ID: 1034889802

View in Genome Browser
Species Human (GRCh38)
Location 7:154829808-154829830
Sequence TGTTTGGTGGTGGTGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 806
Summary {0: 1, 1: 0, 2: 13, 3: 81, 4: 711}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889802_1034889811 7 Left 1034889802 7:154829808-154829830 CCACCCTTCACCACCACCAAACA 0: 1
1: 0
2: 13
3: 81
4: 711
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889802_1034889810 6 Left 1034889802 7:154829808-154829830 CCACCCTTCACCACCACCAAACA 0: 1
1: 0
2: 13
3: 81
4: 711
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889802_1034889808 -2 Left 1034889802 7:154829808-154829830 CCACCCTTCACCACCACCAAACA 0: 1
1: 0
2: 13
3: 81
4: 711
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889802 Original CRISPR TGTTTGGTGGTGGTGAAGGG TGG (reversed) Intronic
900692400 1:3988499-3988521 TGATGGGTGGTGTTGAAGGCTGG - Intergenic
900712898 1:4125845-4125867 TATTTGGTGGTGGTGGGGGGGGG - Intergenic
900759797 1:4463066-4463088 GGTCTGGTGGTGGTGGAGGGTGG + Intergenic
900913807 1:5620430-5620452 TGTGTGGTGGTGGTGGGGTGGGG + Intergenic
901229691 1:7634805-7634827 TGGTTGGTGGTGGTAGAGCGGGG + Intronic
901517107 1:9755375-9755397 TCTTTGGGGGTGGAGATGGGGGG - Intronic
901618256 1:10559612-10559634 CGTTGGGTGGTGGTGGGGGGAGG - Intronic
902298576 1:15485322-15485344 TCCTTGGGTGTGGTGAAGGGAGG - Intronic
903438873 1:23372141-23372163 AGTTTGGAGGTGGAGAAGGTGGG + Intergenic
903707263 1:25295448-25295470 TGATTGGAGCTGCTGAAGGGAGG + Intronic
903719977 1:25397894-25397916 TGATTGGAGCTGCTGAAGGGAGG - Intronic
903790815 1:25891796-25891818 TGTGTGTTGGTGGTGGGGGGTGG - Intronic
904076961 1:27850449-27850471 TTTTTGGTCATGGAGAAGGGTGG + Exonic
904301045 1:29555278-29555300 GGTCAGGAGGTGGTGAAGGGTGG - Intergenic
904377979 1:30093789-30093811 TTGCTGGTGGTGGTGGAGGGTGG + Intergenic
904498136 1:30898980-30899002 CGTTAGGTGGTGGTGAGGAGTGG - Intronic
904741682 1:32682017-32682039 TGAATGGTGATGGTGATGGGAGG + Exonic
905105221 1:35559747-35559769 TGTGTGTGGGGGGTGAAGGGAGG + Intronic
905899692 1:41573344-41573366 TGTTTGGAAATGGTGAAGGAGGG - Intronic
906083160 1:43107551-43107573 TGGTGGGTGGTGGGGAATGGGGG + Intergenic
906194494 1:43921314-43921336 TGCTTGGCTGTGGGGAAGGGTGG - Intronic
906614440 1:47225118-47225140 TGCTTGGTGGTGGTGTCGTGGGG - Intronic
906639215 1:47431662-47431684 TGGGTGGTGGTGGTGGATGGGGG + Intergenic
906836423 1:49087057-49087079 TTTTTGTTGGTGGTGGTGGGTGG - Intronic
907766595 1:57418612-57418634 AATTTTGTGGTGGTGAAGGCGGG - Intronic
908418372 1:63935147-63935169 TCTTTGGTGGTGGTGTTGGCAGG - Intronic
908420160 1:63951710-63951732 TGTGGGCTGGTGGTGAGGGGGGG - Intronic
909053657 1:70797289-70797311 TGTTGGGGGGTGGGGGAGGGGGG + Intergenic
909575592 1:77172678-77172700 TGTTGGGAGGTGGAGGAGGGTGG + Intronic
910186731 1:84549517-84549539 TATTTGGTGGTGGTGGCGGGAGG + Intergenic
910773208 1:90850908-90850930 TGTGTGGTGGTCGTGGAGGAGGG - Intergenic
910810239 1:91228271-91228293 TGTTGGGAGTGGGTGAAGGGAGG - Intergenic
911365693 1:96934770-96934792 TCTTTGGTGGTTAGGAAGGGTGG + Intergenic
911369950 1:96984950-96984972 TGGGGGGTGGGGGTGAAGGGAGG - Intergenic
911510241 1:98802089-98802111 TTTTTGGTGGTGGGGTAGGAGGG + Intergenic
912364087 1:109118653-109118675 TGTAGGGTGATGGTGACGGGCGG + Intronic
912514873 1:110211144-110211166 TCTTTGGTCGGGGTGAAGGCGGG + Intergenic
912553479 1:110499347-110499369 TGTCAGGTGGTGGTGGTGGGGGG + Intergenic
912748093 1:112262666-112262688 TGTGTGTTGATGGTGAAGGAGGG - Intergenic
913097186 1:115529591-115529613 GGTTTGCAGGTGGTGAAGGAAGG + Intergenic
914410060 1:147418788-147418810 TTTCTGGTGGAGGTGAAGCGCGG + Intergenic
914743847 1:150486825-150486847 GGTTTGGTGGGGGGGAGGGGAGG + Intergenic
915528677 1:156491026-156491048 TGTTTTGTGGGGGTGCGGGGTGG - Intronic
916191090 1:162178981-162179003 TTTTTGGTGGGGGTTGAGGGGGG + Intronic
916320206 1:163497173-163497195 TGGATGGTGGAGGTGAAGTGTGG - Intergenic
916324494 1:163541907-163541929 TGAATGGTGCTGGTGAAAGGAGG - Intergenic
916945114 1:169718544-169718566 AGTTTGGTGATGGTGAAGACAGG - Intronic
917117550 1:171617704-171617726 TGTTTTGTGGTGGGGAAAAGTGG + Intergenic
917193361 1:172442296-172442318 TCATTGATGGAGGTGAAGGGCGG - Exonic
917247185 1:173016708-173016730 AGTGTGGTGGTGGTGAGAGGAGG + Intergenic
918877624 1:190070047-190070069 TGGGTGGTGGGGGTGAGGGGAGG - Intergenic
919650474 1:200144167-200144189 TGGTGGTTGGTGGTGATGGGAGG - Intronic
920098206 1:203500126-203500148 TGGGTGGTGGTGGTGGAGGTAGG - Intronic
920098234 1:203500207-203500229 TGGTAGGTGGTGGTGGAGGTGGG - Intronic
920098261 1:203500289-203500311 TGGGTGGTGGTGGTGGAGGTGGG - Intronic
920101901 1:203522058-203522080 TGTCTGGTGGCAGGGAAGGGGGG - Intergenic
920120277 1:203650837-203650859 CTTTTGGTGGTGGTAGAGGGAGG - Intronic
920249141 1:204610958-204610980 TATGTGGTGGAGGTGGAGGGTGG + Intergenic
920716143 1:208342200-208342222 TTTTTGGTGGTGGTGGTGGGGGG + Intergenic
920737308 1:208544640-208544662 AGCTTGGCTGTGGTGAAGGGCGG + Intergenic
921748868 1:218769467-218769489 TGTGTGGGGGTGGGGTAGGGTGG - Intergenic
922062147 1:222103174-222103196 TGGTTGGTGGTGGTGTCAGGAGG + Intergenic
922500411 1:226093415-226093437 TGTGTGATGGTGGTGGTGGGTGG - Intergenic
922540168 1:226413022-226413044 TGTGTGGTGGTGGGGTGGGGGGG + Intergenic
922587834 1:226749026-226749048 TATATGGTGGTGGTGAGTGGGGG + Intergenic
923203293 1:231733372-231733394 TGAGTGGTGGTGGTGATGGTAGG + Intronic
923268931 1:232337351-232337373 TGTTGTGTGGTGGTGATGGTTGG + Intergenic
923337977 1:232986315-232986337 TGGCCGGTGGTGGTGACGGGCGG + Exonic
923616787 1:235544903-235544925 GGGGTGGTGGTGGTGGAGGGTGG + Intergenic
924005050 1:239600058-239600080 TTTTTGGTTTTGGTGATGGGTGG - Intronic
924696579 1:246406843-246406865 TGTTTGTTTGTTTTGAAGGGAGG - Intronic
924918844 1:248604499-248604521 TGTTGGGTGGTGGTGGGGGAAGG + Intergenic
1064744420 10:18464660-18464682 TGTGTGGTAGTGGTGAAGCTGGG - Intronic
1065322150 10:24519976-24519998 CGTGTGGTGGTGGTGGAGGGGGG - Intronic
1065815594 10:29479927-29479949 TGCTTGGTGCTGGGGAAAGGGGG - Intronic
1068394325 10:56442222-56442244 TGTTGTGGGGTGGTGGAGGGGGG - Intergenic
1068820025 10:61364434-61364456 TTGTTGGTGGTTGTGAGGGGTGG - Intergenic
1068891204 10:62149826-62149848 TGTTTGAGGGTGGGGAAGGTGGG - Intergenic
1070178358 10:73991941-73991963 TTTTGGGTGGAGGTGGAGGGTGG + Intergenic
1071175989 10:82927174-82927196 TCCTTGCTGGTGCTGAAGGGTGG + Intronic
1071367462 10:84913606-84913628 TCTTTAGTGGTGGTGAAGGCTGG + Intergenic
1071685287 10:87748594-87748616 TGTTGCGGGGTGGTGAGGGGAGG + Intergenic
1072040979 10:91606457-91606479 TGTTTGGTTATGGTGATGGCAGG - Intergenic
1072110085 10:92310731-92310753 GGATTGGTGGTGGTGAACTGGGG + Intronic
1072430622 10:95367859-95367881 TCTTCGGTGCTGGTGGAGGGTGG + Intronic
1072735850 10:97879208-97879230 GTGTTGGTGGTGGTGATGGGAGG - Intronic
1072743913 10:97926903-97926925 TGCTTGCTGATGGTGAAGGCTGG - Intronic
1072907720 10:99470210-99470232 TATTTGTTGGTGTTGAATGGGGG - Intergenic
1073051211 10:100668562-100668584 TGTGTGGTGGGGGTGTGGGGGGG - Intergenic
1073207800 10:101777839-101777861 TGTTGGGAGGAGGTGAAGGCAGG - Intronic
1073273295 10:102286032-102286054 TGTATTGTGGTGGGGAAAGGAGG - Intronic
1073285923 10:102388265-102388287 TATTTGGTGGCGGGGCAGGGAGG - Intergenic
1073440155 10:103547715-103547737 CGTGGGGTGGAGGTGAAGGGAGG + Intronic
1074350052 10:112727976-112727998 GGTATGGGGGTGGTGAAGAGGGG - Intronic
1074477625 10:113786962-113786984 TTTTTTGTGGTGGTGGGGGGGGG - Intergenic
1074733024 10:116397736-116397758 TGAGTGGTGGTGGTGAACGGGGG + Intergenic
1076213943 10:128677526-128677548 TGTTTGTTGGTGGATAAGGATGG - Intergenic
1077634913 11:3835845-3835867 TGTTTGTTTGTTTTGAAGGGAGG + Intronic
1077785512 11:5379309-5379331 TGTGGGGTGGGGGTGCAGGGAGG + Intronic
1077820099 11:5729031-5729053 TGTGGGGTGGGGGTGAGGGGAGG - Intronic
1078661570 11:13291416-13291438 TGTGTTGTGGTGGTGATGGAAGG + Intronic
1078835278 11:15022284-15022306 TGTTAGGGGGAGGTGAAGGGAGG + Intronic
1079204270 11:18400413-18400435 TGTGTGGTGGTGGTGGTAGGGGG - Intronic
1079360955 11:19770009-19770031 GGTTTGGTGGGGGTGAGGGTTGG - Intronic
1080697921 11:34619313-34619335 TGTGTAGTGATGGTGAAGGGGGG - Intergenic
1081570613 11:44288545-44288567 TGAATGGTGGTGGTGATGAGGGG - Intronic
1081896407 11:46591014-46591036 AATTTGGTGGTGTTGATGGGAGG - Intronic
1082315993 11:50723237-50723259 TTTGTGGTGGGGGTGGAGGGGGG - Intergenic
1082632915 11:55561878-55561900 TGTTGGGAAGTGGTGGAGGGAGG - Intergenic
1082863978 11:57881705-57881727 TTTTGGGGGGTGGTGTAGGGAGG + Intergenic
1082873078 11:57961562-57961584 TGGTTGGGGGTGGTGCAGGAAGG - Intergenic
1083780520 11:64915139-64915161 TGTTTGGGGTTGGTGGTGGGGGG - Intronic
1084240106 11:67813542-67813564 TGGCAGGTGGTGGTGAGGGGTGG + Intergenic
1084441146 11:69174108-69174130 TGTGTTGTGGTGGTGGAAGGTGG + Intergenic
1084569475 11:69950787-69950809 TTTTTTATTGTGGTGAAGGGTGG - Intergenic
1084585633 11:70060263-70060285 TGTTGGGAAGTGGTGGAGGGAGG + Intergenic
1084725352 11:70938232-70938254 TGTGTGGGTGTGGTGGAGGGGGG + Intronic
1085473645 11:76774182-76774204 AGTTTGGTGGTGGTGGGAGGAGG - Intergenic
1085603775 11:77879252-77879274 TGTTTGGTGAGGGTAAGGGGAGG - Intronic
1085662367 11:78380763-78380785 GGTTTGGGGGTGGGGAATGGGGG - Intronic
1085826967 11:79858126-79858148 ACTTTGGGGGTGGAGAAGGGTGG + Intergenic
1086260359 11:84932503-84932525 TGTGTGGTGGGGGTGAGGGGTGG - Intronic
1086869801 11:92023780-92023802 TGTTTGCTGGTGATAATGGGTGG - Intergenic
1087223438 11:95571103-95571125 TGTGGGGTGGGGGTGATGGGTGG + Intergenic
1087439807 11:98169010-98169032 TGTTTGTGTATGGTGAAGGGTGG - Intergenic
1088251225 11:107862404-107862426 TTTTTGGTGGTGGTGGTGGTGGG - Intronic
1088251250 11:107862600-107862622 TTTTTGGTGGTGGTGGTGGTGGG - Intronic
1088318483 11:108531132-108531154 TGACTGGAGGTGGTGAAGTGGGG - Intronic
1089022675 11:115233132-115233154 TGTTTGGTGGTGGTGGTGGCGGG + Intronic
1089045425 11:115498162-115498184 TGTGGGATGGTGGTGAAGGATGG - Intronic
1089081262 11:115777930-115777952 TGGCTGGTGGTGGTGGTGGGGGG + Intergenic
1089334504 11:117713790-117713812 TGTGTGGAGGTGGTGGTGGGTGG + Intronic
1089769570 11:120793594-120793616 TGATGGTTGGAGGTGAAGGGTGG + Intronic
1089803764 11:121063788-121063810 TGTTTGTTGGGGGAGAGGGGTGG + Intronic
1089846308 11:121461244-121461266 TTGGTGGTGGTGGTGATGGGTGG + Intronic
1089868408 11:121651741-121651763 AGTGTGGTGGTGGTGATGGAGGG - Intergenic
1089949461 11:122511774-122511796 TGATTGGCTGTGGGGAAGGGAGG - Intergenic
1090429362 11:126633224-126633246 TGTGGGGTGGGGGTGAGGGGAGG + Intronic
1090613450 11:128492952-128492974 TGTTGGATGGGGGTGAAGGGAGG - Intronic
1090636531 11:128693515-128693537 TTTTTGGGGGTGGGGTAGGGGGG - Intronic
1091398646 12:169756-169778 TATTTGGGGCTGGTGGAGGGAGG - Intronic
1091442335 12:521232-521254 TGTCCCGTGGTGGTGGAGGGTGG - Intronic
1091874824 12:3925077-3925099 AGTGGGGTGGTGGGGAAGGGTGG - Intergenic
1092313216 12:7381690-7381712 TGTGTGGTGGTGGGGAGGGTGGG + Intronic
1092766621 12:11859012-11859034 GGTTTGGTGGTGGGGCAGGAGGG - Intronic
1092918021 12:13205930-13205952 TGATTGGTGGTGGTTAGAGGTGG + Intronic
1092961814 12:13603073-13603095 TGTTGGATGGTGGAGAATGGTGG - Intronic
1093302620 12:17474383-17474405 TGTTAGGAAGTGGTGGAGGGAGG - Intergenic
1094398584 12:30036223-30036245 TGTTTTGGGGTGGGGGAGGGGGG - Intergenic
1095274012 12:40257907-40257929 TGGATGGTGGTGGGGCAGGGTGG + Intronic
1096548534 12:52357236-52357258 CTTTTGATGGTGGTGGAGGGTGG + Intergenic
1097107304 12:56633354-56633376 TGTTTGGAGGGGGTGCTGGGGGG - Intronic
1097170746 12:57111238-57111260 TTTTTGGTGGTGGTGGTGGAAGG - Exonic
1097221299 12:57452756-57452778 TCTTTGGTGGGGGTGGAGTGGGG - Intronic
1097609110 12:61795575-61795597 TGTTGGGTGGGGGAGGAGGGAGG + Intronic
1097928146 12:65154217-65154239 TGTTTGCCTTTGGTGAAGGGTGG - Intergenic
1098206968 12:68121301-68121323 GAGTTGGTGGTGGTGATGGGTGG - Intergenic
1098444780 12:70555286-70555308 TGTGTGGGGGTGGAGGAGGGGGG + Exonic
1098706657 12:73699881-73699903 TGTGTGGTGGTGGTGGTGAGTGG + Intergenic
1098771960 12:74563812-74563834 AGGTTGGCGGTGCTGAAGGGAGG + Intergenic
1099212134 12:79804176-79804198 TTTTTGGTGGTGGGGTTGGGAGG - Intronic
1099572936 12:84348395-84348417 ATTTTGGTGGTGGGGAAGAGGGG + Intergenic
1100089856 12:90955355-90955377 CGTTTGGGGGAGGTGAAGAGGGG + Intergenic
1100718473 12:97330133-97330155 TGTGTGGTGGGGCTGTAGGGAGG + Intergenic
1100774709 12:97961444-97961466 TGGTTGGTGGGGGTGAGGGGAGG - Intergenic
1101082606 12:101204202-101204224 ACCTTGGTGGAGGTGAAGGGAGG + Intronic
1101295248 12:103416553-103416575 TTTTTGGTGGTGGTCTCGGGTGG - Intronic
1101295407 12:103418559-103418581 TTTTTGGTGGTGGTCTCGGGTGG + Intronic
1101503749 12:105328216-105328238 TATTGGGTGGTGGTGAAGTCTGG + Intronic
1101793368 12:107951129-107951151 GGCTTGGTGGTGGAGAAGGATGG + Intergenic
1101797978 12:107993848-107993870 TTACTGGTGGTGGGGAAGGGTGG - Intergenic
1101926696 12:108977534-108977556 TGCTTGGTGCTGGGGAAGGCTGG + Intronic
1102109309 12:110352415-110352437 TGTTTGGTAGTGGGCAAGAGTGG - Intergenic
1102634651 12:114312374-114312396 TTTTTGGTGGTGATGGGGGGAGG - Intergenic
1102634652 12:114312377-114312399 TTTTTTTTGGTGGTGATGGGGGG - Intergenic
1102999486 12:117374603-117374625 CCTCTGGTGGTGGTGATGGGGGG - Intronic
1103629788 12:122250948-122250970 TGCTTTGTGGTGGTAAAGGAGGG - Intronic
1103772464 12:123338722-123338744 GGTGTGGTGGTGGTGGTGGGGGG + Intronic
1106845540 13:33734405-33734427 TGATTGGTGGAAGGGAAGGGAGG - Intergenic
1106922666 13:34580272-34580294 TGTTTGGTGGCGGGGGCGGGGGG + Intergenic
1107480185 13:40779703-40779725 TGTTTGTTTGTAGAGAAGGGGGG - Intergenic
1108055008 13:46476863-46476885 TCTTTGGTGGAGGGGATGGGTGG + Intergenic
1108115180 13:47119602-47119624 TGTTTGGTTTTAGTGAAAGGAGG + Intergenic
1108446256 13:50511816-50511838 TGGTAGCTGGTGGTGAAGTGGGG + Intronic
1108929894 13:55805738-55805760 TTTTTGGTGGTGGTGGTGGGGGG + Intergenic
1109015789 13:57011479-57011501 TGTGTGGTGGTGGTGGAGAGGGG + Intergenic
1109596245 13:64558048-64558070 TTTTTGGTGGTGGTGGAGAGGGG + Intergenic
1109942262 13:69385381-69385403 TGTTTGGTGGTGATGTAGCCTGG - Intergenic
1110293020 13:73828994-73829016 TGTTGGGTGGCGGTGAGGTGTGG - Intronic
1110363423 13:74655198-74655220 AGGTGGGTGGTTGTGAAGGGAGG + Intergenic
1110442795 13:75544099-75544121 TGTGTTGTGGTGGTGGTGGGTGG + Intronic
1110815790 13:79858758-79858780 TTTTTGGTGGTGGTGGGGTGGGG - Intergenic
1111380369 13:87441992-87442014 TGGTTGGTGGTTGCCAAGGGTGG + Intergenic
1111424308 13:88059164-88059186 TCTGTGGTGGTGGTGCAGGGAGG - Intergenic
1111679263 13:91424305-91424327 TTTTTGGTGGTGGTGGGGCGGGG + Intronic
1112280306 13:98056846-98056868 TGTTGGGTGGTGGGGAGAGGGGG + Intergenic
1112528706 13:100179766-100179788 TGTGTGGTGGTCATGAATGGTGG + Intronic
1113699127 13:112370799-112370821 TGTTTGGTGGTGGGGTGGGGTGG - Intergenic
1113704309 13:112416040-112416062 TGCTTGGTGTTGGGGCAGGGTGG + Intronic
1113916060 13:113874836-113874858 TGTGTGTTGATGGTGATGGGCGG + Intergenic
1113983273 13:114294260-114294282 TGTTTGGTTTTGGTGGGGGGGGG + Intronic
1114339521 14:21728459-21728481 TTGGTGGTGGTGGTGATGGGAGG + Intergenic
1114348157 14:21819823-21819845 ATTTTGGTGGTGGTGGAGGTGGG + Intergenic
1114492646 14:23113051-23113073 TGTGTGGTGGTGGTGGTGGGGGG + Intergenic
1114663504 14:24366051-24366073 TGTTGGGGGGTAGGGAAGGGAGG - Intronic
1114846321 14:26326989-26327011 TGTTTTGTAGTGGTGAAGTCTGG - Intergenic
1114979489 14:28144761-28144783 TTTTTTGTGGGGGTGGAGGGTGG - Intergenic
1115119319 14:29921794-29921816 TGTATGGTGGTGGTGGTGGTGGG - Intronic
1115282517 14:31679151-31679173 TCTTGGGTGATGGGGAAGGGTGG + Intronic
1115914798 14:38299846-38299868 TTTTTGGTGCTGTTGAAAGGTGG - Intergenic
1117008645 14:51447786-51447808 TGGATGGTGGTGTTGAGGGGTGG - Intergenic
1117068920 14:52038836-52038858 TGCTGGGTGGTGGGGAAGGACGG + Exonic
1117156691 14:52949431-52949453 TTTTTTGTTTTGGTGAAGGGGGG - Intronic
1117165605 14:53029592-53029614 TGTTTTGAGGGGGTTAAGGGCGG - Intergenic
1117211846 14:53509037-53509059 TGTGTGGTGGTGGTGGAGGTAGG + Intergenic
1117420588 14:55540875-55540897 TTTTTGGTGGTGTTGGAAGGGGG + Intergenic
1117593286 14:57299125-57299147 TGTTTGGTGGTGGGGGGGTGTGG + Intergenic
1118158928 14:63269595-63269617 AGATTGGTGGGGGTGAGGGGAGG + Intronic
1118331074 14:64816432-64816454 GGGTTGGTGGTGGTGATAGGAGG - Intronic
1118382563 14:65229617-65229639 TGTTTGATTGGGGTGGAGGGAGG - Intergenic
1119133227 14:72193665-72193687 AGTTTGGTGATGGTGGAAGGTGG + Intronic
1119218942 14:72891453-72891475 GGGATGGTGGTGGTGCAGGGAGG - Intronic
1119651499 14:76387126-76387148 TGTTAGGTGGTGGATCAGGGAGG + Intronic
1119770107 14:77215250-77215272 TGTGAGGTGGTGGTGGTGGGCGG - Intronic
1120116756 14:80626929-80626951 ATTTTGGGGGTGGTGATGGGGGG - Intronic
1120391134 14:83909960-83909982 TGTTTGGTGAGAGTGAAGGTGGG + Intergenic
1121013223 14:90533918-90533940 TGTGTGGTGGTCCTGAGGGGCGG + Exonic
1121145111 14:91576177-91576199 TTTTTGGTGGTGGTGGTGGGGGG + Intergenic
1121307200 14:92914401-92914423 TGTTTGATGGGGATGACGGGGGG - Intergenic
1121521217 14:94587412-94587434 GGGGTGGTGGCGGTGAAGGGAGG - Exonic
1122078654 14:99252058-99252080 TGGTGGGTGGTGGGGAAGAGGGG - Intronic
1122117430 14:99534900-99534922 TGTATGGTGGTGGGGAGTGGGGG + Intronic
1122424022 14:101595290-101595312 TGGTTGGTGGTGCTGAGGGTAGG - Intergenic
1122549822 14:102543949-102543971 TGTTGGGTGGTGGTGGGGGCGGG - Intergenic
1122915882 14:104858800-104858822 TGGTGGGTGGTGATGGAGGGTGG - Intergenic
1122915924 14:104858960-104858982 TGGTGGGTGGTGATGGAGGGTGG - Intergenic
1122916289 14:104860529-104860551 TAAATGGTGGTGATGAAGGGTGG - Intergenic
1124166504 15:27330847-27330869 TGTGTCGTGGTAGTGATGGGTGG + Intronic
1124338129 15:28872579-28872601 TGGTTGGTGGTTTTGAGGGGTGG + Intergenic
1124463648 15:29916967-29916989 TGAAAGGTGGTGGTGGAGGGGGG - Intronic
1124505545 15:30269965-30269987 TATTTGGAGGTGGGGGAGGGGGG + Intergenic
1124630185 15:31331763-31331785 GGTTTGGTGGTGGTGCAGGCTGG - Intronic
1125226117 15:37398077-37398099 AGTTTGGTGGTGGGGAGGGCAGG - Intergenic
1125770069 15:42159360-42159382 TCTTTGATGGTGGTGAGGGTGGG - Exonic
1125976131 15:43953376-43953398 TCCTTGGTGGTGGAGATGGGTGG + Intronic
1126088115 15:45027799-45027821 TGTTTGGTGGTGGGGGTGGTGGG + Intronic
1126383495 15:48071268-48071290 TGTCTAGTGGTGGGGTAGGGAGG + Intergenic
1128473047 15:67972677-67972699 TGTTTGGTTGTGGGGCACGGAGG - Intergenic
1128632436 15:69280387-69280409 TGTGGGGGGGTGGTGATGGGGGG - Intergenic
1128752973 15:70162190-70162212 TGTGTGGTGGTGGTGATGGTGGG + Intergenic
1128888846 15:71312744-71312766 TGTGGGGTGGTGGGGAAGTGGGG - Intronic
1129227577 15:74179017-74179039 GGCTTGGTGGAGGTGGAGGGCGG - Intergenic
1129520284 15:76181570-76181592 TGTTTGTTTTTGGTGAGGGGTGG + Intronic
1129823622 15:78620492-78620514 GGTTTGGTGGTGGCTAGGGGTGG + Intronic
1130625715 15:85512356-85512378 AGTCTGGAGGTGGAGAAGGGAGG - Intronic
1130917525 15:88317688-88317710 TGTGTGGTGGTAATGAAGGACGG + Intergenic
1131257876 15:90873479-90873501 TGGTTGGTGGTGGTGGGGGCAGG + Intronic
1131359006 15:91772673-91772695 TGTTTGGGGGCGGGGGAGGGGGG + Intergenic
1131383521 15:91983638-91983660 TGTTTGGTTGTGGTGTGGGGAGG + Intronic
1131398454 15:92105506-92105528 TGGGCGGTGGTGGTGGAGGGGGG - Intronic
1131452747 15:92559629-92559651 TTTTTGGTGGTGGTAGTGGGGGG - Intergenic
1131732620 15:95297825-95297847 AATTTGGTGGTGGTGTTGGGGGG + Intergenic
1132008855 15:98256379-98256401 TGTGGAGTGGTGGTGTAGGGAGG - Intergenic
1132245968 15:100296559-100296581 TGTTTGGAGGGGGTGAGGGGGGG + Intronic
1132633963 16:933822-933844 TGTTTGGTGGAGGGGACCGGAGG - Intronic
1132959030 16:2612110-2612132 TGTATGGGGGTGGGGCAGGGAGG + Intergenic
1132972089 16:2694085-2694107 TGTATGGGGGTGGGGCAGGGAGG + Intronic
1133521643 16:6564048-6564070 AGGTTGGTGGAGGTGAAGGGTGG - Intronic
1136354594 16:29735920-29735942 TGTTTGGAGGTGCTGATGGGGGG + Intergenic
1136525368 16:30826204-30826226 GGTTGGGTGGTGGTGGGGGGAGG - Intergenic
1136670447 16:31851790-31851812 TGTTTGGTGATGAATAAGGGGGG - Intergenic
1137407451 16:48200728-48200750 TTTTTGGGGGTAGGGAAGGGAGG + Intronic
1137549841 16:49429916-49429938 TTTGTGGTGGTGGTAAAGGACGG - Intergenic
1138406041 16:56795048-56795070 TTTTTGGTTGTGGGGAGGGGAGG - Intronic
1138529343 16:57626717-57626739 TGTGTGGTGGTGGTGGTGGGGGG + Intronic
1139252337 16:65508366-65508388 GGATTGGTGGTTGTGAAGGAAGG - Intergenic
1140313754 16:73873126-73873148 TGGATGGTGGTGGTGGTGGGTGG + Intergenic
1140313772 16:73873173-73873195 TGGTGGGTGGTGGTGGATGGTGG + Intergenic
1140313803 16:73873258-73873280 TGGATGGTGGTGGTGGTGGGTGG + Intergenic
1140517884 16:75557448-75557470 TGGTTGGGGGTGGTGGCGGGGGG - Intergenic
1140937973 16:79692562-79692584 TGTTTGGTTGTGGTGCCGGTGGG + Intergenic
1141460923 16:84178534-84178556 TGTTTGGTGAGGGTGGAGTGAGG - Exonic
1141996898 16:87641569-87641591 TATTTGGGGCTGGAGAAGGGGGG - Intronic
1143200226 17:5108152-5108174 GGTTTGGTGATAGTGATGGGGGG + Intronic
1143873936 17:9977735-9977757 TGTGCGGGGGTGGGGAAGGGGGG + Intronic
1144294841 17:13864239-13864261 TTTTTGGTGGTGGGGTTGGGGGG - Intergenic
1144296249 17:13877819-13877841 TGTTTGGTGGTTGAAGAGGGTGG + Intergenic
1144385108 17:14742039-14742061 GCTTTGGTGGTGGTGGTGGGAGG + Intergenic
1144446198 17:15331525-15331547 TGGTTGGTGTTGGTCTAGGGTGG + Exonic
1144461334 17:15460878-15460900 TGGTTGGCGGTGGGGAAGGCGGG - Intronic
1144486722 17:15672310-15672332 TGTTTGGTTGTGGTAAAGTCTGG - Intronic
1144509830 17:15866489-15866511 TGTTTGGTGGTGGGGAGCGGGGG + Intergenic
1144914299 17:18709987-18710009 TGTTTGGTTGTGGTAAAGTCTGG + Intronic
1145173940 17:20684132-20684154 TGTTTGGTGGTGGGGAGCGGGGG + Intergenic
1145371528 17:22310579-22310601 TGTTTTGTGGTGGGGGTGGGTGG + Intergenic
1145873462 17:28296323-28296345 TTTTTGGTGGAGGTGATGGGTGG - Intergenic
1145917790 17:28586315-28586337 TAAGTCGTGGTGGTGAAGGGAGG - Intronic
1146250152 17:31333489-31333511 TGTTTACTCTTGGTGAAGGGAGG - Intronic
1146552383 17:33792402-33792424 TCATTGGGGGTGGTGGAGGGGGG + Intronic
1146568971 17:33936961-33936983 GGCTTGGTGGAGGTGGAGGGTGG - Intronic
1146923367 17:36728285-36728307 TGTTGGGTGCTGGGGAAGGGGGG - Intergenic
1147218245 17:38913153-38913175 TGGGTGGTGGTGGTCAAGGTGGG + Intronic
1147313354 17:39607412-39607434 TTTTCGGTGGTGGGGAAAGGTGG + Intronic
1148087773 17:45004766-45004788 TCTTGGGTGGGGGGGAAGGGTGG + Intergenic
1148749272 17:49935360-49935382 TGTTGGGGGGTGGTGATGGAGGG + Intergenic
1149083867 17:52691017-52691039 TGTTTGGAGGTAGGGAAGGAGGG + Intergenic
1149422488 17:56524161-56524183 TGTGGGGTGGTGGAGAAGGGAGG + Intergenic
1149453212 17:56766347-56766369 TTTTTGGTGGTGGGGAGGGGAGG + Intergenic
1149502788 17:57167182-57167204 GGTAGGGTGGTGGGGAAGGGGGG + Intergenic
1149662472 17:58342076-58342098 TGATAGGTGGTGGTGGAGGAGGG - Intergenic
1150331413 17:64297389-64297411 TGTGTGGTGGTGGGCATGGGAGG + Intergenic
1150871446 17:68916130-68916152 AGTGGGGTGGTGGGGAAGGGGGG + Intronic
1151140552 17:71987730-71987752 AAATTGGTGGTGGTGGAGGGGGG - Intergenic
1152036152 17:77874365-77874387 TGTTTGGTGATGGTGCAGGGAGG - Intergenic
1152269581 17:79316166-79316188 TGGCTGGTGATGGTGGAGGGTGG + Intronic
1152327833 17:79651852-79651874 TGATGGGGGGTGGTGGAGGGGGG - Intergenic
1152888258 17:82865219-82865241 TGTGTGCTGGTGCTGAAGGGAGG + Intronic
1152888269 17:82865271-82865293 TGTGTGCTGGTGCTGAAGGGAGG + Intronic
1153614296 18:6920446-6920468 TGTGTGGTGGTGGTGGCGTGTGG + Intergenic
1153953997 18:10080711-10080733 TGTTTGGAGGTGGGGACTGGTGG + Intergenic
1154208068 18:12354765-12354787 TGGGGGGTGGTGGGGAAGGGTGG - Intronic
1154971340 18:21412839-21412861 AGTTTGGTGGTGGGGGGGGGTGG - Intronic
1154995066 18:21632725-21632747 TTTTAGGGGGTGGTGAAGAGGGG - Intergenic
1156222282 18:35064791-35064813 TATTTGGCGGTGGTGTTGGGTGG - Intronic
1156867527 18:41905357-41905379 TGTTTGGTGCTGTTGAATGCAGG + Intergenic
1156897739 18:42265812-42265834 TGTTGTGTGGTGGGGGAGGGGGG - Intergenic
1157573513 18:48729269-48729291 TGTGTGGTAGTGGTGGTGGGGGG - Intronic
1157662550 18:49458835-49458857 TTTTTGTTGGTGGTGGTGGGAGG - Intronic
1157838282 18:50928959-50928981 AGTTTGGTGTTGGGGAAGAGAGG - Intronic
1159296196 18:66492393-66492415 TTTTTGGTGGAGGGGAAGGAAGG + Intergenic
1160618374 18:80151133-80151155 AGGGTGGTGGTGGTGACGGGAGG + Intronic
1160753613 19:746982-747004 TGTTGGGGCGTGGTGACGGGTGG - Exonic
1161530239 19:4784557-4784579 TGATTGGTAGTGGTGAAGCCTGG - Intergenic
1161712463 19:5856875-5856897 TGTTGGGAAGTGGTGGAGGGAGG - Intergenic
1161739603 19:6012624-6012646 TGTGTGGGGGAGGTGAATGGTGG + Intronic
1161827021 19:6574807-6574829 TGTTGGGAAGTGGTGGAGGGAGG - Intergenic
1163076484 19:14896790-14896812 TGTTGGGTGGGGGTGGGGGGCGG + Intergenic
1163148550 19:15398358-15398380 TGCTTGGGGGTGGTGTCGGGAGG + Intronic
1163457053 19:17413318-17413340 TGTTTTGTTGAGGTGAGGGGTGG - Intronic
1163651521 19:18521021-18521043 TGGCTGGTGGTGGGGAGGGGAGG - Intronic
1164658176 19:29939864-29939886 TGGTTGGAGGTGGGGAAGGTGGG + Intronic
1164716161 19:30391977-30391999 TTTTTGGCGGGGGTGAAGGGGGG - Intronic
1165717876 19:38058306-38058328 TCTGTGGTGCTGCTGAAGGGTGG + Intronic
1165925419 19:39323141-39323163 TGGGTGGTGGCGATGAAGGGTGG - Intergenic
1165929757 19:39349475-39349497 TGAATGGTGCTGGGGAAGGGAGG - Intronic
1166056734 19:40294430-40294452 TTTTTTTTGGTGGTGAGGGGAGG + Intergenic
1166346043 19:42166592-42166614 TGTATGCTGGAGGTGAAGGAGGG + Intronic
1166758668 19:45211355-45211377 GGTATGGTGGTGGTGGAGGGGGG + Intronic
1166885157 19:45956136-45956158 TGTTCTGGGGTGGGGAAGGGGGG - Intronic
1166889514 19:45981893-45981915 TGGTTGCTGGTGGGAAAGGGTGG - Intergenic
1167179969 19:47895558-47895580 TGTTTGTTTTTGGTGGAGGGAGG + Intergenic
1167271516 19:48509095-48509117 TGTCTGGTGGGGGTCAAGGGTGG - Intronic
1167499262 19:49836254-49836276 TGGCTGGAGGTGGTGGAGGGAGG - Exonic
1167833568 19:52047963-52047985 AGTTTTTTGGGGGTGAAGGGGGG - Intronic
1168460005 19:56546872-56546894 AGTTTTGTGGAGGTGAAAGGAGG - Intronic
1168670745 19:58239339-58239361 AGTTTGGTGGGAGTGGAGGGGGG - Intronic
924998781 2:387067-387089 TGTTTGGAGAAAGTGAAGGGGGG - Intergenic
925272541 2:2623077-2623099 TTGTTGGTGGTGGTGATGGTTGG + Intergenic
925440028 2:3877775-3877797 TGTTTGGTTGGGGTGGGGGGAGG - Intergenic
925998419 2:9310774-9310796 TTTTTGGTGGGGGTGGATGGTGG - Intronic
927114378 2:19886596-19886618 TGCTTGGTTGGGGTGGAGGGGGG - Intergenic
927284452 2:21341897-21341919 TGTTTTGGGGTGGGGGAGGGGGG + Intergenic
927596696 2:24403294-24403316 TGTGGGGGGGTGGTGAAGGGAGG - Intergenic
927651031 2:24913955-24913977 TGGTTGGGGGTGGTGGTGGGCGG - Intronic
927752976 2:25686417-25686439 TGCATGGTGGTGGGGGAGGGAGG + Intergenic
927822242 2:26277854-26277876 AGTATGGTAGTGGTGAAGGAAGG - Intronic
928500966 2:31894875-31894897 TGTATGGAGGCTGTGAAGGGAGG - Intronic
928592483 2:32832172-32832194 TGTTTGGTAGTGGGGGTGGGTGG - Intergenic
928696773 2:33857085-33857107 TGTTTGGTGATGGAGAAGGCAGG - Intergenic
928983467 2:37158239-37158261 TGTTGGGGGATGGAGAAGGGAGG - Intergenic
928990164 2:37225030-37225052 TGTTTGTTTGTTTTGAAGGGGGG - Intronic
929052574 2:37850460-37850482 TGGCTGGTAGTGGTGAAGGAGGG - Intergenic
929287364 2:40150357-40150379 TGTTTGTGTGTGGTGGAGGGTGG + Intronic
930069577 2:47355155-47355177 TTGTTGGTGTTGGTGAATGGTGG - Intronic
930097545 2:47577558-47577580 TGTATGGTGCTGGTCACGGGAGG + Intergenic
930102605 2:47614903-47614925 AGTTTGGTGGTGGGGAGAGGAGG - Intergenic
930467887 2:51777157-51777179 TGTCTGCTGGTGGGGAAGGCAGG + Intergenic
930727168 2:54693550-54693572 CCTTTGGTAGTGGTGAAGGCTGG - Intergenic
931184967 2:59940918-59940940 TGATTTGGGGTGGTGAAGTGTGG + Intergenic
931313480 2:61104540-61104562 TGTGTGGTGGTGATGAATGAGGG + Intronic
932030521 2:68178967-68178989 TGTGTGGGGGTGGGTAAGGGAGG - Exonic
932250669 2:70240869-70240891 TTTTTGGTGGGGGGGCAGGGAGG - Intronic
932912590 2:75820637-75820659 TTTTTGGTGGTGGAATAGGGAGG + Intergenic
934141624 2:89052772-89052794 TGTTGGGAAGTGGTGGAGGGAGG - Intergenic
934227620 2:90147774-90147796 TGTTGGGAAGTGGTGGAGGGAGG + Intergenic
934667782 2:96185342-96185364 TGTTTTGTGGTGTTGAAAAGTGG - Exonic
935349286 2:102139937-102139959 TATTAGGTGGTGCTGAAGAGTGG + Intronic
935563643 2:104584305-104584327 GGTTTGGTGGTGGGGGTGGGGGG + Intergenic
935934722 2:108169151-108169173 TGTTAGGAGGTGGGGAAGTGGGG - Intergenic
936391919 2:112082809-112082831 TGTTTAGTGAAGGTAAAGGGTGG + Intronic
936748388 2:115609576-115609598 TTTTTGGTGGGGGAGAAGAGAGG - Intronic
937645087 2:124257720-124257742 TGTTGGGTGGGGGCGGAGGGGGG - Intronic
937737330 2:125308022-125308044 TGTGTGTGGGTGGTGAATGGGGG + Intergenic
938200908 2:129372599-129372621 TGTGTGGTGGGGGTGATGCGGGG + Intergenic
938996086 2:136679881-136679903 GGTTTGGTGGTGGTGGTGGTGGG - Intergenic
939624309 2:144458163-144458185 TGTGTGGTGGTGGTGGTGGTTGG - Intronic
939758990 2:146151272-146151294 TGTTGGGGGGTGATGGAGGGGGG - Intergenic
940345430 2:152623430-152623452 TGTTTGGTGGTGGAGAGGCCTGG + Intronic
941056182 2:160791453-160791475 TGTTTGGTGGTGGTTGGGAGGGG + Intergenic
941226994 2:162863080-162863102 TTTTTGGGGGTGGGGAAGGCTGG - Intergenic
941704583 2:168644348-168644370 TGTTTGGGGATGGGGAAGAGAGG + Intronic
941713867 2:168743921-168743943 TTTTTGGTGGTGGTGGGGGGTGG - Intronic
942924632 2:181417130-181417152 TGGGGGGTGGTGGTGAGGGGAGG + Intergenic
943042537 2:182820560-182820582 TTTTTGGAGGTGGAGATGGGAGG - Intergenic
943195110 2:184736578-184736600 TGTTGGGTGGTGGGGACGAGGGG + Intronic
943287123 2:186016264-186016286 TGTATGGTGGCGGTGGGGGGTGG - Intergenic
943520328 2:188941702-188941724 TATTTGGTAGTGATGACGGGTGG + Intergenic
943674567 2:190704536-190704558 TTTTTGTTGGTGGTGGTGGGGGG + Intergenic
944211483 2:197210894-197210916 TGTTTGGTGGTATTGGAGAGGGG + Intronic
944303305 2:198150046-198150068 TGTGTGGTGGTTGTGAGGTGGGG - Intronic
944391108 2:199220537-199220559 TTTTTGGTGGTGGTGATGGGGGG + Intergenic
944965276 2:204925375-204925397 TGCTTGGTGGTGATGGAGGGTGG - Intronic
945187099 2:207150092-207150114 TGTGTGGTTGTGGGGGAGGGTGG - Intronic
945404216 2:209424831-209424853 TGCCTGGTGGTGTTGGAGGGCGG + Intronic
945977537 2:216282468-216282490 TCTGGGGTGGTGGTGGAGGGGGG - Intronic
946188726 2:217996097-217996119 GGTTGGGTGGTGATGAAAGGGGG + Intronic
946322867 2:218963628-218963650 TGTTTGTTGGGGGTTGAGGGGGG - Intergenic
946590544 2:221242573-221242595 TGTGTGGTGGGGGAGAGGGGAGG + Intergenic
947107854 2:226686280-226686302 TGTATGGAGGTGGTGGCGGGTGG + Intergenic
947325414 2:228969590-228969612 TTGTTGGTGGTGGTGATGGTTGG + Intronic
947372098 2:229457603-229457625 TCTTTGGTGGTGGGGGTGGGTGG - Intronic
947500599 2:230668268-230668290 TGCATGGTGGTGGGGAAGGTGGG - Intergenic
947585210 2:231351848-231351870 AGGGTGCTGGTGGTGAAGGGAGG - Intronic
947960364 2:234231429-234231451 TGTTTGGAGGTGGAGCAGGCTGG + Intergenic
948273104 2:236688794-236688816 TGGTTGGGGGTGGGGAGGGGTGG + Intergenic
948512302 2:238476714-238476736 ACTGTGGTGGTGGTGAATGGCGG + Intergenic
1169307724 20:4507538-4507560 TGTTTTGAGGGGGTGGAGGGAGG + Intergenic
1169331679 20:4721440-4721462 TGTGTGGTGGTGGGGGGGGGGGG - Intergenic
1169544200 20:6634528-6634550 TGTTAGGTGTTGTTGAATGGGGG - Intergenic
1170663802 20:18367457-18367479 TGTTTGATGGGGTTGCAGGGAGG + Intergenic
1171035574 20:21710072-21710094 TGGGTGGTGGTGGTGGTGGGCGG + Intronic
1171128739 20:22628279-22628301 TGTCTGGCGGTGGTGGAGGCTGG + Intergenic
1171161554 20:22929221-22929243 TTTTTGGTGGTGGTGATTCGGGG - Intergenic
1172580869 20:36046846-36046868 TGTTTGGGGTGGGGGAAGGGGGG - Intergenic
1172890306 20:38259804-38259826 TGTGTGGTGGTGGTGGTGGCAGG - Intronic
1173615158 20:44398528-44398550 TGTTTGGCGTTGGCTAAGGGTGG + Intronic
1173824039 20:46035936-46035958 TGTCAGGGGGTGGTGAGGGGAGG - Intronic
1173844125 20:46177398-46177420 TCATTGGTGGTGGGGGAGGGGGG - Intronic
1174864757 20:54125032-54125054 TGTTTGGGGCTGTTGAAGGGAGG + Intergenic
1175193590 20:57227390-57227412 TATTTGGTGCTGGTGGGGGGTGG - Intronic
1175350510 20:58314888-58314910 TAGTTGGTGGTGGTGAGGGACGG + Intronic
1175525953 20:59633499-59633521 TGAGTGGTGGGGGTGAGGGGAGG + Intronic
1175831531 20:61967523-61967545 GGTTTGATGGTGCTGAGGGGCGG - Intronic
1176236969 20:64057898-64057920 GGTGGGGTGGTGGTGAAGTGAGG + Intronic
1176273500 20:64248706-64248728 TACTTGGTGGTGGTCAGGGGTGG - Intergenic
1176904634 21:14484533-14484555 TGTATGGTGGTGGTGGTGAGGGG + Intergenic
1177043750 21:16145299-16145321 GGTTTGATTGTGGTGTAGGGTGG + Intergenic
1177054088 21:16277875-16277897 AGCTTGGAGGTGGTAAAGGGTGG - Intergenic
1177062741 21:16394986-16395008 TGTTGGGAAGTGGTGGAGGGAGG + Intergenic
1178480177 21:32973702-32973724 TTGTGGGTGGTGGTGATGGGAGG - Intergenic
1179150913 21:38807057-38807079 TGATTGGTGGTGGTGTGGGCAGG - Intronic
1179190382 21:39117767-39117789 TATTTTGTGGTGCTGAGGGGAGG - Intergenic
1179225233 21:39447109-39447131 TTTTTGCTGGTGGTGGTGGGCGG + Intronic
1180151527 21:45950655-45950677 TGTGTTGTGGTGGAGAAGGTGGG - Intergenic
1181135693 22:20764637-20764659 TGTCTGGTGGTCATGAAGGAGGG + Intronic
1182908342 22:33957869-33957891 CGTTTGATGGAGGTGAAGGGTGG - Intergenic
1183283492 22:36947501-36947523 TGATTGGTCGGGGGGAAGGGGGG - Intergenic
1183318862 22:37152702-37152724 TTTTTGGCGGGGGAGAAGGGTGG + Intronic
1183378159 22:37477050-37477072 TGCTGGTTGGGGGTGAAGGGTGG - Intronic
1183786538 22:40032174-40032196 AGCTTGGTGGTGGTGTGGGGTGG - Exonic
1184606547 22:45577711-45577733 TGTTTGGGGAGCGTGAAGGGAGG + Intronic
1184883876 22:47330066-47330088 TGGTTGCTGGGGGTGATGGGGGG + Intergenic
1185239250 22:49733800-49733822 TGTCTTGTGGTGGTGAAGACGGG + Intergenic
1185271623 22:49932119-49932141 CGTCTGGTGGTGGTGGCGGGCGG + Intergenic
1185332652 22:50258627-50258649 TGTTTGGTTGGGGTGAAGAGGGG - Intronic
949577614 3:5353893-5353915 TGTTTTGTGGTGGTTAATAGAGG - Intergenic
950445891 3:13037842-13037864 TGGCTGCTGGGGGTGAAGGGAGG + Intronic
950490345 3:13300808-13300830 GGTTTGGGAGTGGGGAAGGGAGG + Intergenic
950616821 3:14166505-14166527 TGGGGGGTGGGGGTGAAGGGAGG - Intronic
950922185 3:16705680-16705702 TGAGTGGTGGTGGTGGAGGTGGG - Intergenic
951271836 3:20634682-20634704 TGTCTAGTGATGATGAAGGGGGG + Intergenic
951753320 3:26061238-26061260 TTCTTGGTGGTGGTTAATGGTGG + Intergenic
952336977 3:32412036-32412058 TTTTTGGTAGTGGTGAAGTATGG + Intronic
952957979 3:38571170-38571192 AGTTTGGTGGTAGTTTAGGGGGG - Intronic
953091411 3:39730116-39730138 TGTGGGGTGGGGGTGAGGGGAGG - Intergenic
953224019 3:40999907-40999929 TGTCTGGAGGTGGGGAAGGGTGG - Intergenic
953409797 3:42684316-42684338 TGTCTGGTGGTGGGGCGGGGTGG + Intergenic
953432004 3:42847713-42847735 AGCTTGGTGGTGCTGGAGGGAGG + Intronic
953827291 3:46264889-46264911 TGTGGGGTGGTGGTGAAGAATGG - Intronic
954269912 3:49499740-49499762 GTATTGGTGGTGGTGATGGGAGG + Intronic
954315956 3:49802007-49802029 TGATTGGTGGTGGTGGCAGGAGG - Intergenic
954794477 3:53154577-53154599 TGTCTGCTGGAGGGGAAGGGTGG - Intergenic
956069981 3:65438456-65438478 TATTAAGTGGTGGTGAAGTGTGG - Intronic
956191242 3:66610342-66610364 TGGTTGGTGGGAGTGAAGAGGGG + Intergenic
956657364 3:71565431-71565453 TATTTGGTGGCAGTGATGGGGGG + Intronic
956732348 3:72208179-72208201 AATTTGGTGGGGGTGGAGGGGGG - Intergenic
956872529 3:73431859-73431881 TGTTTGGGGGTGGGGCTGGGGGG + Intronic
957198785 3:77105400-77105422 TTTTTGGTGGTGATGGTGGGTGG + Intronic
957548245 3:81668212-81668234 TGTGGGGTGGGGGTGAAGGGAGG + Intronic
957971174 3:87384539-87384561 TGTTTGGTGAGGGTGGAGTGAGG - Intergenic
958192021 3:90195812-90195834 TGTTGGGTGGTGGGGAGAGGGGG - Intergenic
958733955 3:97988781-97988803 CGTTTGGTAGTGGTGGATGGTGG + Intronic
958734058 3:97989215-97989237 TGGATGGTGGTGGTGGATGGTGG + Intronic
958909125 3:99973830-99973852 TGTTTGTTGTTGGTGGTGGGTGG + Intronic
958941294 3:100318075-100318097 TATTTCTTGGTGGGGAAGGGAGG + Intronic
959826452 3:110802993-110803015 TAGTTGGTGGTGGTGCTGGGGGG - Intergenic
959958466 3:112267871-112267893 TGTTAGGTGATGGTGAAGTCAGG + Intronic
960160530 3:114345698-114345720 TCTGGGGTGGGGGTGAAGGGTGG + Intronic
960169964 3:114448423-114448445 GGGTTGCTGGTGGTGACGGGTGG + Intronic
960638338 3:119805700-119805722 TTTTTGGTGGGGGGGAGGGGGGG - Intronic
961026255 3:123560537-123560559 TGTTTAGTGGTGGTGATGGCAGG - Intronic
961057288 3:123799886-123799908 AGTACGGTGGTGGTGAAGTGTGG - Intronic
961559412 3:127718366-127718388 TGTTTGGTGGTGGGGCTGAGGGG - Intronic
961986757 3:131142625-131142647 TGTTTGGAGTTGGGGTAGGGAGG - Intronic
962151363 3:132896905-132896927 TGTTGGGAGGTGGAGAAGGAGGG + Intergenic
962357340 3:134706025-134706047 GGTTTGGTGGTGGTGGAGGGGGG + Intronic
962851202 3:139309472-139309494 GGTTTGGTGGTGGTATTGGGAGG - Intronic
964399631 3:156285505-156285527 TTTTTGGTGGGGGGGATGGGGGG + Intronic
964523562 3:157592894-157592916 AGTTTGGTGGTGGTGCTGGAAGG + Intronic
964913628 3:161812638-161812660 TGTTTGGGAGTGGAGATGGGTGG + Intergenic
965321922 3:167261673-167261695 TGTTGGGTGGTGGGGCATGGTGG - Intronic
966297288 3:178439089-178439111 TGTATGGGGTTGGTGAAGAGAGG + Intronic
966524513 3:180906540-180906562 GGTGTGGTGGTGGTGATGGTGGG - Intronic
966975334 3:185077776-185077798 TATTTGGTGGTGGTGGGGGGGGG + Intergenic
967158846 3:186717910-186717932 TGGTGGGTGGTGGTGGATGGTGG - Intronic
967158900 3:186718067-186718089 TGGTTGGTGGTGGTGGGTGGTGG - Intronic
967158908 3:186718090-186718112 TGGTTGGTGGTGGTGGATGGTGG - Intronic
967158942 3:186718188-186718210 TGGGTGGTGGTGGTGGATGGTGG - Intronic
967158984 3:186718303-186718325 TGGGTGGTGGTGGTGGTGGGTGG - Intronic
967158997 3:186718336-186718358 TGGGTGGTGGTGGTGGTGGGTGG - Intronic
967328313 3:188264740-188264762 TGTTTGGGGGTGGCGAACAGGGG - Intronic
967512690 3:190330550-190330572 CATCCGGTGGTGGTGAAGGGTGG + Intronic
967854567 3:194106941-194106963 TGTTTGGTAGTGGTGGTGGGTGG - Intergenic
968132550 3:196200044-196200066 TTTTGGGAGGTGGAGAAGGGAGG + Intronic
968883016 4:3310726-3310748 TGTGAGGTGGTGGTGGGGGGAGG + Intronic
969335916 4:6510218-6510240 TGGTGGGAGGTGGTGAAAGGGGG - Intronic
971054641 4:22898442-22898464 TTTTTGGTGGAGGTGGAGGGTGG + Intergenic
971114652 4:23630746-23630768 TGTGTGGTGGTGGTGGACGGGGG - Intergenic
971394937 4:26218803-26218825 TGTATGGGGGTGGGGCAGGGAGG + Intronic
971442430 4:26702040-26702062 TCTTTGGTGGTGGTAAAAAGGGG + Intronic
971462092 4:26910810-26910832 TGCTTGGTGGTGGTGTGGTGGGG + Intronic
971826328 4:31628575-31628597 TGTGTGATGGTGGTGAAGGGTGG - Intergenic
971950034 4:33332766-33332788 TGCTTGGTTGTGGAGCAGGGAGG - Intergenic
973014434 4:45119738-45119760 TGTTTGTTTGTTGTGAAGGGAGG + Intergenic
974855642 4:67457460-67457482 ATTTTGGTGGTGGTAAAGTGTGG - Intergenic
975064948 4:70049227-70049249 GGCCTGGTGGTGGGGAAGGGAGG - Intergenic
975819709 4:78257667-78257689 GATTTGGTGGTGGAGAGGGGAGG + Intronic
976003414 4:80399686-80399708 TGTTTTGAGGTGGGGGAGGGGGG + Intronic
976829267 4:89295533-89295555 TGCTTGGTGATGATGAAGAGGGG + Intronic
976832790 4:89333664-89333686 TGCTTGGTGGGGGTGGAGGTGGG + Intergenic
977805599 4:101293697-101293719 GCTGTGGTGGAGGTGAAGGGAGG - Intronic
978185120 4:105848526-105848548 TTTTTGGTGGTGGTGGTGGGGGG - Intronic
978471556 4:109073171-109073193 TGTTTGGTGGTTGTCAGGAGGGG + Intronic
978718464 4:111875244-111875266 TGTTTGGGGGTTTTGAATGGGGG + Intergenic
978909356 4:114046735-114046757 TTTTTTGTGGTGAAGAAGGGCGG + Intergenic
979384784 4:120052183-120052205 TGTGTGGTGGTGGTGGTGGTAGG - Intergenic
979646583 4:123076971-123076993 TGTGTGGTGGTGGTGGGGCGGGG + Intronic
980115056 4:128671484-128671506 AGGCTGGGGGTGGTGAAGGGAGG + Intergenic
980639171 4:135552656-135552678 TGTGTGGCGGTGGTGAGGGAGGG - Intergenic
981434837 4:144708247-144708269 TGGTTGGTGCTGTTGAAGTGTGG - Exonic
982459930 4:155656471-155656493 TGTTGGGAGGTGGTTAAGGTAGG - Intergenic
982657727 4:158170621-158170643 CGTTTGCTGGTGCTGGAGGGGGG - Exonic
982937049 4:161492964-161492986 AGTTTGGAGGTGGTGAGGGAAGG - Intronic
983271923 4:165572170-165572192 TGTTGGGTGGTGGTGGGTGGGGG + Intergenic
983271927 4:165572180-165572202 TGGTGGGTGGGGGTGAGGGGAGG + Intergenic
984534942 4:180962799-180962821 TGTTTCGGGGTGGTGGAGGTGGG + Intergenic
984727305 4:183034208-183034230 TGTTTGGGGTAGGGGAAGGGGGG - Intergenic
984967191 4:185149754-185149776 GGGGTGGTGGTGGTGAAGGAGGG - Exonic
985063370 4:186099407-186099429 TGTTGTGGGGTGGTGGAGGGGGG - Intergenic
985560193 5:581735-581757 TGTTAGAAGGTGGTGAGGGGCGG + Intergenic
985651551 5:1109991-1110013 TTTTTGGTGGTGGTTGGGGGCGG - Intronic
985665986 5:1181720-1181742 TGGGTGGTGGAGGGGAAGGGAGG + Intergenic
985969817 5:3366054-3366076 AGTGTGGGGGTGGGGAAGGGAGG - Intergenic
986004447 5:3656364-3656386 TGTTTGGGGGTGGGGGTGGGGGG + Intergenic
986333817 5:6738001-6738023 TGTGTGGTGGTGGGGAAGCAGGG - Intronic
986826915 5:11532118-11532140 TGTTTGGAGGTGGTGCAAAGGGG - Intronic
987153997 5:15069465-15069487 TGTGGGGAGGTGGGGAAGGGAGG + Intergenic
988220219 5:28335455-28335477 TGTTGGGTAGTGGTGAAGTCTGG - Intergenic
989041830 5:37237516-37237538 TGTTGTGTAGTGGTGAAGTGTGG - Intronic
989453371 5:41612975-41612997 TGTTTGGTGCTGGTGAAGTATGG - Intergenic
989625853 5:43428876-43428898 TTTGTGGTGGTGGTGTGGGGCGG + Intergenic
989683586 5:44058754-44058776 TGTTGTGTGGTGGTAAGGGGTGG + Intergenic
990097364 5:52133868-52133890 GTTTTGGTGGTGATGGAGGGAGG + Intergenic
990427211 5:55698526-55698548 TGTATTGTGGTGGGGAAGTGGGG - Intronic
992351901 5:75938920-75938942 GATTTGGGGGTGGTAAAGGGTGG + Intergenic
992531194 5:77653226-77653248 TGTATGGCTGTGGTAAAGGGAGG + Intergenic
992780402 5:80122027-80122049 TATTTGGAGGTGGAGAAAGGGGG - Intronic
993563649 5:89444966-89444988 TCATTGGTGGTGGTGGAGGTTGG - Intergenic
993755589 5:91725290-91725312 TTTTTTGTGGGGGTGAAGGAGGG + Intergenic
993977979 5:94505500-94505522 TCTTTATTGGTGGTGTAGGGGGG - Intronic
994001643 5:94788569-94788591 TGTTTGGTGGTGGTGGGGGAAGG - Intronic
995282072 5:110347371-110347393 TGTTTTGTGGTGGGGGATGGTGG + Intronic
995684809 5:114760761-114760783 TGTGGGGTGGGGGTGAGGGGAGG - Intergenic
995793137 5:115915207-115915229 GGTGGGGTGGTGGTGAGGGGAGG - Intergenic
996626434 5:125575566-125575588 TTTTTAGTGGTGGTGGAGAGGGG + Intergenic
997943145 5:138176610-138176632 TGCTTGGGGGTGGTGAGGAGGGG + Intronic
998867859 5:146523063-146523085 TTTTTGGTGGTGGTGGTGGGGGG + Intergenic
999342163 5:150781630-150781652 TCTTTGGTGGTGGTGGTGGTGGG + Intronic
999393534 5:151212004-151212026 TGGGTGGTGGTGGTGGGGGGGGG + Intronic
999408266 5:151326309-151326331 TGGTAGGTGGGGGTGAGGGGAGG - Intronic
999672104 5:153966883-153966905 TGGTTGGGTGTGGTGAGGGGAGG - Intergenic
999924342 5:156358877-156358899 TGACTGGTGGTGGTGGTGGGTGG + Intronic
1000162851 5:158617095-158617117 TTTGTGGAGGTGGTTAAGGGAGG + Intergenic
1000291345 5:159874272-159874294 TGTATGTTGGTGGTGGTGGGAGG - Intergenic
1000525625 5:162353843-162353865 TGTTGTGTAGTGGTGAAGTGTGG + Intergenic
1002164570 5:177336451-177336473 TGTTGGGGGCTGGTGAAGGAGGG + Intronic
1003639812 6:7867199-7867221 TGTTTGGGGGTGGGAAAAGGAGG - Intronic
1003948425 6:11095863-11095885 TGTTTGGATGTGGGGAAGGAGGG + Intronic
1004183290 6:13399165-13399187 ATTTTGGTGGTGGGGGAGGGAGG + Intronic
1004594042 6:17081887-17081909 CCTTTGGTGGTGGTGACAGGTGG - Intergenic
1004679022 6:17874282-17874304 TGTTTTTTGGTGGTGGTGGGGGG + Intronic
1004879877 6:19996773-19996795 TGAGGGGTGGTGGTGAAGTGGGG - Intergenic
1004982533 6:21042262-21042284 GGTATGGTGGTGGAGTAGGGTGG - Intronic
1005003889 6:21269348-21269370 TGCTTGGTGCTGGTGCTGGGAGG - Intergenic
1005192871 6:23245929-23245951 TATTTATTTGTGGTGAAGGGTGG - Intergenic
1005385543 6:25280596-25280618 TTTTTGGTGGTGGTGGGGGCGGG + Intronic
1005771500 6:29077459-29077481 TGTCTGGGGGTGGAGAGGGGAGG - Intergenic
1007073335 6:39051636-39051658 TGTGTGGTGGTGGTGGTGGTTGG + Intronic
1007097634 6:39223688-39223710 TGGTTGGTGGTGGTGGGAGGAGG - Intronic
1007557974 6:42782634-42782656 CGGTTGGTGGTGGGGAGGGGAGG + Intronic
1007951150 6:45873524-45873546 TGTTTGGAGGTGATGAATGTTGG + Intergenic
1008714812 6:54275576-54275598 TGTTGTGGGGTGGGGAAGGGGGG - Intergenic
1008880538 6:56376827-56376849 TGTTTGGGGGGGGTGGGGGGTGG - Intronic
1010851421 6:80782287-80782309 TATGTGGTGGTGGGGAAGGGGGG + Intergenic
1010903233 6:81453533-81453555 GGTATTGTGCTGGTGAAGGGAGG + Intergenic
1012155180 6:95810709-95810731 TGAATGGGGGTGGTGAAGGAGGG - Intergenic
1013236348 6:108200353-108200375 TTTTTGGCGGTGGTGGTGGGGGG + Intergenic
1014074061 6:117216381-117216403 AGTTTGGTGTTGCTGCAGGGAGG + Intergenic
1014296258 6:119621214-119621236 TGTTTGGGGCTGGGGTAGGGAGG - Intergenic
1014336885 6:120147770-120147792 TGAGTGGAGGTGGTGGAGGGTGG - Intergenic
1014927720 6:127294615-127294637 TGTTGTGTGGTTGTGAGGGGGGG + Intronic
1015425243 6:133057473-133057495 TATTTGGTGGTGATGATGGTGGG + Intergenic
1015536542 6:134272617-134272639 AGTTGGGTGGTGGTGAAAGGTGG - Intronic
1015804635 6:137096160-137096182 TGTTTTGTGGTGGTGGTGTGGGG - Intergenic
1015844715 6:137507934-137507956 TGTTTGGTGGAGGTGGTGAGAGG + Intergenic
1016808316 6:148235211-148235233 TGTATGGTGGAGGTGGATGGGGG + Intergenic
1017097602 6:150818508-150818530 TTTTTGGTGGTGGTAGAGGTTGG - Intronic
1017250431 6:152274515-152274537 TTTTTGGGGGTGGGGAAGGGGGG + Intronic
1017482296 6:154869992-154870014 TTTTTGGTGGGGGTGGTGGGGGG + Intronic
1017515553 6:155152808-155152830 TGTGTGGTGGTGGTGGGTGGGGG + Intronic
1017979308 6:159385656-159385678 TATTTGGTGGTGGGGTAGGGGGG - Intergenic
1018133592 6:160756074-160756096 TGTTTTTGGCTGGTGAAGGGTGG - Intergenic
1018398906 6:163402932-163402954 TTTTTGGTGGGGGGGAAGGGAGG + Intergenic
1019123928 6:169826533-169826555 TGGTCGGTGGTGGTGGCGGGGGG - Intergenic
1019162420 6:170077712-170077734 TGTCCTCTGGTGGTGAAGGGAGG + Intergenic
1019282592 7:207868-207890 TTTTTGCTGGTGGAGAAGGAAGG - Intronic
1019821687 7:3248474-3248496 TGTATGGTGGGGGCGAGGGGTGG - Intergenic
1019972727 7:4554601-4554623 TGTTGGGGGGTGGTGAGGGGAGG - Intergenic
1020264220 7:6549611-6549633 TTTTTGGAGGTGGGGAATGGCGG + Intronic
1020276352 7:6626968-6626990 TGTTTGTTGGGGGTGAGTGGTGG + Intergenic
1020277725 7:6635100-6635122 TTTTTGGTGGTGGTGGTGGTTGG - Intergenic
1020482590 7:8680261-8680283 AGTTTGCTGGTGGTGAATCGGGG + Intronic
1020809213 7:12830750-12830772 TTTTTTGTGGTGGGGAGGGGTGG + Intergenic
1021446694 7:20741762-20741784 TGTGTGGTGGTAGTGATGGCTGG - Intronic
1021704323 7:23351752-23351774 TGGGTGGTGGTGGTGCGGGGTGG - Intronic
1022461971 7:30617810-30617832 TGTTTGGTGGTGGAGGCTGGAGG - Intronic
1022797124 7:33741061-33741083 TGTCTGGGGCTGGGGAAGGGGGG - Intergenic
1023023037 7:36027898-36027920 GGTTTGGAGGTGTTGGAGGGGGG + Intergenic
1023665136 7:42514984-42515006 GGATTGGTGGTGGTGAAGAAAGG - Intergenic
1023960486 7:44922126-44922148 TGGTTGGGGGTGGTGGTGGGGGG + Intergenic
1024639223 7:51316421-51316443 TGTTGGGTGCTGGTGTTGGGTGG - Intronic
1025756626 7:64350797-64350819 TGTTTGGTGGTGGTGGTGGGTGG + Exonic
1026414422 7:70163328-70163350 TGTTAGGTTGTGGTGGTGGGGGG + Intronic
1026972346 7:74476076-74476098 TGCCTGGTGGTGGTGAGGGATGG + Intronic
1027723162 7:81770205-81770227 TGTTTGGTGCTGTTGAAGGGGGG - Intronic
1027855189 7:83502242-83502264 TGATTGGTGGTGGTCGAGGGAGG - Intronic
1028760169 7:94487307-94487329 AGTTGGGTGGTGGTGATGGTGGG - Intergenic
1028910432 7:96201772-96201794 TGTTTGGTGGTGGTTGGGCGGGG + Intronic
1029433260 7:100546167-100546189 TTTTTGGTGGGGGTGGCGGGCGG - Intronic
1029997148 7:105017395-105017417 TTTTTGGTGGTGGTGGTGGGTGG + Intronic
1030924482 7:115434866-115434888 TTTTTGGTTATGGTGAAAGGTGG - Intergenic
1030937803 7:115607297-115607319 TGTGTGGTGGTGATGGTGGGAGG - Intergenic
1031057932 7:117014107-117014129 AATTTGGTAGTGGTGGAGGGTGG + Intronic
1031292513 7:119954918-119954940 TGGGAGGTGGTGGTAAAGGGTGG - Intergenic
1031404354 7:121366520-121366542 GGTTTGGGGGTGGGGAAGTGGGG + Intronic
1031407356 7:121402681-121402703 TTTTGTGTGGTGGTGAGGGGTGG - Intergenic
1032058049 7:128699262-128699284 TTTTTGGTGGTGGGGGGGGGGGG - Intergenic
1032531690 7:132626126-132626148 TGATTGGTGGTGGTGAGTGAAGG - Intronic
1033352555 7:140573502-140573524 TTTTTTGTGGCGGTGAAGGAAGG + Intronic
1034889802 7:154829808-154829830 TGTTTGGTGGTGGTGAAGGGTGG - Intronic
1036435911 8:8733063-8733085 AGCATGTTGGTGGTGAAGGGTGG + Intergenic
1037375117 8:18218850-18218872 TCTTTAGTGGAGGTGAGGGGAGG + Intronic
1037513368 8:19605726-19605748 TCTTTGGGGGTGGGGAAGGGTGG - Intronic
1037936030 8:22915618-22915640 TATTTGGTGTTGGGGATGGGCGG - Intronic
1038132510 8:24748788-24748810 TTTTTGGTGATGGTGGTGGGTGG - Intergenic
1038670589 8:29579968-29579990 TGTTTGGCGGTGGTGACTGATGG + Intergenic
1038761860 8:30391717-30391739 TGTTTGGCGGTGGAGGTGGGAGG + Intronic
1038843165 8:31204795-31204817 TGTTTGGAGGTGGGGAAGGAGGG - Intergenic
1039554480 8:38466897-38466919 TTTTTGGTGGTGGTGGGGGGGGG - Intronic
1040394862 8:46987614-46987636 TGTTTAGTGGTGGTGGTGAGAGG - Intergenic
1040452575 8:47562813-47562835 AGTTTGGCGGGGATGAAGGGTGG - Intronic
1040472538 8:47746747-47746769 AGATTGTTGGTGGTGAAGGAGGG + Intergenic
1041007341 8:53508081-53508103 TGGGTGGTGGTGGTGGTGGGTGG - Intergenic
1041245309 8:55883456-55883478 TGCTTGGGGGTGGGAAAGGGTGG + Intronic
1041481375 8:58323377-58323399 TGTTGGGGGGTGGGGGAGGGGGG + Intergenic
1042333404 8:67606177-67606199 TGTTTTGGGGTGGGGGAGGGGGG + Intronic
1042401599 8:68355228-68355250 TGTTTGGTGGTGGGGCAGGGGGG - Intronic
1043414486 8:80033451-80033473 TGTCTGGTGCCGGTGAAAGGTGG + Intronic
1043467692 8:80528716-80528738 TGTTTGGTGGTGGGGGTTGGGGG - Intergenic
1043840037 8:85092134-85092156 TGTTGGGGGGTCTTGAAGGGAGG + Intergenic
1044741531 8:95332307-95332329 TGTTGGGTGGTGGGATAGGGTGG + Intergenic
1045687388 8:104726389-104726411 TTTTTGGTTGTGTTGAAGGAGGG + Intronic
1045722028 8:105123792-105123814 CGTTTGGTGGTAATGAAGGCGGG - Intronic
1046562231 8:115852634-115852656 TGTTGTGGGGTGGGGAAGGGGGG - Intergenic
1047024391 8:120811124-120811146 TGTTGGGGGGGGGGGAAGGGTGG - Intronic
1047520427 8:125591681-125591703 TGGGTGGGGGTGGTGAAGAGAGG + Intergenic
1047544690 8:125804284-125804306 TGTTTGGTGGGTGTGGTGGGGGG + Intergenic
1047767913 8:128004344-128004366 TATTGGGTGGGGGAGAAGGGAGG + Intergenic
1048304951 8:133277822-133277844 TGTTAAGTGGTGGTGGAGAGAGG - Intronic
1048997588 8:139804096-139804118 TGTTTGGTGGTGGTGGTGAGTGG - Intronic
1048997591 8:139804109-139804131 TGTGTGGTGGTGGTGTTTGGTGG - Intronic
1048997599 8:139804143-139804165 TGCTTGGTGGTGGTGGTGGGTGG - Intronic
1048997609 8:139804175-139804197 TGCTTGGTGGCGGTGGTGGGTGG - Intronic
1048997626 8:139804233-139804255 TGTTTGGTGGTGGTGGTGGGTGG - Intronic
1048997631 8:139804246-139804268 TGTGTGGTGGTGGTGTTTGGTGG - Intronic
1048997638 8:139804280-139804302 TGTGTGGTGGCGGTGGTGGGTGG - Intronic
1048997647 8:139804312-139804334 TGCTTGGTGGCGGTGGTGGGTGG - Intronic
1048997663 8:139804366-139804388 TGTTTGGTGGTGGTGGTGAGTGG - Intronic
1048997666 8:139804379-139804401 TGTGTGGTGGTGGTGTTTGGTGG - Intronic
1048997673 8:139804413-139804435 TGCTTGGTGGCGGTGGTGGGTGG - Intronic
1048997686 8:139804461-139804483 TGTTTGGTGGTGGTGGTGAGTGG - Intronic
1048997689 8:139804474-139804496 TGTGTGGTGGTGGTGTTTGGTGG - Intronic
1048997695 8:139804508-139804530 TGTGTGGTGGCGGTGGTGGGTGG - Intronic
1048997704 8:139804540-139804562 TGCTTGGTGGCGGTGGTGGGTGG - Intronic
1048997714 8:139804572-139804594 TGCTTGGTGGCGGTGGTGGGTGG - Intronic
1048997719 8:139804585-139804607 TGTGTGGTGGTGGTGCTTGGTGG - Intronic
1048997726 8:139804617-139804639 TGCTTGGTGGCGGTGGTGGGTGG - Intronic
1048997736 8:139804649-139804671 TGCTTGGTGGCGGTGGTGGGTGG - Intronic
1048997741 8:139804662-139804684 TGTGTGGTGGTGGTGCTTGGTGG - Intronic
1048997748 8:139804694-139804716 TGGTGGGTGGTGGTGGTGGGTGG - Intronic
1049317236 8:141975808-141975830 GGGTTGGTGGTGCTGAAGGGAGG - Intergenic
1049444970 8:142625777-142625799 GGTGGGGTGGTGGTGATGGGAGG - Intergenic
1049520042 8:143083196-143083218 TGTTGGGTGATGGGGAAGGACGG + Intergenic
1050332209 9:4556766-4556788 TATTTGGTGGTGGTGAGTTGGGG + Intronic
1050547995 9:6725241-6725263 TGTTTGGAGATGGTGCAGGAGGG + Intronic
1050668329 9:7967321-7967343 TGTAGGGTGGAGGTGAAGTGGGG - Intergenic
1051319245 9:15882867-15882889 TGTTTGATGGTGGTGGAGGGGGG + Intronic
1051438502 9:17057520-17057542 TGATTGGTGGTGGTGACGGGTGG - Intergenic
1051644579 9:19254991-19255013 GGTGTGGTGGTGGTGGAGGGGGG + Intronic
1051667304 9:19477212-19477234 TGTTTGGGAGTGGTGAAGGGTGG + Intergenic
1051863557 9:21652998-21653020 TGTGTGTTGGTGGGGATGGGTGG + Intergenic
1053180601 9:35965263-35965285 TATTGGGTGGAGATGAAGGGAGG - Intergenic
1053419717 9:37969778-37969800 TGTCTGGGGGTGGTGCAGGTTGG - Intronic
1054744808 9:68843638-68843660 CGGTTGGTGGTGGTAAATGGAGG + Intronic
1055316445 9:75038966-75038988 TTCTTGGTGTTGGTGGAGGGGGG + Intergenic
1055587085 9:77766630-77766652 AGTGTGGTGGGGGTGTAGGGTGG + Intronic
1055691122 9:78831837-78831859 TGTGTGGTGGTGGGGAAGGGAGG - Intergenic
1056045885 9:82715381-82715403 TTGTTGGTGGTGGTGGTGGGGGG + Intergenic
1056461657 9:86814804-86814826 TAATTGGTCGGGGTGAAGGGGGG + Intergenic
1056708890 9:88974343-88974365 TGTTGGGTGGTTGTGAGGTGTGG - Intergenic
1057114929 9:92511932-92511954 TGGTTGGAGATGGGGAAGGGAGG - Intronic
1057207710 9:93183717-93183739 TGGTTCCTGGTGGTGAAGTGAGG + Intergenic
1057522646 9:95772340-95772362 TGCGTGGTGGTGGTGGCGGGGGG - Intergenic
1058781516 9:108341235-108341257 TGTTTTGTGGTTGTGGTGGGTGG + Intergenic
1059312895 9:113400901-113400923 TGGTTGGTGGGGGGGTAGGGAGG - Intronic
1059644735 9:116253560-116253582 TTTTTATTGGTGGTGAGGGGTGG - Intronic
1059693337 9:116707521-116707543 CATTTGGTGGTGGTGTGGGGAGG - Intronic
1059960167 9:119556830-119556852 TATTTGGTGGCGGTGGCGGGGGG - Intergenic
1060188448 9:121577764-121577786 TCTTAGGTGGCGGTGGAGGGCGG + Intronic
1060535533 9:124384028-124384050 TCTTTGGTGGTGGGGGAAGGTGG - Intronic
1062210470 9:135360890-135360912 ACCTTTGTGGTGGTGAAGGGAGG - Intergenic
1185877473 X:3712808-3712830 TGTGTGCTGGGGGTGGAGGGTGG + Intronic
1185890290 X:3816278-3816300 TGTGTGCTAGTGGTGGAGGGCGG + Intergenic
1185894025 X:3843055-3843077 TGTGTGCTGGGGGTGGAGGGTGG + Intronic
1185899143 X:3881479-3881501 TGTGTGCTGGGGGTGGAGGGTGG + Intergenic
1185904260 X:3919908-3919930 TGTGTGCTGGGGGTGGAGGGTGG + Intergenic
1186154001 X:6707018-6707040 TGTTGGTTGGTGGTGTTGGGGGG - Intergenic
1186368829 X:8925868-8925890 TTTTTGGTGGTGGTGATGGTGGG + Intergenic
1186411179 X:9345726-9345748 TGGTTGTTGCTGGTGAGGGGAGG + Intergenic
1186553331 X:10530335-10530357 TCTTTGGTGGTAGTGGTGGGAGG - Intronic
1187223477 X:17353393-17353415 GGAGTGGTGGTGGGGAAGGGTGG - Intergenic
1187452421 X:19410758-19410780 AGTGTAGTGGTAGTGAAGGGAGG - Intronic
1187995143 X:24918193-24918215 TTTTTTTTGGTGGTGATGGGTGG - Intronic
1188255860 X:27961288-27961310 TGTTTGGTGTTGGGGAGGGAGGG - Intergenic
1188292782 X:28409798-28409820 TGTTTGCTGGAGCTCAAGGGTGG + Intergenic
1189222631 X:39385358-39385380 TGATTGGGGGTGGTGAGGGGAGG - Intergenic
1189323370 X:40098849-40098871 TGTTTGGAGGTGGGGGAAGGGGG + Intronic
1189327076 X:40119257-40119279 TTTTTGGTGGTGGTGCCGGTGGG + Intronic
1189365244 X:40383206-40383228 TGATTGGTGGGGGTGGGGGGTGG + Intergenic
1189824056 X:44898924-44898946 TGCTTGGTGGTGGTGGTGGGGGG + Intronic
1190076769 X:47322637-47322659 TGGGTGGTGGTGGTGAATGTTGG - Intergenic
1190442451 X:50488765-50488787 TGTTGGGTGGGGGTGGGGGGAGG - Intergenic
1190639312 X:52467299-52467321 TCTTTGTGGGTGGTGAATGGAGG - Intergenic
1190940730 X:55038141-55038163 TCTTGGGTGGTGGGGCAGGGAGG - Intergenic
1192129607 X:68536775-68536797 TGTGTGGTGGTGGTGGAAGCGGG - Exonic
1192366557 X:70478624-70478646 TTTTTGGCTGGGGTGAAGGGGGG - Intronic
1192872177 X:75195028-75195050 TGCATGCTGGTGGTGAAGGAGGG + Intergenic
1192982914 X:76366476-76366498 TGTTTGATTGTGGTGTAAGGTGG + Intergenic
1193495343 X:82204337-82204359 TGTTGGGGGGTTGGGAAGGGAGG - Intergenic
1193516349 X:82470251-82470273 TGTTACGGGGTGGGGAAGGGGGG - Intergenic
1194211470 X:91074538-91074560 TAGTTGGTAGTGGTTAAGGGTGG + Intergenic
1194394763 X:93368801-93368823 TGTTTGGAGGTGGAGACTGGTGG - Intergenic
1194517110 X:94868233-94868255 TGTTGTGTGGTGGGGGAGGGGGG + Intergenic
1195339375 X:103891263-103891285 TGTTGTGTGGTGGGGGAGGGTGG - Intergenic
1196050648 X:111300015-111300037 TGTGTGGTGGTGGTGGGAGGGGG - Exonic
1196098717 X:111826697-111826719 TGTTTAGTGGAAGTGAAAGGTGG + Intronic
1196488404 X:116241018-116241040 AGTTGGATGGTGGTGAAGGGAGG + Intergenic
1197413331 X:126145118-126145140 TGTTTGGGGGTGGTGGGGGCAGG - Intergenic
1197422604 X:126257597-126257619 GGTTTGATTGTGGTGTAGGGTGG + Intergenic
1197516090 X:127431430-127431452 TGTTGGGAGGTGGTGGGGGGAGG - Intergenic
1197603723 X:128560590-128560612 TCTTTGTTGGGGGTGAAGGGTGG - Intergenic
1197732217 X:129820923-129820945 TGTTGAGGGGTGGGGAAGGGAGG - Intronic
1198079271 X:133223707-133223729 GGATTGGTGGTGGTCAAGGCAGG + Intergenic
1198219681 X:134587902-134587924 AGTTTGGAGGTTATGAAGGGAGG - Intronic
1198461532 X:136867512-136867534 TGTTTGTTGCTGGTGTTGGGAGG + Intronic
1198505834 X:137300546-137300568 TGTTTGGGGGTGATGAATTGGGG + Intergenic
1198958895 X:142162590-142162612 TCTTTGGCGGGGGTGGAGGGTGG + Intergenic
1198960474 X:142177054-142177076 TGGTTGGTGTTGGTGTACGGGGG - Intergenic
1198985484 X:142447611-142447633 TTGGTAGTGGTGGTGAAGGGGGG - Intergenic
1199374244 X:147088357-147088379 TGTGTGGTGGTGGTGATGGGCGG - Intergenic
1199782908 X:151079993-151080015 TGTGTGGATGTGTTGAAGGGGGG + Intergenic
1200007486 X:153097260-153097282 TGTTGGGAAGTGGTGGAGGGAGG + Intergenic
1200010894 X:153119971-153119993 TGTTGGCTTGGGGTGAAGGGAGG - Intergenic
1200028705 X:153279951-153279973 TGTTGGCTTGGGGTGAAGGGAGG + Intergenic
1201947520 Y:19527507-19527529 TAGTTGGTGGTGGTGATGGCAGG - Intergenic
1202117159 Y:21480596-21480618 TTTTTGGTGGCTGAGAAGGGAGG + Intergenic