ID: 1034889801

View in Genome Browser
Species Human (GRCh38)
Location 7:154829807-154829829
Sequence GTTTGGTGGTGGTGAAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 625
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 567}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889801_1034889810 7 Left 1034889801 7:154829807-154829829 CCCACCCTTCACCACCACCAAAC 0: 1
1: 0
2: 4
3: 53
4: 567
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889801_1034889808 -1 Left 1034889801 7:154829807-154829829 CCCACCCTTCACCACCACCAAAC 0: 1
1: 0
2: 4
3: 53
4: 567
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889801_1034889811 8 Left 1034889801 7:154829807-154829829 CCCACCCTTCACCACCACCAAAC 0: 1
1: 0
2: 4
3: 53
4: 567
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889801 Original CRISPR GTTTGGTGGTGGTGAAGGGT GGG (reversed) Intronic
900149392 1:1171576-1171598 ACTTGGTGGGGGTGACGGGTGGG - Intergenic
900193187 1:1360053-1360075 GTTTGGTGGGGGGACAGGGTTGG + Intronic
900512810 1:3068475-3068497 GTTGGGTGGGGGCGAAGGGGAGG + Intergenic
900712897 1:4125844-4125866 ATTTGGTGGTGGTGGGGGGGGGG - Intergenic
900759798 1:4463067-4463089 GTCTGGTGGTGGTGGAGGGTGGG + Intergenic
900895304 1:5479159-5479181 GTTTCGTGGCGGAGAAGGATGGG - Intergenic
901888440 1:12240804-12240826 GTATGGTGGTGGGGCGGGGTGGG + Intronic
902445502 1:16460947-16460969 GTGTGGTGGTGGTGCATGCTTGG + Intergenic
902676301 1:18010847-18010869 ATGTGGTAGTGGTCAAGGGTGGG - Intergenic
902778482 1:18689817-18689839 GTTAAGTGGAGGTGAAGGGAAGG - Intronic
903182068 1:21609821-21609843 TTTTAGTGGTGGAGATGGGTAGG + Intronic
904076962 1:27850450-27850472 TTTTGGTCATGGAGAAGGGTGGG + Exonic
904377980 1:30093790-30093812 TGCTGGTGGTGGTGGAGGGTGGG + Intergenic
904710671 1:32427338-32427360 TGGTGGTGGTGGTGTAGGGTTGG + Intergenic
905257087 1:36691755-36691777 GCTTGGAGGTGGTGACTGGTGGG + Intergenic
905363835 1:37438145-37438167 GTTTCCTGGATGTGAAGGGTAGG - Intergenic
906017670 1:42596628-42596650 GTGATGTGGTGGTGAAGTGTTGG - Intronic
906211911 1:44016833-44016855 GTGTGGTGGGGGTGAGGGGGAGG - Intronic
906568230 1:46815392-46815414 CTTTTGTGGTGGTGGGGGGTGGG + Intronic
906836422 1:49087056-49087078 TTTTGTTGGTGGTGGTGGGTGGG - Intronic
907720061 1:56963577-56963599 GTTGGGGGGTGGTGGGGGGTGGG + Intronic
907739069 1:57146188-57146210 GTTTGCTTGTTGTGAAGAGTGGG - Intronic
907900937 1:58740966-58740988 CTTTGGTGGTGGTGGTGGTTGGG + Intergenic
908526528 1:64993244-64993266 GTATGGTAGTGGTTAAGAGTTGG + Intergenic
908532852 1:65049954-65049976 TTTTTATGGGGGTGAAGGGTGGG + Intergenic
909761123 1:79288745-79288767 GTTCGGTGTTGGTGAAGGACAGG - Intergenic
910186732 1:84549518-84549540 ATTTGGTGGTGGTGGCGGGAGGG + Intergenic
910276669 1:85456850-85456872 CTTTTTTGGTGGTGGAGGGTGGG - Intronic
911104732 1:94120879-94120901 GTAGGGTGGTGGGGCAGGGTGGG - Intronic
911365694 1:96934771-96934793 CTTTGGTGGTTAGGAAGGGTGGG + Intergenic
912307305 1:108582006-108582028 GGGTGGTGGTTGTTAAGGGTTGG - Intronic
912604336 1:110973081-110973103 GTGTGGTGGTGGTGAATTGGTGG + Intergenic
913097187 1:115529592-115529614 GTTTGCAGGTGGTGAAGGAAGGG + Intergenic
913264447 1:117030795-117030817 GTTGGGTAGTGGGGAAGAGTTGG + Intronic
914420857 1:147527188-147527210 GTCTGGAAGTGGTGAAGGGCTGG + Intergenic
914422479 1:147541880-147541902 GGTTGGTGGGGGAGAAGGGGTGG + Intronic
914743848 1:150486826-150486848 GTTTGGTGGGGGGGAGGGGAGGG + Intergenic
915687625 1:157650655-157650677 GTTGGGAGGTGGAGAAGGGAAGG + Intergenic
916217698 1:162411626-162411648 ACATGGTGGTGGTGAAGGGAAGG - Intronic
916316115 1:163449846-163449868 GTGTGGTGGTGGTGAAGAAATGG + Intergenic
916884606 1:169054817-169054839 GTTTGGTGGGGGTGGTGGGAAGG + Intergenic
917117551 1:171617705-171617727 GTTTTGTGGTGGGGAAAAGTGGG + Intergenic
917247186 1:173016709-173016731 GTGTGGTGGTGGTGAGAGGAGGG + Intergenic
917471999 1:175333954-175333976 GTTTGGTGTTGGAGAGGAGTCGG + Intronic
918126670 1:181589961-181589983 TTTTGGTGGGAGGGAAGGGTTGG + Intronic
918755095 1:188330549-188330571 GGGTGGTGGTGGGGAAAGGTGGG - Intergenic
918865029 1:189884785-189884807 TTTTGTTGATGGTGAAAGGTAGG - Intergenic
918927851 1:190810409-190810431 GTTTGATTGTGGTAAAAGGTAGG - Intergenic
919403339 1:197146891-197146913 TTTTGGTTGTGCTGAAGGGAAGG + Intergenic
919738599 1:200969298-200969320 AGTTGGTGGTGGTGGTGGGTGGG - Intergenic
920249142 1:204610959-204610981 ATGTGGTGGAGGTGGAGGGTGGG + Intergenic
920295972 1:204956652-204956674 GCTAGGTGCTGGTGAAAGGTTGG - Intronic
921748867 1:218769466-218769488 GTGTGGGGGTGGGGTAGGGTGGG - Intergenic
923007260 1:230060514-230060536 GGGTGGTGGTGGTGAGGGGATGG - Intronic
923392716 1:233529954-233529976 GGTGGCTGTTGGTGAAGGGTTGG + Intergenic
923465527 1:234245110-234245132 GGTAGGTGGTGGTAGAGGGTAGG - Intronic
923616788 1:235544904-235544926 GGGTGGTGGTGGTGGAGGGTGGG + Intergenic
923959366 1:239059302-239059324 GTTTTGTAGTGGTGAATGGGAGG - Intergenic
1062804562 10:407783-407805 TTTTGGTGGTGGTGACTTGTAGG + Intronic
1063199496 10:3774307-3774329 ACTTGGGGGTGGAGAAGGGTAGG + Intergenic
1063231775 10:4072528-4072550 GGTTGGTCATGGTGGAGGGTGGG - Intergenic
1064466111 10:15583697-15583719 GTCTCGGGGTGGGGAAGGGTTGG + Intronic
1067826508 10:49577815-49577837 GTTTGGTGGTTGCTAGGGGTTGG - Intergenic
1068222280 10:54059043-54059065 GAGTGGTGGTGGTGGAGGATGGG - Intronic
1068685196 10:59863527-59863549 GATTTGTGGTTGTGTAGGGTTGG + Intronic
1068730062 10:60347998-60348020 GCATGGTGGTGGTGAGGGGTTGG - Intronic
1068820024 10:61364433-61364455 TGTTGGTGGTTGTGAGGGGTGGG - Intergenic
1068887711 10:62114684-62114706 GTTTGGTCATGGGGCAGGGTCGG - Intergenic
1069886569 10:71627614-71627636 GTGTGGAGGAGGTGAGGGGTGGG - Intronic
1070178359 10:73991942-73991964 TTTGGGTGGAGGTGGAGGGTGGG + Intergenic
1070400900 10:76052829-76052851 GGCTGGGGGTGGTGAGGGGTGGG - Intronic
1070550358 10:77486260-77486282 ACTTGGTGGTGGGGAAGGGGAGG - Intronic
1071367463 10:84913607-84913629 CTTTAGTGGTGGTGAAGGCTGGG + Intergenic
1072735849 10:97879207-97879229 TGTTGGTGGTGGTGATGGGAGGG - Intronic
1072757993 10:98033297-98033319 GATTGGGGGTGGGGAAGGGCTGG - Intergenic
1073348294 10:102800986-102801008 GTTTAGTAGAGGTAAAGGGTGGG - Intronic
1073440156 10:103547716-103547738 GTGGGGTGGAGGTGAAGGGAGGG + Intronic
1073758422 10:106605714-106605736 GTGAAGTGGAGGTGAAGGGTGGG - Intronic
1074152541 10:110770174-110770196 TGTAGGTGGTGGTGAGGGGTGGG + Intronic
1074295100 10:112179266-112179288 ATTTGGTGGTGGTAATGGTTTGG - Intronic
1074733025 10:116397737-116397759 GAGTGGTGGTGGTGAACGGGGGG + Intergenic
1075630696 10:123999037-123999059 GTTTGGTGGGGGGGATGGTTTGG + Intergenic
1075742504 10:124704456-124704478 GTGTGGTGGGGGTAAGGGGTGGG + Intronic
1075776478 10:124992225-124992247 TTTTGGTGGTGGGGTGGGGTCGG + Intronic
1076213942 10:128677525-128677547 GTTTGTTGGTGGATAAGGATGGG - Intergenic
1078835279 11:15022285-15022307 GTTAGGGGGAGGTGAAGGGAGGG + Intronic
1079476092 11:20830904-20830926 GTGTGGTGGTGTTGGGGGGTGGG - Intronic
1080244484 11:30164055-30164077 GTGGGGTGGGGGTGAAGGGCAGG + Intergenic
1080649302 11:34209759-34209781 GTAGGGTGGGGGTGGAGGGTAGG + Intronic
1082795602 11:57376300-57376322 GTGTGGTGCAGGTGAGGGGTTGG - Intergenic
1082795655 11:57376435-57376457 GTGTGGTGCAGGTGAGGGGTTGG - Intergenic
1082820124 11:57539003-57539025 GGGTGGTGGAGGGGAAGGGTAGG - Intergenic
1082828346 11:57597727-57597749 GTTTGGTGCTGGGCAGGGGTGGG + Intronic
1083170704 11:60922615-60922637 GTTTGGTGGGAGTACAGGGTAGG - Exonic
1083479261 11:62933385-62933407 GCTTGGTGGTGGTGCAAGTTTGG + Intergenic
1084174980 11:67418354-67418376 GTGTGGAGGTGGTGGAAGGTGGG + Intronic
1084240107 11:67813543-67813565 GGCAGGTGGTGGTGAGGGGTGGG + Intergenic
1084441147 11:69174109-69174131 GTGTTGTGGTGGTGGAAGGTGGG + Intergenic
1084466124 11:69324056-69324078 TTTTGGTGGTGGTGGAGGTGAGG + Intronic
1084569474 11:69950786-69950808 TTTTTATTGTGGTGAAGGGTGGG - Intergenic
1085034526 11:73292084-73292106 GTTTGGTGGTGAGGAGGGGCTGG + Intronic
1085826968 11:79858127-79858149 CTTTGGGGGTGGAGAAGGGTGGG + Intergenic
1086260358 11:84932502-84932524 GTGTGGTGGGGGTGAGGGGTGGG - Intronic
1086869800 11:92023779-92023801 GTTTGCTGGTGATAATGGGTGGG - Intergenic
1087064187 11:94011825-94011847 GTGAGGTGGGGGTGGAGGGTTGG + Intergenic
1087309812 11:96528265-96528287 GTTTGATGGTGGTATAAGGTGGG - Intergenic
1087439806 11:98169009-98169031 GTTTGTGTATGGTGAAGGGTGGG - Intergenic
1088076380 11:105854188-105854210 ATTAGGTGGTGGTGAAGTGTTGG + Intronic
1088670392 11:112134786-112134808 GTCTGGTGGGGGTGAGTGGTGGG + Intronic
1088982474 11:114876238-114876260 GTGTGTTGGGGGTGAGGGGTAGG - Intergenic
1089022676 11:115233133-115233155 GTTTGGTGGTGGTGGTGGCGGGG + Intronic
1089235703 11:117023239-117023261 CTTTGGGGGTGGTGAGGGGATGG - Intronic
1089846309 11:121461245-121461267 TGGTGGTGGTGGTGATGGGTGGG + Intronic
1090127711 11:124105536-124105558 GCTTGGTCGTGGTGCCGGGTTGG - Intergenic
1090479083 11:127052001-127052023 GTTTGGTGGTGGGAAGGGGCTGG - Intergenic
1091292029 11:134446044-134446066 GGCTGGTGGTGGTGGTGGGTGGG + Intergenic
1091442334 12:521231-521253 GTCCCGTGGTGGTGGAGGGTGGG - Intronic
1091646386 12:2275337-2275359 GTTGGGTGATGGTGAGGAGTCGG - Intronic
1091874823 12:3925076-3925098 GTGGGGTGGTGGGGAAGGGTGGG - Intergenic
1092476378 12:8822463-8822485 GTTAGGTGGTGGACCAGGGTAGG - Exonic
1092766620 12:11859011-11859033 GTTTGGTGGTGGGGCAGGAGGGG - Intronic
1092918022 12:13205931-13205953 GATTGGTGGTGGTTAGAGGTGGG + Intronic
1092983479 12:13821167-13821189 GTTGGGAGGTGGTTTAGGGTAGG - Intronic
1093710373 12:22322721-22322743 GTGTTTTGGTGGTGAAGTGTTGG - Intronic
1093841848 12:23912806-23912828 GATTGGTGGTTGTCTAGGGTAGG + Intronic
1094339224 12:29392107-29392129 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1095274013 12:40257908-40257930 GGATGGTGGTGGGGCAGGGTGGG + Intronic
1096109326 12:49019907-49019929 GCTTGGTGGTGGTGGACGGGCGG - Exonic
1096192021 12:49625614-49625636 CTTTGGTGGTGGGAAAGGGGTGG + Intronic
1096503832 12:52080873-52080895 GGGAGGGGGTGGTGAAGGGTGGG + Intergenic
1096766739 12:53897144-53897166 ATGTGCTGGGGGTGAAGGGTAGG + Intergenic
1096972791 12:55681345-55681367 GGTTGGTAGTGGTGAATGCTGGG - Intergenic
1097273431 12:57794010-57794032 GGTGGGTGGTAGGGAAGGGTTGG + Intronic
1097899426 12:64858188-64858210 GTTTGGTGGGAATGGAGGGTGGG - Intronic
1098206967 12:68121300-68121322 AGTTGGTGGTGGTGATGGGTGGG - Intergenic
1098393455 12:69993603-69993625 ATCTAGTGCTGGTGAAGGGTTGG - Intergenic
1100774708 12:97961443-97961465 GGTTGGTGGGGGTGAGGGGAGGG - Intergenic
1100909803 12:99346412-99346434 GTGTGGTGGTGGGGAAGGGGAGG - Intronic
1101295247 12:103416552-103416574 TTTTGGTGGTGGTCTCGGGTGGG - Intronic
1101295408 12:103418560-103418582 TTTTGGTGGTGGTCTCGGGTGGG + Intronic
1101312283 12:103592854-103592876 GAATGGTGGTTGTTAAGGGTTGG - Intronic
1101503750 12:105328217-105328239 ATTGGGTGGTGGTGAAGTCTGGG + Intronic
1101569289 12:105938177-105938199 GGTGGGTGGGGGAGAAGGGTTGG - Intergenic
1101777595 12:107807978-107808000 GTGTGGATGTGGGGAAGGGTGGG + Intergenic
1101793369 12:107951130-107951152 GCTTGGTGGTGGAGAAGGATGGG + Intergenic
1102241152 12:111325618-111325640 GTGTTGTGGTGGGGAGGGGTGGG + Intronic
1102450299 12:113037038-113037060 GTTGGGTGGGGGTGCAGGCTGGG - Intergenic
1102639593 12:114355264-114355286 GTGTGGTGGTAGTGGGGGGTGGG + Exonic
1103063249 12:117875854-117875876 GTGTGGTGGTGGTGGGGGGGAGG - Intronic
1105015923 12:132786854-132786876 CTTTGGTGGGGGTGATGGGCTGG - Intronic
1105067618 12:133214617-133214639 TATTGGTGGTTGTCAAGGGTCGG + Intergenic
1106896633 13:34309872-34309894 GTTTGGTGGGGGTGGGGGGGCGG + Intergenic
1107397914 13:40037369-40037391 ATGTGGTGATGGTGAAAGGTAGG + Intergenic
1109596246 13:64558049-64558071 TTTTGGTGGTGGTGGAGAGGGGG + Intergenic
1110442796 13:75544100-75544122 GTGTTGTGGTGGTGGTGGGTGGG + Intronic
1111380370 13:87441993-87442015 GGTTGGTGGTTGCCAAGGGTGGG + Intergenic
1112393770 13:99009662-99009684 GTTTGGGGGTGGGGACAGGTGGG - Intronic
1113507314 13:110826187-110826209 GCTTGGTGGGAGTGAAGGGCAGG - Intergenic
1113699126 13:112370798-112370820 GTTTGGTGGTGGGGTGGGGTGGG - Intergenic
1113794028 13:113046390-113046412 GTTTGGTGCTGGGGAATGCTTGG - Intronic
1114348158 14:21819824-21819846 TTTTGGTGGTGGTGGAGGTGGGG + Intergenic
1114492647 14:23113052-23113074 GTGTGGTGGTGGTGGTGGGGGGG + Intergenic
1114647222 14:24262561-24262583 GTTTGGTGGGGGTGAGGGGAAGG - Intronic
1114734413 14:25029295-25029317 GAATGGTGGTGCTGAAGGTTGGG - Intronic
1114846320 14:26326988-26327010 GTTTTGTAGTGGTGAAGTCTGGG - Intergenic
1114979488 14:28144760-28144782 TTTTTGTGGGGGTGGAGGGTGGG - Intergenic
1115111789 14:29832198-29832220 TTTTGGTGGTGGTGGTGGGGTGG - Intronic
1115479164 14:33844719-33844741 GAGTGGTGGGGGTGAGGGGTTGG + Intergenic
1116823328 14:49646898-49646920 GTTTGGTGATGGTATGGGGTTGG - Intronic
1117008644 14:51447785-51447807 GGATGGTGGTGTTGAGGGGTGGG - Intergenic
1117211847 14:53509038-53509060 GTGTGGTGGTGGTGGAGGTAGGG + Intergenic
1117284447 14:54273153-54273175 ATATGATGGTGGTGAAGGTTAGG - Intergenic
1117486448 14:56202624-56202646 GTCTGGGAGTGGGGAAGGGTGGG + Intronic
1117593287 14:57299126-57299148 GTTTGGTGGTGGGGGGGTGTGGG + Intergenic
1118224860 14:63889368-63889390 TTGTGGTGGTGGTGTAGGGGAGG + Intronic
1118331073 14:64816431-64816453 GGTTGGTGGTGGTGATAGGAGGG - Intronic
1118334405 14:64840691-64840713 GTGTGGGGATGGTGAAGGGATGG - Intronic
1118456434 14:65948986-65949008 GTGTGCTGGGGGTGGAGGGTTGG + Intergenic
1118714590 14:68549962-68549984 TTTTAGTGGTGGTGGAGGATTGG + Intronic
1118876517 14:69789508-69789530 GATTAGTGGTTGTCAAGGGTTGG + Intronic
1119326240 14:73761068-73761090 TTTTGGTGGTGGTGCAGTGGTGG + Intronic
1119748836 14:77063553-77063575 GTTGGGTGGTGGTGGAGATTGGG - Intergenic
1119750208 14:77071990-77072012 GTGTGGTGGTGGTGGGAGGTGGG - Intergenic
1120111533 14:80563175-80563197 GATTGGTGGTTTGGAAGGGTGGG - Intronic
1120386263 14:83850049-83850071 GTTTGGTGTTGGGGAAAAGTGGG + Intergenic
1120844566 14:89114650-89114672 GTGTGGTGGTGGGGTAGGGGAGG + Intergenic
1120957708 14:90097511-90097533 ATGTGGTGGTGGTGGAAGGTGGG - Intronic
1121019492 14:90570493-90570515 GTTTTGAGGTGGAAAAGGGTGGG - Intronic
1122086913 14:99314090-99314112 GGTTGGTGGCGGGGGAGGGTTGG - Intergenic
1122423406 14:101591272-101591294 GCTTAGTGGTGGGGGAGGGTGGG - Intergenic
1122770846 14:104097048-104097070 GGGTGGTGGGGGTGAGGGGTGGG - Intronic
1122905292 14:104798883-104798905 GTTTGGTCGTGCTCAAGGTTGGG + Intergenic
1122915881 14:104858799-104858821 GGTGGGTGGTGATGGAGGGTGGG - Intergenic
1202852351 14_GL000225v1_random:29801-29823 GGTGGGTGGTGGTGTGGGGTGGG - Intergenic
1124371970 15:29109160-29109182 GTTTTGTGGAGGTGATGGGGAGG + Intronic
1125226116 15:37398076-37398098 GTTTGGTGGTGGGGAGGGCAGGG - Intergenic
1125887673 15:43240734-43240756 GTGTGGAGGAGGTGAAGGGGAGG + Intronic
1125976133 15:43953377-43953399 CCTTGGTGGTGGAGATGGGTGGG + Intronic
1126144584 15:45463398-45463420 GTGTGGTGGTGGTGATGGTGTGG - Intergenic
1128932237 15:71715867-71715889 GTTTGGTGGTTGTGGAGTGGTGG - Intronic
1129227576 15:74179016-74179038 GCTTGGTGGAGGTGGAGGGCGGG - Intergenic
1129706589 15:77798074-77798096 GTTTGGGGCTGGTGAACCGTGGG - Intronic
1129780946 15:78270640-78270662 CTTTGGTGGTGGTGGACGGATGG + Exonic
1129823623 15:78620493-78620515 GTTTGGTGGTGGCTAGGGGTGGG + Intronic
1130297436 15:82657061-82657083 GTGTGCTGCTGGTGAAGGCTGGG - Intergenic
1131082220 15:89546295-89546317 GTTTGGAGCTGATGGAGGGTGGG - Intergenic
1131494972 15:92900236-92900258 TTTTGGTGGAGATGAAGGGGTGG + Exonic
1131597655 15:93814082-93814104 GTTAGGTTGTGGTATAGGGTAGG - Intergenic
1131695400 15:94871827-94871849 CATTGGTGGTTTTGAAGGGTAGG - Intergenic
1131696511 15:94882591-94882613 GCTTGGCGCTGGTGGAGGGTAGG + Intergenic
1132399666 15:101497620-101497642 GTTTTGTGGTGGGGACGGGGAGG - Intronic
1132941693 16:2511676-2511698 GGAAGGTGGTGGTGAAGGGGTGG + Intronic
1132994078 16:2813997-2814019 GGTGGGTGGTGCAGAAGGGTGGG - Intergenic
1133113382 16:3562930-3562952 GCTTGGTGGTGGGGAGGGGACGG + Intronic
1133272683 16:4618168-4618190 GTAGGGTGGTGGGGAAGGCTTGG + Intronic
1134206550 16:12242942-12242964 TTTTGGGGGTGGGGAATGGTTGG - Intronic
1137237595 16:46628191-46628213 TTTTGGAGGTGGGGTAGGGTAGG - Intergenic
1137669493 16:50271133-50271155 GTGTTGGGGTGGAGAAGGGTTGG + Intronic
1137780646 16:51095287-51095309 GTATGGTGGTGGTGAAGCTAAGG - Intergenic
1137827408 16:51511165-51511187 GTTTGCTGGAGGTGAGAGGTTGG + Intergenic
1138119845 16:54391164-54391186 GTTTGGTGCTGGTGATGGTGTGG + Intergenic
1138605144 16:58083851-58083873 GTTGGGTGGGGGTGTGGGGTGGG - Intergenic
1139269651 16:65670378-65670400 GTGTGGTGGTGTTGGAAGGTGGG - Intergenic
1139439910 16:66961237-66961259 GATCGGTGGTGCTGAAGGGCAGG + Exonic
1140313773 16:73873174-73873196 GGTGGGTGGTGGTGGATGGTGGG + Intergenic
1141133358 16:81449747-81449769 GATTGGAGGTGGTGGAGGGGAGG + Intronic
1141770573 16:86087308-86087330 GACTGCTGGCGGTGAAGGGTGGG + Intergenic
1143200227 17:5108153-5108175 GTTTGGTGATAGTGATGGGGGGG + Intronic
1144296250 17:13877820-13877842 GTTTGGTGGTTGAAGAGGGTGGG + Intergenic
1144385109 17:14742040-14742062 CTTTGGTGGTGGTGGTGGGAGGG + Intergenic
1144446199 17:15331526-15331548 GGTTGGTGTTGGTCTAGGGTGGG + Exonic
1144486721 17:15672309-15672331 GTTTGGTTGTGGTAAAGTCTGGG - Intronic
1144698556 17:17322015-17322037 GTTTGGAGGTGGGGAGGGTTAGG + Intronic
1144800342 17:17921873-17921895 GAGTGCTGGTGGTGAATGGTGGG - Intronic
1144840119 17:18180974-18180996 TTCTAGTGGTGGTGATGGGTGGG + Intergenic
1144914300 17:18709988-18710010 GTTTGGTTGTGGTAAAGTCTGGG + Intronic
1145371529 17:22310580-22310602 GTTTTGTGGTGGGGGTGGGTGGG + Intergenic
1145873461 17:28296322-28296344 TTTTGGTGGAGGTGATGGGTGGG - Intergenic
1146568970 17:33936960-33936982 GCTTGGTGGAGGTGGAGGGTGGG - Intronic
1146954732 17:36930910-36930932 GTTTAGTGGTGGGGAGGGGGTGG + Intergenic
1147721881 17:42544391-42544413 TTTGGGTGGTGGTGGAGGGCAGG - Exonic
1148152673 17:45405568-45405590 GTGAGGGGGTGGTGATGGGTGGG - Intronic
1149422489 17:56524162-56524184 GTGGGGTGGTGGAGAAGGGAGGG + Intergenic
1149502789 17:57167183-57167205 GTAGGGTGGTGGGGAAGGGGGGG + Intergenic
1149998745 17:61418642-61418664 GATTGGTGGTTGTCAAGGGCTGG - Intergenic
1150168309 17:62966066-62966088 GTTTGGGGGTGGGGAACGGCTGG - Intergenic
1150696437 17:67409540-67409562 TTTTGGTGGTGGTGGCGGGGCGG + Intronic
1151140551 17:71987729-71987751 AATTGGTGGTGGTGGAGGGGGGG - Intergenic
1151153909 17:72111188-72111210 GCTTGGGGGTGGGGAAGGATGGG - Intergenic
1152036151 17:77874364-77874386 GTTTGGTGATGGTGCAGGGAGGG - Intergenic
1152683006 17:81679327-81679349 GTTTGGTGGTGGTAAGAGGCAGG + Intergenic
1152888259 17:82865220-82865242 GTGTGCTGGTGCTGAAGGGAGGG + Intronic
1152888270 17:82865272-82865294 GTGTGCTGGTGCTGAAGGGAGGG + Intronic
1153199115 18:2631478-2631500 GTTTGGGGGTTGTGTGGGGTGGG - Intergenic
1153399425 18:4667001-4667023 ATGTGCTGGTGGGGAAGGGTAGG - Intergenic
1153953998 18:10080712-10080734 GTTTGGAGGTGGGGACTGGTGGG + Intergenic
1154172873 18:12063625-12063647 GATTGGGGGTGGGGAGGGGTGGG - Intergenic
1154208067 18:12354764-12354786 GGGGGGTGGTGGGGAAGGGTGGG - Intronic
1154215724 18:12414735-12414757 TTTTGGTGGGGGTGGAGGGGTGG - Intronic
1155141452 18:23048290-23048312 TTTTTGTGGTTGTGAAGAGTTGG - Intergenic
1156473299 18:37390782-37390804 GGCTGGTGGTGGTGATGGGGCGG + Intronic
1157400776 18:47384690-47384712 GGATGGAGGTGGTTAAGGGTTGG - Intergenic
1160029900 18:75249475-75249497 CTTTGGTAGGGGGGAAGGGTAGG + Intronic
1160334677 18:78028143-78028165 GTTTGTTGGAGGTGGAGGGCAGG + Intergenic
1160409905 18:78668196-78668218 ATTTGGTGTTGGTGAGGGCTTGG - Intergenic
1160409919 18:78668268-78668290 ATTTGGTGTTGGTGAGGGCTTGG - Intergenic
1160409933 18:78668340-78668362 ATTTGGTGTTGGTGAGGGCTTGG - Intergenic
1160409947 18:78668412-78668434 ATTTGGTGTTGGTGAGGGCTTGG - Intergenic
1160585098 18:79909723-79909745 GTGAGGTGGTGGGGAAGGTTGGG - Intronic
1160585125 18:79909815-79909837 GTGAGGTGGTGGGGAAGGTTGGG - Intronic
1160585260 18:79910275-79910297 GTGAGGTGGTGGGGAAGGTTGGG - Intronic
1160585270 18:79910305-79910327 GTGAGGTGGTGGGGAAGGTTGGG - Intronic
1160585280 18:79910335-79910357 GTGAGGTGGTGGGGAAGGTTGGG - Intronic
1160585290 18:79910365-79910387 GTGAGGTGGTGGGGAAGGTTGGG - Intronic
1160753612 19:746981-747003 GTTGGGGCGTGGTGACGGGTGGG - Exonic
1161530238 19:4784556-4784578 GATTGGTAGTGGTGAAGCCTGGG - Intergenic
1161739604 19:6012625-6012647 GTGTGGGGGAGGTGAATGGTGGG + Intronic
1161896982 19:7089861-7089883 TTTTGGTGGTGGTGGGGGGGTGG - Intergenic
1162728018 19:12701460-12701482 GGAGGGTGGTGGTGAGGGGTAGG + Intronic
1163134443 19:15299465-15299487 CCTTGGTGGTGGTGGTGGGTAGG + Intronic
1163296076 19:16413681-16413703 GGCTGGTGGTGGGGAAGGGCAGG - Intronic
1163457052 19:17413317-17413339 GTTTTGTTGAGGTGAGGGGTGGG - Intronic
1164632208 19:29769144-29769166 GATTGGTGGGGGTGAGGAGTGGG - Intergenic
1164664176 19:30013093-30013115 TTTTGGTGGTGGTGCAGGGGAGG + Intronic
1164851510 19:31488246-31488268 ATATGGTGATGGGGAAGGGTTGG - Intergenic
1165717877 19:38058307-38058329 CTGTGGTGCTGCTGAAGGGTGGG + Intronic
1166758669 19:45211356-45211378 GTATGGTGGTGGTGGAGGGGGGG + Intronic
1166889513 19:45981892-45981914 GGTTGCTGGTGGGAAAGGGTGGG - Intergenic
1167616257 19:50535857-50535879 TCCTGGTGGTGGGGAAGGGTGGG - Intronic
1168472944 19:56654486-56654508 GGGTGGTGGTAGTGAAGGGAAGG + Intronic
927414611 2:22865826-22865848 GTGTGGTGGGGGTGCAGGGATGG + Intergenic
927543498 2:23932546-23932568 GGTGGGTGGGGGTGCAGGGTTGG + Intronic
927692074 2:25215564-25215586 TGTTGGTGGTGGTGCTGGGTTGG - Intergenic
928098594 2:28421278-28421300 GATTGGTGGTTGTCAGGGGTTGG - Intergenic
928592482 2:32832171-32832193 GTTTGGTAGTGGGGGTGGGTGGG - Intergenic
928696772 2:33857084-33857106 GTTTGGTGATGGAGAAGGCAGGG - Intergenic
929704043 2:44192051-44192073 GTTTGGTTTTTGTGAAGGGGAGG + Intronic
930358135 2:50346480-50346502 GGGTGTTGGTGGTGAGGGGTGGG - Intronic
930572248 2:53101959-53101981 GTGTGATGGTGTTAAAGGGTAGG - Intergenic
931077066 2:58727197-58727219 GTATGGTGGTGGTGGTGGCTTGG + Intergenic
931699511 2:64898396-64898418 GATTGGTAGAGGTGAAGGGCTGG + Intergenic
932316841 2:70790352-70790374 GTTTGGTGGTAGAGCAGGGAAGG + Intronic
934089862 2:88541737-88541759 GAATGGTGGTTGTGAGGGGTTGG + Intergenic
935563644 2:104584306-104584328 GTTTGGTGGTGGGGGTGGGGGGG + Intergenic
935640685 2:105287186-105287208 GGCTGGTGGGGGTGTAGGGTGGG + Intronic
936283662 2:111164072-111164094 ATTTGGGGGTGGGGAGGGGTGGG - Intronic
936915429 2:117635020-117635042 CTTAGGTGGTGGTGAATGTTCGG - Intergenic
938101330 2:128499901-128499923 GTGTGGTTGTGGGGAAAGGTCGG + Intergenic
939507996 2:143072607-143072629 TTTTGGGGGTGGTGGAAGGTGGG + Intergenic
939624308 2:144458162-144458184 GTGTGGTGGTGGTGGTGGTTGGG - Intronic
939986387 2:148833494-148833516 GTTTGGTGGTGGTGGGGGTTAGG - Intergenic
940324429 2:152410655-152410677 GTGGGGTGGGGGTGAAGGGATGG - Intronic
940977120 2:159958515-159958537 GTATGATGGTGGGGAAGGGGTGG - Intronic
941226993 2:162863079-162863101 TTTTGGGGGTGGGGAAGGCTGGG - Intergenic
941713866 2:168743920-168743942 TTTTGGTGGTGGTGGGGGGTGGG - Intronic
943287122 2:186016263-186016285 GTATGGTGGCGGTGGGGGGTGGG - Intergenic
943358408 2:186888107-186888129 GGATGGGGGTAGTGAAGGGTGGG - Intergenic
943400074 2:187397701-187397723 CTTTGGTGGTTTAGAAGGGTGGG - Intronic
943520329 2:188941703-188941725 ATTTGGTAGTGATGACGGGTGGG + Intergenic
944975187 2:205041893-205041915 GTTTGGGGGTTTTGAAGGATAGG - Intronic
945699147 2:213149748-213149770 GTGTGGTGGTGAAGAAGGGGAGG - Intronic
945781302 2:214175914-214175936 GTTTGGTTGTGGGGAATGGGAGG + Intronic
946176843 2:217927515-217927537 GTCTGGGGGAGCTGAAGGGTGGG + Intronic
946207960 2:218124446-218124468 GTTTTGTCAGGGTGAAGGGTAGG + Intergenic
946339682 2:219059446-219059468 GCTTGGTGGTGGGGACGGGAAGG - Intronic
947073066 2:226312516-226312538 GTGTGCTGGTGGTGGAGTGTAGG - Intergenic
947107855 2:226686281-226686303 GTATGGAGGTGGTGGCGGGTGGG + Intergenic
947372097 2:229457602-229457624 CTTTGGTGGTGGGGGTGGGTGGG - Intronic
947585209 2:231351847-231351869 GGGTGCTGGTGGTGAAGGGAGGG - Intronic
947944411 2:234089293-234089315 GATGGGTGGTTGTGAGGGGTTGG + Intergenic
948273105 2:236688795-236688817 GGTTGGGGGTGGGGAGGGGTGGG + Intergenic
948675630 2:239594941-239594963 TTTTGCTGGTGGTGGAGGCTGGG + Intergenic
1168994252 20:2120893-2120915 CTTGGGTGGTGGGGAGGGGTGGG + Intronic
1169115111 20:3059481-3059503 CAATGGTGGTGGTGAAGGGCAGG - Intergenic
1170396794 20:15934487-15934509 GGTTGGGGGTGGGGGAGGGTTGG - Intronic
1170449479 20:16467301-16467323 GTGAGGTGGTGGTGAGGCGTGGG - Intronic
1171108864 20:22462290-22462312 GCTTGGTGGTGGTGTAGAATGGG - Intergenic
1172581004 20:36048085-36048107 GGTTGGTGGTGGAGAGGAGTTGG - Intergenic
1173785921 20:45792607-45792629 GTGGGGTGGAGGTGGAGGGTGGG - Intronic
1174183383 20:48688921-48688943 GCGTGGTGGTGGTGGAGGGCAGG - Intronic
1174691680 20:52512449-52512471 CTTTGATGGTGGTTAAGGGGTGG - Intergenic
1175193589 20:57227389-57227411 ATTTGGTGCTGGTGGGGGGTGGG - Intronic
1175831530 20:61967522-61967544 GTTTGATGGTGCTGAGGGGCGGG - Intronic
1175932258 20:62498481-62498503 GTTGGGTGTTGGGGATGGGTGGG + Intergenic
1175932317 20:62498632-62498654 GGTGGGTGGTGGGGATGGGTGGG + Intergenic
1178515553 21:33244174-33244196 GTTGGTTGGGGGTGAAGAGTTGG + Intronic
1178727471 21:35066791-35066813 GTTTGGGGGTGGGGCGGGGTGGG + Intronic
1180185907 21:46139088-46139110 GCTTGGTGGAGGAGCAGGGTAGG + Intronic
1181010215 22:20035779-20035801 GTTTGGTGCTGTTGCAGGGGAGG + Intronic
1181607239 22:23988119-23988141 AGGTGGTGGTGGTGCAGGGTTGG - Intergenic
1182859620 22:33547985-33548007 GTTGGGGGGTGGGGTAGGGTTGG - Intronic
1182908341 22:33957868-33957890 GTTTGATGGAGGTGAAGGGTGGG - Intergenic
1183786537 22:40032173-40032195 GCTTGGTGGTGGTGTGGGGTGGG - Exonic
1183897514 22:40981076-40981098 TTTTGGTGGTGGTGAGTTGTTGG + Intergenic
1185271624 22:49932120-49932142 GTCTGGTGGTGGTGGCGGGCGGG + Intergenic
949128730 3:476197-476219 GTTTGGTAATGGTAGAGGGTAGG + Intergenic
950076668 3:10192270-10192292 GTTTGACGGGCGTGAAGGGTTGG + Intronic
950490346 3:13300809-13300831 GTTTGGGAGTGGGGAAGGGAGGG + Intergenic
950494394 3:13325037-13325059 GTTTGGTGCAGGTTGAGGGTGGG - Intronic
950791318 3:15474581-15474603 GTTGTGTGGTGGTGAAAGCTTGG + Intronic
950853350 3:16083331-16083353 TTTTGGTGGTGATGATGGTTGGG + Intergenic
951845212 3:27077670-27077692 GGCTTGTGGTGGTGAAAGGTGGG - Intergenic
952224904 3:31365550-31365572 GTTTTGTGGATGTGAAGGCTAGG - Intergenic
952560874 3:34592267-34592289 GTTTGATTGTGGTGTAAGGTGGG + Intergenic
953224018 3:40999906-40999928 GTCTGGAGGTGGGGAAGGGTGGG - Intergenic
953409798 3:42684317-42684339 GTCTGGTGGTGGGGCGGGGTGGG + Intergenic
953662876 3:44903839-44903861 GTTTGGGGGTGGTCCGGGGTGGG + Intronic
953827290 3:46264888-46264910 GTGGGGTGGTGGTGAAGAATGGG - Intronic
954201482 3:49025894-49025916 GGTTTGTGGTGCTGATGGGTGGG - Intronic
954269913 3:49499741-49499763 TATTGGTGGTGGTGATGGGAGGG + Intronic
954279136 3:49563463-49563485 GCTTTGTGATGGGGAAGGGTGGG + Intronic
954405871 3:50344812-50344834 GGCTGGTGGTGGGGAAGGGGTGG - Intronic
955695175 3:61628715-61628737 GTTTGGAGGTGGGGTAAGGTAGG + Intronic
955761726 3:62292113-62292135 ATTTGGTGTTGGTGATGAGTTGG - Intronic
956832713 3:73069286-73069308 GGTGGGTGGTGGCGCAGGGTCGG - Intergenic
956956901 3:74351729-74351751 ATATGCTGGTGGTGGAGGGTAGG + Intronic
957548246 3:81668213-81668235 GTGGGGTGGGGGTGAAGGGAGGG + Intronic
957788148 3:84906655-84906677 GTGTGGTGGGGGGCAAGGGTAGG - Intergenic
959094877 3:101943905-101943927 GTTTGGTGGGAGTGGAGGGGTGG + Intergenic
959268395 3:104172297-104172319 GTTTGGTGCGGGACAAGGGTGGG + Intergenic
960160531 3:114345699-114345721 CTGGGGTGGGGGTGAAGGGTGGG + Intronic
961026254 3:123560536-123560558 GTTTAGTGGTGGTGATGGCAGGG - Intronic
962621161 3:137181226-137181248 TTGTGGTGGTTGTAAAGGGTAGG - Intergenic
962851201 3:139309471-139309493 GTTTGGTGGTGGTATTGGGAGGG - Intronic
964703304 3:159592493-159592515 GTTTGGTGTTACTGCAGGGTAGG - Intronic
965321921 3:167261672-167261694 GTTGGGTGGTGGGGCATGGTGGG - Intronic
965416073 3:168394545-168394567 GTTTGGTGGTGCTTATGGGGTGG + Intergenic
965540871 3:169870327-169870349 GTGGGGTGGTGGTGCAGGGTTGG - Intergenic
966524512 3:180906539-180906561 GTGTGGTGGTGGTGATGGTGGGG - Intronic
966592808 3:181700405-181700427 TTTTGGTGGTGGTTACGGGTAGG + Intergenic
966975335 3:185077777-185077799 ATTTGGTGGTGGTGGGGGGGGGG + Intergenic
967158899 3:186718066-186718088 GGTTGGTGGTGGTGGGTGGTGGG - Intronic
967512691 3:190330551-190330573 ATCCGGTGGTGGTGAAGGGTGGG + Intronic
967740984 3:193001834-193001856 TTTTGTTTGTGGTGAAAGGTAGG + Intergenic
969028542 4:4193334-4193356 GTGTGGTGATGGGGAAGGGCAGG - Intronic
970192136 4:13527481-13527503 TTTGGGTGGTGGGGCAGGGTAGG + Intergenic
970511764 4:16788314-16788336 CTTTGGGGGTGGTGATGGGAAGG + Intronic
970828261 4:20304760-20304782 GTATGGTGGGGGTGAGGGGATGG - Intronic
971054642 4:22898443-22898465 TTTTGGTGGAGGTGGAGGGTGGG + Intergenic
971114651 4:23630745-23630767 GTGTGGTGGTGGTGGACGGGGGG - Intergenic
971117782 4:23668070-23668092 GTATGGTGGTGGTGATACGTTGG + Intergenic
973745148 4:53956762-53956784 GTCTGGGGGTGGGGAAGGGGAGG + Intronic
973851012 4:54961670-54961692 GTTTAGTGGTGATGTAGGGTAGG - Intergenic
974065121 4:57070359-57070381 GTTTAGTTGTGGGGAAGGGACGG - Intronic
975064947 4:70049226-70049248 GCCTGGTGGTGGGGAAGGGAGGG - Intergenic
975447123 4:74479024-74479046 GTATAGTGATGGTCAAGGGTGGG - Intergenic
976659296 4:87522620-87522642 GTTTGGTGGTGGTGGCTGGGAGG - Intronic
977805598 4:101293696-101293718 CTGTGGTGGAGGTGAAGGGAGGG - Intronic
977924274 4:102682305-102682327 GATTGGTGGAGGGGGAGGGTAGG + Intronic
977953835 4:103003884-103003906 GTTTGGTTGTGGTATAAGGTGGG - Intronic
978185119 4:105848525-105848547 TTTTGGTGGTGGTGGTGGGGGGG - Intronic
978416644 4:108483854-108483876 GGGTGGGGGTGGTGAAAGGTAGG - Intergenic
978727500 4:111986330-111986352 GGAAGGTGGTGGTGAAGTGTGGG + Intergenic
979013267 4:115397571-115397593 GTTTGGTGGTGGGGCAGGGGTGG - Intergenic
980025274 4:127758641-127758663 GTTTGTATATGGTGAAGGGTAGG + Intronic
980164248 4:129205781-129205803 ATTGGGTAGTGGTGAAGTGTAGG + Intergenic
980250776 4:130311766-130311788 GTGTGGTAGTGTTGAAAGGTGGG - Intergenic
981405899 4:144368797-144368819 GGTTGGGGGTGGTAAAGGGATGG + Intergenic
981434836 4:144708246-144708268 GGTTGGTGCTGTTGAAGTGTGGG - Exonic
981488241 4:145311330-145311352 GCAATGTGGTGGTGAAGGGTTGG + Intergenic
982288587 4:153759095-153759117 ATTTGGGGGTGGAGGAGGGTAGG - Intronic
982644212 4:158002510-158002532 GCTGTGTGGTGGTGAAGGGTCGG + Intergenic
982717738 4:158826624-158826646 TGGTGGTGGTGGTGTAGGGTGGG + Intronic
985392419 4:189504429-189504451 GGTGGGTGGTGGTTAATGGTAGG - Intergenic
985511984 5:318289-318311 GATTGGGGGAGGTGCAGGGTTGG - Intronic
985776800 5:1848555-1848577 CTTTGGTGGTGGGGGAGGCTGGG + Intergenic
986650556 5:9959424-9959446 GTTTGGTGGTGGTGGTAGGTAGG - Intergenic
987411345 5:17618075-17618097 GTTTTGTGGTGGTGAGTTGTTGG + Intergenic
988220218 5:28335454-28335476 GTTGGGTAGTGGTGAAGTCTGGG - Intergenic
988249556 5:28738557-28738579 GTTTGATTGTGATAAAGGGTTGG - Intergenic
988344660 5:30021375-30021397 TTTTGGTGGAGGTGATGGGGTGG - Intergenic
988531050 5:32027430-32027452 GTTTGGGGGTGATGAATGGGAGG + Intronic
988585708 5:32505712-32505734 ATTTGGTGGCGGGGAAGGGCTGG + Intergenic
989041829 5:37237515-37237537 GTTGTGTAGTGGTGAAGTGTGGG - Intronic
989299196 5:39868842-39868864 TTTAGGAGGTGGTGAAGTGTGGG + Intergenic
989453370 5:41612974-41612996 GTTTGGTGCTGGTGAAGTATGGG - Intergenic
989683587 5:44058755-44058777 GTTGTGTGGTGGTAAGGGGTGGG + Intergenic
991213644 5:64135530-64135552 GTTTGGTGGTTGGGGATGGTGGG + Intergenic
992547909 5:77833109-77833131 GTCTGGTGGTGGTGGTGGTTTGG + Intronic
992560023 5:77942346-77942368 GATTGGTGGTTGTCAAGGGCTGG + Intergenic
992608112 5:78482438-78482460 GAGTGGTGGTGGTGAAGGGCTGG + Intergenic
992810773 5:80386296-80386318 GTGTGGTGGTGGAGAGGGGCAGG + Intergenic
992861609 5:80916566-80916588 GTTTGGTGGTAGAGATGGGGAGG - Intergenic
993178398 5:84518196-84518218 GTTTGATTGTGGTAAAAGGTGGG + Intergenic
994001642 5:94788568-94788590 GTTTGGTGGTGGTGGGGGAAGGG - Intronic
995488101 5:112659251-112659273 GTTTGATTGTGGTAAAAGGTGGG - Intergenic
995793136 5:115915206-115915228 GTGGGGTGGTGGTGAGGGGAGGG - Intergenic
997052837 5:130403043-130403065 GTTTGGTGGTGGGGGTGGGTAGG - Intergenic
997633187 5:135385411-135385433 CTTTGGGGGTGGGGATGGGTTGG + Intronic
998166811 5:139848757-139848779 GGTTGGGGGTGGGGTAGGGTGGG + Intronic
998377767 5:141702504-141702526 GCCTGGCGGTGGGGAAGGGTGGG - Intergenic
998451994 5:142241910-142241932 GTTCGGGGGTGGTGGGGGGTGGG - Intergenic
998689981 5:144576886-144576908 GTGTGGGGGGGGTGAGGGGTAGG + Intergenic
999616488 5:153430247-153430269 GTTTAGGAGTGGGGAAGGGTGGG + Intergenic
999924343 5:156358878-156358900 GACTGGTGGTGGTGGTGGGTGGG + Intronic
1000164529 5:158635105-158635127 GGTGGGGGGTGGTGATGGGTGGG - Intergenic
1000525626 5:162353844-162353866 GTTGTGTAGTGGTGAAGTGTGGG + Intergenic
1000813055 5:165886758-165886780 GGTTCCTGGAGGTGAAGGGTTGG - Intergenic
1001098088 5:168791389-168791411 GTTTGGAGGTGCTGGAGAGTGGG + Intronic
1001421225 5:171588837-171588859 GTGTGGTGGTGGTGAGGGTATGG + Intergenic
1002087763 5:176786358-176786380 GCTTGGTGGTGCTGAGGGGCTGG + Intergenic
1002476440 5:179469080-179469102 GTGTGGTGCAGGTGAGGGGTGGG - Intergenic
1002662141 5:180798431-180798453 TGTTGCTGTTGGTGAAGGGTAGG - Intronic
1003968585 6:11277400-11277422 GTTTGGGGGTGGGGAAGTGGTGG + Intronic
1004183291 6:13399166-13399188 TTTTGGTGGTGGGGGAGGGAGGG + Intronic
1004594041 6:17081886-17081908 CTTTGGTGGTGGTGACAGGTGGG - Intergenic
1004982532 6:21042261-21042283 GTATGGTGGTGGAGTAGGGTGGG - Intronic
1005512601 6:26524555-26524577 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1006901808 6:37507704-37507726 GGTAGGTGGTGGTGGGGGGTGGG + Intergenic
1006901899 6:37507911-37507933 GGTAGGTGGTGGTGGTGGGTGGG + Intergenic
1007256522 6:40533541-40533563 CTTTGGTGGGGGTGAGAGGTAGG - Intronic
1007314090 6:40970567-40970589 GCTTGGTGGAGTTGAAGGGGTGG - Intergenic
1007337371 6:41163231-41163253 GTCTGGAGGCGGTGCAGGGTGGG + Intergenic
1007557975 6:42782635-42782657 GGTTGGTGGTGGGGAGGGGAGGG + Intronic
1008136417 6:47782294-47782316 GTTTAGTGGAGGCGAAGAGTGGG + Intronic
1008821106 6:55631328-55631350 ATTTGGTGTTCCTGAAGGGTGGG + Intergenic
1008880537 6:56376826-56376848 GTTTGGGGGGGGTGGGGGGTGGG - Intronic
1009025264 6:57992084-57992106 GTTTGATGCTGGTGAAGGTGTGG - Intergenic
1011190522 6:84723166-84723188 GAATGGTGGTGGTCAGGGGTTGG - Intronic
1011888539 6:92127772-92127794 TGATGGTGGTGGTGAGGGGTTGG - Intergenic
1013270498 6:108541283-108541305 GTGTGGTTTTGGTGAAGGGATGG + Intergenic
1013324492 6:109031406-109031428 GTTTGGTGGTGGTGTGAGGCTGG - Intronic
1014074062 6:117216382-117216404 GTTTGGTGTTGCTGCAGGGAGGG + Intergenic
1014930101 6:127325644-127325666 GCTTGGTGGTGGGGATGGGCAGG - Intronic
1015154331 6:130075080-130075102 GGTTGGTGGTGGTGATGGGAAGG + Intronic
1016749305 6:147614663-147614685 GATTTGGGGTGGGGAAGGGTTGG + Intronic
1016943550 6:149506045-149506067 GTTTTGGGGGAGTGAAGGGTGGG - Intronic
1017097601 6:150818507-150818529 TTTTGGTGGTGGTAGAGGTTGGG - Intronic
1017979307 6:159385655-159385677 ATTTGGTGGTGGGGTAGGGGGGG - Intergenic
1019821686 7:3248473-3248495 GTATGGTGGGGGCGAGGGGTGGG - Intergenic
1019870422 7:3755675-3755697 GTTTGTTTGGGGTGAGGGGTTGG - Intronic
1019892482 7:3957150-3957172 GATTAGTGGTTGTGAGGGGTGGG + Intronic
1019972726 7:4554600-4554622 GTTGGGGGGTGGTGAGGGGAGGG - Intergenic
1020094924 7:5362860-5362882 GTTTGGGGTTGGGGAAGGGGTGG - Intronic
1020809214 7:12830751-12830773 TTTTTGTGGTGGGGAGGGGTGGG + Intergenic
1021704322 7:23351751-23351773 GGGTGGTGGTGGTGCGGGGTGGG - Intronic
1022055382 7:26727413-26727435 TTTTGGTGGTGGTGCTGGGGAGG - Intronic
1022299768 7:29091902-29091924 GCTTGGTGGAGGTGTGGGGTAGG + Intronic
1022472762 7:30691842-30691864 TAGTGGTGGTGGTGATGGGTGGG + Intronic
1023193120 7:37604319-37604341 GTTTGGAGGTGGTGAAGAGGTGG + Intergenic
1024385535 7:48747980-48748002 GTTTGGTTGTGGTATAAGGTGGG + Intergenic
1024478060 7:49834891-49834913 GTGTGGTGGTGGTGGAGGCCAGG + Intronic
1024498171 7:50071130-50071152 GGTTGGTGGTGGGGTAGGGGTGG - Intronic
1025756627 7:64350798-64350820 GTTTGGTGGTGGTGGTGGGTGGG + Exonic
1025790222 7:64681510-64681532 TTGTGGGGATGGTGAAGGGTTGG - Intronic
1025947507 7:66115479-66115501 GTTTTGGGGTGGAGAAGGGAAGG + Intronic
1026972347 7:74476077-74476099 GCCTGGTGGTGGTGAGGGATGGG + Intronic
1027723161 7:81770204-81770226 GTTTGGTGCTGTTGAAGGGGGGG - Intronic
1028760168 7:94487306-94487328 GTTGGGTGGTGGTGATGGTGGGG - Intergenic
1029126120 7:98296180-98296202 GTCTGGTGTTGGAGAAGGGATGG + Intronic
1029175815 7:98663622-98663644 GAATGGTGGTGGTGATGGGTTGG + Intergenic
1030924481 7:115434865-115434887 TTTTGGTTATGGTGAAAGGTGGG - Intergenic
1031057933 7:117014108-117014130 ATTTGGTAGTGGTGGAGGGTGGG + Intronic
1031075545 7:117208868-117208890 CTTTGGTGGTGGTGGTGGGGTGG + Intronic
1031407355 7:121402680-121402702 TTTGTGTGGTGGTGAGGGGTGGG - Intergenic
1031448587 7:121885679-121885701 TTTTGGGGGTGGGGAAGGGTTGG - Intronic
1031548255 7:123076975-123076997 ATTTGGTGGAGGAGAAAGGTAGG + Intergenic
1032259054 7:130319948-130319970 GTTTGGTGGTGGGGCAGGTATGG + Intronic
1032610568 7:133408209-133408231 TATTGGTGGTGATGATGGGTGGG + Intronic
1033981374 7:147170216-147170238 GTTTTGTGGTGGTGTAGTTTGGG + Intronic
1034440349 7:151082890-151082912 GTTTGGTTGGGGTGAAGTTTAGG - Exonic
1034889801 7:154829807-154829829 GTTTGGTGGTGGTGAAGGGTGGG - Intronic
1035142786 7:156780826-156780848 GAAGGGTGGAGGTGAAGGGTAGG - Intronic
1035264429 7:157683332-157683354 GCTTGGCGGTGGAGGAGGGTGGG + Intronic
1036435912 8:8733064-8733086 GCATGTTGGTGGTGAAGGGTGGG + Intergenic
1036796276 8:11758688-11758710 GTGTGCTCGTGCTGAAGGGTGGG - Exonic
1037040850 8:14230754-14230776 TTTTGGTGGTGGTGGGGGGGTGG + Intronic
1037674965 8:21043845-21043867 GGTTGGGGGTGGTGGAAGGTAGG - Intergenic
1038164608 8:25073360-25073382 TTTTGGTGGGGGTGAATGTTTGG - Intergenic
1038495522 8:27999432-27999454 GGAAGGTGGTGGTGAAGGGCAGG - Intergenic
1038539270 8:28378115-28378137 GGTTGGTGGTGGTGGGGGGCCGG - Intronic
1039554479 8:38466896-38466918 TTTTGGTGGTGGTGGGGGGGGGG - Intronic
1040452574 8:47562812-47562834 GTTTGGCGGGGATGAAGGGTGGG - Intronic
1040472539 8:47746748-47746770 GATTGTTGGTGGTGAAGGAGGGG + Intergenic
1041622157 8:59984108-59984130 GAATGGTGGTTATGAAGGGTTGG - Intergenic
1042225924 8:66514245-66514267 GTTTCAGGGTGGTGAAGGGTTGG + Intronic
1042851963 8:73225793-73225815 GGGTGGTGGTGGTGGAGGGCTGG - Intergenic
1042955555 8:74246336-74246358 GTTTGTCTGGGGTGAAGGGTTGG - Intronic
1043210184 8:77504306-77504328 GTGTGGTGGTGTTGGAAGGTGGG - Intergenic
1043414487 8:80033452-80033474 GTCTGGTGCCGGTGAAAGGTGGG + Intronic
1043881066 8:85543556-85543578 ATTTATTGGTGGTGATGGGTGGG + Intergenic
1044071536 8:87766772-87766794 GAATGGTGGTTGTGAGGGGTGGG + Intergenic
1045351469 8:101344610-101344632 CTTTGGTGGTGGTGATGGTCAGG + Intergenic
1045409688 8:101904523-101904545 GAGGGGTGGTGGTGAAGGGATGG - Intronic
1045445355 8:102256765-102256787 TTTTGGGGGTGGTGGAGGGAAGG - Intronic
1045722027 8:105123791-105123813 GTTTGGTGGTAATGAAGGCGGGG - Intronic
1045775498 8:105797705-105797727 GTTTGGTGGAGAAGAGGGGTTGG - Intronic
1046008929 8:108522108-108522130 TATTGTTGGTGGTCAAGGGTAGG + Intergenic
1046787143 8:118280061-118280083 TTTTGGTGGTGGTGATGTGTAGG + Intronic
1047075294 8:121394228-121394250 GTTTTGTGGTGTTGAAATGTTGG + Intergenic
1047173930 8:122522498-122522520 ATGTGGTGGTGTTGGAGGGTGGG + Intergenic
1047464426 8:125098789-125098811 GTTTGGGGGAGGGGTAGGGTGGG + Intronic
1048025613 8:130584011-130584033 GTTTGGTGGGGGCGGAGGGTAGG + Intergenic
1050424843 9:5502267-5502289 GTATGCTGGTGGGGAAGGGAAGG - Intergenic
1050475353 9:6034909-6034931 GTGTGCTGGTGGAGAAGGGAAGG - Intergenic
1050966570 9:11811455-11811477 GTTTGATTGTGGTGTAAGGTGGG + Intergenic
1051241946 9:15066744-15066766 GGATGGTGATGGTTAAGGGTAGG - Intergenic
1051246052 9:15112711-15112733 ATTTGGTGCTGGCGAAGGTTTGG - Intergenic
1051438501 9:17057519-17057541 GATTGGTGGTGGTGACGGGTGGG - Intergenic
1051644580 9:19254992-19255014 GTGTGGTGGTGGTGGAGGGGGGG + Intronic
1052456665 9:28707755-28707777 TTGTCGGGGTGGTGAAGGGTGGG + Intergenic
1052493443 9:29195026-29195048 GTTTGGGGGTGGGGGTGGGTAGG - Intergenic
1052512110 9:29435092-29435114 GGATGGTGGTAGTGGAGGGTCGG + Intergenic
1053104332 9:35397333-35397355 GTGTGGTGGTGGTAAGGGGGAGG - Intronic
1054788096 9:69228833-69228855 GTAGGGTGGTGGGGAAGGGTTGG - Intronic
1054877308 9:70110484-70110506 GTTAAGTGGAGGTGCAGGGTAGG + Intronic
1054937066 9:70699352-70699374 GTTTGGTGGTGGGGAGGTGCAGG + Intronic
1055587086 9:77766631-77766653 GTGTGGTGGGGGTGTAGGGTGGG + Intronic
1056072049 9:82997508-82997530 TTTTGGTGGTGGTGGTGGTTAGG + Intronic
1056926526 9:90839288-90839310 GTATGTTGGTGGTGATGGTTTGG - Intronic
1058315101 9:103554929-103554951 GTTTGATTGTGGTAAAAGGTGGG - Intergenic
1058349287 9:104002125-104002147 GGTTGGTGGTGGAGAGGAGTTGG + Intergenic
1058544869 9:106050555-106050577 ATGTGGTAGCGGTGAAGGGTTGG - Intergenic
1059299533 9:113300923-113300945 GTGTGATGGTGGTGCAGGTTAGG + Intronic
1059347115 9:113636475-113636497 TCATGGTGGTGGTGACGGGTAGG + Intergenic
1059689441 9:116670546-116670568 GTTGGGTAGAGGTGAGGGGTTGG + Intronic
1059693336 9:116707520-116707542 ATTTGGTGGTGGTGTGGGGAGGG - Intronic
1060633001 9:125176681-125176703 GATTGATGGTGGTGGAGGGGTGG + Intronic
1061770705 9:132918629-132918651 GGCTGGTGGTGAGGAAGGGTTGG - Intronic
1061818107 9:133208086-133208108 GGTTGGCGGTGGGGGAGGGTGGG + Intronic
1061899735 9:133666677-133666699 GTTTGGAGCTGGTGAGGGATCGG + Intronic
1062533277 9:137010902-137010924 GTTCGGGGGTGGGGCAGGGTAGG - Intronic
1185860559 X:3574798-3574820 GTGTGGGTGTTGTGAAGGGTCGG + Intergenic
1186561138 X:10614620-10614642 GTTTGGAGGTGGGGAAGGGAAGG + Intronic
1187452420 X:19410757-19410779 GTGTAGTGGTAGTGAAGGGAGGG - Intronic
1187965354 X:24606261-24606283 GTTTGGAGGTGGTTAGGTGTGGG - Intronic
1187995142 X:24918192-24918214 TTTTTTTGGTGGTGATGGGTGGG - Intronic
1188292783 X:28409799-28409821 GTTTGCTGGAGCTCAAGGGTGGG + Intergenic
1188364977 X:29304580-29304602 GTGTGGTTGGGGTGATGGGTAGG + Intronic
1188835369 X:34948248-34948270 GTGTGCTGGTGGAGAAGGGAAGG - Intergenic
1189222630 X:39385357-39385379 GATTGGGGGTGGTGAGGGGAGGG - Intergenic
1189365245 X:40383207-40383229 GATTGGTGGGGGTGGGGGGTGGG + Intergenic
1189824057 X:44898925-44898947 GCTTGGTGGTGGTGGTGGGGGGG + Intronic
1191726769 X:64289967-64289989 GATTGGTGGTTGTCAGGGGTAGG + Intronic
1191898835 X:66020887-66020909 GTTGGGTGGCGGTGAAGTGGAGG + Intergenic
1192872035 X:75194164-75194186 GTTTGGTTGTGGTATAAGGTGGG + Intergenic
1192981806 X:76351914-76351936 GTTTCATTGGGGTGAAGGGTCGG - Intergenic
1192982915 X:76366477-76366499 GTTTGATTGTGGTGTAAGGTGGG + Intergenic
1193304697 X:79934306-79934328 GTGGGGTGGTGGGGAAGGGGAGG + Intergenic
1193397355 X:81001336-81001358 GGTTGGTGGTGGAGAGGAGTTGG - Intergenic
1193536226 X:82718691-82718713 TTTTGGTGGTTGTTATGGGTTGG - Intergenic
1193905313 X:87236929-87236951 GCTGGGTGGTGGGGGAGGGTTGG - Intergenic
1194072064 X:89338184-89338206 GTCTGGTGATGGTTAAGTGTAGG - Intergenic
1194102081 X:89717929-89717951 GTGTGGTGGTGGGAAAGGGGAGG + Intergenic
1194211471 X:91074539-91074561 AGTTGGTAGTGGTTAAGGGTGGG + Intergenic
1194348166 X:92792800-92792822 TGTTGGCGGTGGTGAAGGGGTGG - Intergenic
1194394762 X:93368800-93368822 GTTTGGAGGTGGAGACTGGTGGG - Intergenic
1194708003 X:97199666-97199688 GCTTGGTGGAGGAGTAGGGTAGG + Intronic
1195329216 X:103783005-103783027 GTTTGGGGGTGGGGAGGAGTTGG + Intronic
1196742839 X:119040462-119040484 TTTTGATGGGGGAGAAGGGTCGG + Intergenic
1197422605 X:126257598-126257620 GTTTGATTGTGGTGTAGGGTGGG + Intergenic
1197856756 X:130921033-130921055 GATTGGTGGGGGAGAAGGGTAGG + Intergenic
1198079272 X:133223708-133223730 GATTGGTGGTGGTCAAGGCAGGG + Intergenic
1198125753 X:133642039-133642061 GTTTGATTGTGGGGCAGGGTGGG - Intronic
1198150065 X:133899622-133899644 GTTGGGTAGTGGTGGAGTGTGGG - Intronic
1198304122 X:135364110-135364132 TCTTGGTGTTTGTGAAGGGTTGG + Intergenic
1198958896 X:142162591-142162613 CTTTGGCGGGGGTGGAGGGTGGG + Intergenic
1199006016 X:142696551-142696573 GTTTGCATGTGGAGAAGGGTTGG + Intergenic
1199254341 X:145701240-145701262 TTCTGGTGGGGGTGAAGGATGGG + Intergenic
1199374243 X:147088356-147088378 GTGTGGTGGTGGTGATGGGCGGG - Intergenic
1200454757 Y:3376177-3376199 GTGTGGTGGTGGGAAAGGGGAGG + Intergenic
1200656495 Y:5909429-5909451 TGTTGGCGGTGGTGAAGGGGTGG - Intergenic
1200726307 Y:6673935-6673957 GTCTGGTGATGGTTAAGTGTAGG - Intergenic
1200949597 Y:8881645-8881667 GTGAAGTGGTGGTGACGGGTAGG + Intergenic
1201338396 Y:12904748-12904770 GGGTGGTGGTGGTGGAGGGGTGG + Intronic