 GAAGGTGGTAAAGGGTGAGATGG + Intergenic
1197754637 X:129984710-129984732 GGTCGAGGGGAAAGGTGGGAGGG + Intronic
1197756413 X:129998360-129998382 GGTGGTGGGGGGAGGTGGGAAGG + Intronic
1197980724 X:132216536-132216558 GGGGGTGTTGGGGGGTGGGAGGG + Intronic
1198079274 X:133223712-133223734 GGTGGTGGTCAAGGCAGGGAGGG + Intergenic
1198094347 X:133363826-133363848 TGTGTTGGGGAAGGGTTGGAGGG - Intronic
1198384710 X:136117647-136117669 GGGTGTGGTAAAGGGTGGGTAGG - Intergenic
1198456014 X:136818706-136818728 GGTGGTGGTGGGTGGGGGGAAGG - Intergenic
1198549541 X:137730241-137730263 GGTAGTGGTGCATGGTGGGAAGG + Intergenic
1198986365 X:142458835-142458857 GGTGTTGGGGAGGGTTGGGATGG - Intergenic
1199242892 X:145568948-145568970 GGTGGTGGTGACAGGCTGGATGG - Intergenic
1200229661 X:154437613-154437635 GGTGGGGGCGATGGGTGGGCGGG - Intronic
1200474619 Y:3628990-3629012 TGTGATGGGGAAGGGTGGGCTGG + Intergenic
1200687495 Y:6269518-6269540 AGTGGTGGGGAAGGAAGGGAAGG - Intergenic
1200949598 Y:8881649-8881671 AGTGGTGGTGACGGGTAGGTAGG + Intergenic
1201047779 Y:9905194-9905216 GGTGGTGGGGAAGGAAGGGAAGG + Intergenic
1201157139 Y:11141395-11141417 GGTGGTGGTGGTTGGTGGGAAGG + Intergenic
1201424164 Y:13831102-13831124 GGTCCAGGGGAAGGGTGGGAAGG + Intergenic
1201474951 Y:14370639-14370661 GGTGGTGGTGAAGGGGAAGTTGG - Intergenic
1202371093 Y:24196245-24196267 GGTGGAAGTGAAGGGAGAGATGG - Intergenic
1202499691 Y:25473872-25473894 GGTGGAAGTGAAGGGAGAGATGG + Intergenic