ID: 1034889800

View in Genome Browser
Species Human (GRCh38)
Location 7:154829804-154829826
Sequence TGGTGGTGGTGAAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2071
Summary {0: 1, 1: 1, 2: 32, 3: 260, 4: 1777}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889800_1034889808 2 Left 1034889800 7:154829804-154829826 CCTCCCACCCTTCACCACCACCA 0: 1
1: 1
2: 32
3: 260
4: 1777
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889800_1034889811 11 Left 1034889800 7:154829804-154829826 CCTCCCACCCTTCACCACCACCA 0: 1
1: 1
2: 32
3: 260
4: 1777
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889800_1034889810 10 Left 1034889800 7:154829804-154829826 CCTCCCACCCTTCACCACCACCA 0: 1
1: 1
2: 32
3: 260
4: 1777
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889800 Original CRISPR TGGTGGTGGTGAAGGGTGGG AGG (reversed) Intronic
Too many off-targets to display for this crispr