ID: 1034889803

View in Genome Browser
Species Human (GRCh38)
Location 7:154829811-154829833
Sequence TGGTGTTTGGTGGTGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 541
Summary {0: 1, 1: 0, 2: 7, 3: 68, 4: 465}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889803_1034889810 3 Left 1034889803 7:154829811-154829833 CCCTTCACCACCACCAAACACCA 0: 1
1: 0
2: 7
3: 68
4: 465
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889803_1034889808 -5 Left 1034889803 7:154829811-154829833 CCCTTCACCACCACCAAACACCA 0: 1
1: 0
2: 7
3: 68
4: 465
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889803_1034889811 4 Left 1034889803 7:154829811-154829833 CCCTTCACCACCACCAAACACCA 0: 1
1: 0
2: 7
3: 68
4: 465
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889803 Original CRISPR TGGTGTTTGGTGGTGGTGAA GGG (reversed) Intronic
900718792 1:4161724-4161746 TGAGGTTTGGTGGTGGTGGGTGG - Intergenic
901735275 1:11308436-11308458 TGGTGGTTGGTGCTGGTTATCGG - Intergenic
901921765 1:12541871-12541893 TTTTGTCTGGTGGTGGGGAAAGG - Intergenic
902149622 1:14432718-14432740 TGGGGGTTGGGGGTGGGGAAAGG - Intergenic
902919240 1:19656631-19656653 TGGTGGCTGCTGGTGGGGAATGG + Intronic
903518403 1:23928354-23928376 ATGTGGTTGCTGGTGGTGAATGG - Intergenic
904573320 1:31484393-31484415 TGTTGATGGGTGGTGGTGATGGG - Intergenic
904999813 1:34659379-34659401 TGGTGCTGGGTGCTGGGGAATGG - Intergenic
905677026 1:39833824-39833846 TGGTGTTGGCTGGGGGTGGAGGG - Intergenic
905931570 1:41791818-41791840 TGGGGTTTGGGGGTGGGGAGGGG - Intronic
906081647 1:43093797-43093819 TGTTGTTAGTTGGTGGTGGAAGG + Intergenic
906083157 1:43107548-43107570 GGGTGGTGGGTGGTGGGGAATGG + Intergenic
906703424 1:47876526-47876548 TTGTGTATGGTGGTGGGGAGGGG + Intronic
909753107 1:79189483-79189505 TGGTGAATGGTTGTGGTGAATGG - Intergenic
910186730 1:84549514-84549536 TGTTATTTGGTGGTGGTGGCGGG + Intergenic
911116858 1:94254922-94254944 TGGTTTTTGGTAGTGGGGACAGG + Intronic
911557674 1:99364624-99364646 TGCAGTTTGGAGGTGGGGAAAGG + Intergenic
911753316 1:101523739-101523761 TGGTGTTTTCTGCTGGAGAAAGG + Intergenic
912116855 1:106418095-106418117 TGTTGCTTGGTGCTGGGGAATGG - Intergenic
912364086 1:109118650-109118672 TGGTGTAGGGTGATGGTGACGGG + Intronic
913118038 1:115714553-115714575 AGGTGTTTGGTTGGGGTGAAAGG + Intronic
915996097 1:160565421-160565443 TAGCGCTTGGTGGTGGTGTAGGG + Exonic
916220593 1:162440933-162440955 GGATGTGGGGTGGTGGTGAAGGG - Intergenic
916880852 1:169018406-169018428 TGCTGAGTGGTGGTGGAGAAAGG + Intergenic
916958897 1:169869221-169869243 TGGGGTTTGATGGTGGTGGCAGG - Intronic
917124445 1:171673725-171673747 TGGTTCTTGCTGGTGGTAAATGG - Intergenic
918678201 1:187316986-187317008 TGGTGTTTTATGGTGGTGGGGGG - Intergenic
919134802 1:193494238-193494260 AGGTGTTTGCTAGTGGGGAAGGG + Intergenic
919650474 1:200144167-200144189 TGGTGGTTGGTGGTGATGGGAGG - Intronic
920282408 1:204854076-204854098 TGGTGGGTGGGGGTGGGGAATGG - Intronic
920293864 1:204943949-204943971 TTCTGATTGGTAGTGGTGAAGGG + Intronic
921052731 1:211522712-211522734 TTGTGATTGGTGGTGGTGAGTGG - Intergenic
921367080 1:214383954-214383976 TGGTGCTTGGTGGCCGTGAGGGG + Exonic
921400355 1:214715270-214715292 TGGTGTTTGGTGGTGTAGAATGG + Intergenic
922599217 1:226836919-226836941 TGTTGTTTGGTGGTGGGGATTGG - Intergenic
922614662 1:226954751-226954773 TGGTGTTCGGTGCTGGAGAGAGG + Intronic
922618734 1:226978116-226978138 GGGTGTTTGGTGGGTGTGCAGGG - Intronic
1062769292 10:86614-86636 TGGTGGTTGTTGGTAGTGAGTGG - Intergenic
1063832874 10:9976325-9976347 TGTTTTTTGGTGATTGTGAATGG - Intergenic
1065141018 10:22718149-22718171 TTAGGTTGGGTGGTGGTGAAAGG - Intergenic
1066312739 10:34213402-34213424 TGGTGTTGGGAGGTGGGGCATGG - Intronic
1066348245 10:34610882-34610904 TGGTGTGTGGTGATGGGGAGAGG + Intronic
1067713408 10:48668287-48668309 TGGTATTTGGTGGTGGGGATGGG + Intergenic
1067848733 10:49741835-49741857 TGGTGTTTGGTGTGTGTGCATGG - Intronic
1068375142 10:56168252-56168274 TTGTGTATGGTGCTGGAGAAAGG - Intergenic
1068887712 10:62114688-62114710 TGGTGTTTGGTCATGGGGCAGGG - Intergenic
1069265265 10:66449289-66449311 TGGTGTTTCTTGGTGCTGACTGG + Intronic
1070178357 10:73991938-73991960 TGGTTTTGGGTGGAGGTGGAGGG + Intergenic
1070377406 10:75846723-75846745 TGGTTTTTGTTGGTGGTGGGGGG - Intronic
1073082545 10:100869055-100869077 TGGTGCCTGGTGGAGGTGGAGGG - Intergenic
1073094360 10:100970568-100970590 TTGTGTGTGGGGGTGGTGAGGGG - Intronic
1074346342 10:112689843-112689865 TGATGTGTGGTGGTGGAGCAAGG - Intronic
1074717738 10:116235480-116235502 TGGTGGTGGGTGGTGATGATGGG - Intronic
1074723198 10:116281636-116281658 TGGTCTGTCGTGGTGGTGACAGG - Intergenic
1074733021 10:116397733-116397755 GTGTGAGTGGTGGTGGTGAACGG + Intergenic
1076505647 10:130971095-130971117 TGGCGTCTGTTGGTGGTGAGGGG + Intergenic
1076889935 10:133278474-133278496 TGGGGTTTGCAGGTGGTGATAGG - Intergenic
1076941524 10:133613162-133613184 TGCTGTTTGAAGGTGGTGGAGGG + Intergenic
1077190295 11:1253146-1253168 TGGGGTGTGGTGGTGGTGTTTGG + Intronic
1077684918 11:4282740-4282762 TTGTGTTTTTTGGTGGAGAAGGG + Intergenic
1077690272 11:4335190-4335212 TTGTGTTTTTTGGTGGAGAAGGG - Intergenic
1080697924 11:34619316-34619338 TTGTGTGTAGTGATGGTGAAGGG - Intergenic
1081746679 11:45477958-45477980 TGCTGTTGGGTGGTGGAGAAGGG + Intergenic
1081842283 11:46211413-46211435 TTGTGTGTGGTGGGGGTGCAGGG - Intergenic
1082044055 11:47710593-47710615 TGGTGGTGGGTGGTGATAAAAGG - Intronic
1082632827 11:55561185-55561207 TGTTGTTTGGTCGTGGGGATTGG - Intergenic
1083161588 11:60857772-60857794 TGGGGTGGGGTGGTGGGGAAGGG - Intergenic
1083291379 11:61692244-61692266 TGGAGGAGGGTGGTGGTGAAGGG - Intronic
1083780458 11:64914878-64914900 AGGTGCTTGGGGGTGGTGAGGGG + Intronic
1084023111 11:66430051-66430073 TGGTATTTGGTGGCAGTGACAGG + Intergenic
1084585731 11:70061060-70061082 TGTTGTTTGGTGGTGGAGATTGG + Intergenic
1084622672 11:70283807-70283829 TGGTGTTTGGTGGTGTTGAGAGG + Intronic
1084953622 11:72679950-72679972 TGGAGGGTGGTGGTGGTGAGGGG - Intergenic
1085213625 11:74806845-74806867 TTGATCTTGGTGGTGGTGAATGG + Intronic
1085662370 11:78380766-78380788 GGGGGTTTGGGGGTGGGGAATGG - Intronic
1085816056 11:79738756-79738778 TGGTGTATGTGGGTGGTGAGAGG + Intergenic
1086066872 11:82754887-82754909 TTGAATTTGATGGTGGTGAAGGG - Intergenic
1086260360 11:84932506-84932528 TGTTGTGTGGTGGGGGTGAGGGG - Intronic
1087245933 11:95836841-95836863 TAGTGTTTGGCAGGGGTGAATGG + Intronic
1088574894 11:111261235-111261257 TGGTACTAGATGGTGGTGAACGG - Intronic
1088588535 11:111380425-111380447 GGGTGTTTGGTGGTGCTTAGAGG - Intronic
1088682363 11:112254319-112254341 TGGTGTGTGGGGGTGGTGTGTGG + Intronic
1089125423 11:116173117-116173139 TGGTGTTTGCAGTTGATGAATGG + Intergenic
1090613451 11:128492955-128492977 TTGTGTTGGATGGGGGTGAAGGG - Intronic
1091033104 11:132209026-132209048 TGGTGTTGGGGGGTGGGGGAAGG + Intronic
1092918020 12:13205927-13205949 TGCTGATTGGTGGTGGTTAGAGG + Intronic
1093617065 12:21238571-21238593 TGGTGTAAGGTGCTGGAGAAGGG + Intronic
1094565508 12:31595056-31595078 TGGAGTGTGGTGGTGAAGAACGG + Intergenic
1095977104 12:47947291-47947313 AGGTGGTTGGTGGTGGGGACGGG - Intergenic
1096553395 12:52388945-52388967 GGCTGTCTGGTGGAGGTGAAAGG + Intergenic
1097808018 12:63986764-63986786 TGGTAATTGGTGGCTGTGAAGGG + Intronic
1098185055 12:67887978-67888000 TCTTGTTGGATGGTGGTGAAAGG - Intergenic
1098695266 12:73545113-73545135 TGGGGGTTGGTGATGGTTAATGG + Intergenic
1100629301 12:96371374-96371396 TGGAGTTAGGAGGTGGTTAAAGG - Intronic
1100683582 12:96959366-96959388 GGGCGTTTGGTGGTGGAGTAGGG + Intergenic
1100774710 12:97961447-97961469 TGTTGGTTGGTGGGGGTGAGGGG - Intergenic
1100882867 12:99037940-99037962 TGGTGTGTGGTGGTAGAGAAAGG + Intronic
1100909805 12:99346416-99346438 ATGTGTGTGGTGGTGGGGAAGGG - Intronic
1101612994 12:106309172-106309194 TGGGGTTTGGTGGCAGTGAAAGG + Intronic
1101797979 12:107993851-107993873 TGGTTACTGGTGGTGGGGAAGGG - Intergenic
1101923373 12:108951295-108951317 TGGTGTTTGGCTGCGGTGCATGG + Intronic
1103063251 12:117875858-117875880 GGGTGTGTGGTGGTGGTGGGGGG - Intronic
1103530621 12:121598839-121598861 TGCTGTTGGGTGTTGGAGAAAGG + Intergenic
1103553178 12:121750816-121750838 TGGTGTGTGGTGTTGGTGTGGGG - Intronic
1104583648 12:130029764-130029786 TGGTCTTTTCTGGTGGTGAAAGG - Intergenic
1104624594 12:130340612-130340634 TGGGGGTTGGTGGTGGTGGTTGG + Intronic
1104727366 12:131086225-131086247 TGGGTTTTGGGGGTGTTGAATGG + Intronic
1105257904 13:18756796-18756818 AGGAGTTTGGTGGTGGTGGAAGG - Intergenic
1105340989 13:19525521-19525543 TGATTTTTGTTTGTGGTGAAAGG - Intronic
1105789000 13:23779418-23779440 TGGTTTTTTGTTGTTGTGAATGG - Intronic
1105988463 13:25593106-25593128 TCGTATTTGGTGGTGGGGAGGGG + Intronic
1106900492 13:34350278-34350300 TGGTCAGTGGTGGTGGTGATAGG - Intergenic
1110170370 13:72492897-72492919 TGTTTTTTGGTGGTGGGGAGGGG - Intergenic
1111300288 13:86341077-86341099 TGGTGGGTGGTGGTAGTGCAAGG - Intergenic
1111380368 13:87441989-87442011 TGGTGGTTGGTGGTTGCCAAGGG + Intergenic
1112310118 13:98310679-98310701 TGGTGGTGGGTGGTGGTGGGTGG + Intronic
1114221895 14:20704222-20704244 TGTTGTTTGGTGGTGGGGACTGG - Intergenic
1114647223 14:24262565-24262587 TGTTGTTTGGTGGGGGTGAGGGG - Intronic
1114902746 14:27085187-27085209 TGGTTTTTGGTGGTGGTCCCTGG - Intergenic
1115086421 14:29520953-29520975 GTGTGTTTGGTGGTGGTGCTGGG - Intergenic
1115402297 14:32975837-32975859 TTGTGATTGTTGGTGGTGAGGGG + Intronic
1116503891 14:45654111-45654133 TGGTGGTTGGTGATGTTGAATGG + Intergenic
1117008642 14:51447779-51447801 TGGTGTTGAGGGGTGGGGAATGG - Intergenic
1118077035 14:62310667-62310689 TCCTGTTTTGTGGTTGTGAATGG + Intergenic
1118096852 14:62546731-62546753 TGCTGTTTGGGGTTGGGGAAGGG - Intergenic
1118774549 14:68965598-68965620 CCTTGTTTGGTGTTGGTGAAGGG - Intronic
1120666639 14:87314298-87314320 GGTTGTTTGGTGCTGGTGATTGG - Intergenic
1120813511 14:88829036-88829058 TGGTGTTTGGTAATGGGGAAGGG + Intronic
1120844564 14:89114646-89114668 TGTTGTGTGGTGGTGGGGTAGGG + Intergenic
1120917681 14:89724006-89724028 TGGGGCTTGGGGGTGGGGAATGG - Intergenic
1121176400 14:91893843-91893865 TGGTGGTTGGTGGCGGGGAAGGG + Intronic
1121515629 14:94548113-94548135 TGGTGTTTTATGGTGGTTAGTGG + Intergenic
1121743849 14:96272531-96272553 TGGGGTTGGGAGCTGGTGAAGGG + Intergenic
1122322992 14:100866727-100866749 TGGTGTTGGCTGATGGTGGAAGG + Intergenic
1122407579 14:101509389-101509411 TGGTGTTTGGTGAAGGGGAGTGG + Intergenic
1122625229 14:103082108-103082130 TGGTGGGTGCTGGTGGTGAATGG + Intergenic
1122661995 14:103302142-103302164 TTGTCTTTGGTGGTGGTGGCAGG - Intergenic
1123132028 14:105995113-105995135 TGGTGTCTTGTGGTGTTGACTGG + Intergenic
1123582262 15:21726239-21726261 TGGTGTCTTGTGGTGTTGACTGG + Intergenic
1123618912 15:22168835-22168857 TGGTGTCTTGTGGTGTTGACTGG + Intergenic
1124132162 15:27000500-27000522 TGGTGCCTGATGGAGGTGAATGG + Intronic
1124166503 15:27330844-27330866 TGGTGTGTCGTGGTAGTGATGGG + Intronic
1127114519 15:55711621-55711643 TGGTTGTTGGTTGGGGTGAAAGG - Intronic
1129780945 15:78270636-78270658 TGTTCTTTGGTGGTGGTGGACGG + Exonic
1130234375 15:82120640-82120662 TCGTGATTTGTGGTGGTGACTGG - Intergenic
1131388287 15:92026115-92026137 TGGTGACTGGTGGTGGACAAGGG - Intronic
1131865587 15:96705259-96705281 TGGTAGGGGGTGGTGGTGAAAGG - Intergenic
1133858151 16:9568973-9568995 TTGTTTTTGGTTGTGGTGATGGG + Intergenic
1134302622 16:13005131-13005153 TGGTGTGTGGAGTTGGTGGAGGG + Intronic
1136043689 16:27599694-27599716 AGGGGTTGGGTGGTGGAGAATGG - Intronic
1136173525 16:28502590-28502612 TGGGGATTGCTGGTGGGGAAGGG - Intronic
1136354591 16:29735917-29735939 GGGTGTTTGGAGGTGCTGATGGG + Intergenic
1136392845 16:29976220-29976242 GGGTGTGTGGTGCTGGTGAGGGG + Intronic
1138220238 16:55244075-55244097 TGGTATTTGCAGGTGGTGTAAGG + Intergenic
1139099234 16:63745076-63745098 GGGTGTTTGATGGTGGTACAAGG - Intergenic
1139176031 16:64688765-64688787 CTGAGTTTGGTGGTAGTGAATGG + Intergenic
1139891900 16:70258498-70258520 TGGTGGTTGGTGGAGGGGAGAGG - Intronic
1140313693 16:73872950-73872972 TGGTGGTGGGTGGTGGTGGGTGG + Intergenic
1140313758 16:73873136-73873158 TGGTGGTGGGTGGTGGTGGGTGG + Intergenic
1140313771 16:73873170-73873192 GGGTGGTGGGTGGTGGTGGATGG + Intergenic
1140778510 16:78272876-78272898 TGTTGTCTTGTGGGGGTGAAAGG - Intronic
1140810952 16:78577290-78577312 TTGTATTTGGTGGTGGTGCAGGG + Intronic
1141601247 16:85127686-85127708 TTGTCTGTGGTGGTGGAGAAGGG - Intergenic
1142171144 16:88623492-88623514 TGGTGTTTGGTGGGGGACACAGG - Intronic
1142571603 17:878401-878423 TGGGGTTTGGGGGTGGGGGAGGG + Intronic
1142668693 17:1477414-1477436 TGGTGTTTTGTGATGGCGGAGGG + Intronic
1142964767 17:3573601-3573623 TGGAGTTGGGGGGTGGTGAGTGG - Intronic
1143501124 17:7339765-7339787 TGGTGTGTGGTGATGGTTAAAGG - Intronic
1144296248 17:13877816-13877838 TGGTGTTTGGTGGTTGAAGAGGG + Intergenic
1144355775 17:14444864-14444886 TGATAGTTGGTGGAGGTGAAGGG - Intergenic
1145867561 17:28250626-28250648 TGGGGTTTCGTGGTGGTCCATGG + Intergenic
1146650184 17:34601777-34601799 TGGGGTTTTGGGGTGGGGAAGGG - Intronic
1148604795 17:48920967-48920989 TGGAGGGTGGTGGAGGTGAATGG + Intronic
1148835419 17:50463378-50463400 TGGTGTCTGGTGATGGAGACAGG - Exonic
1149319819 17:55471503-55471525 TGCTGTTTGGTGGTGGGGATTGG - Intergenic
1149345832 17:55734430-55734452 TGGGGGTTGATGGTGGTGAAGGG - Intergenic
1149422487 17:56524158-56524180 TGTTGTGGGGTGGTGGAGAAGGG + Intergenic
1149469668 17:56905832-56905854 TGGAGAGTGGGGGTGGTGAAGGG + Intronic
1149563639 17:57626939-57626961 TTGTGTTTGGTGCTGATGCATGG + Intronic
1150336374 17:64333450-64333472 TGGTGTTTTGTGGTGGGGAGGGG + Intronic
1151624205 17:75266535-75266557 TGGTGGGTTGTGGTGGGGAAAGG + Exonic
1152036153 17:77874368-77874390 CTGTGTTTGGTGATGGTGCAGGG - Intergenic
1152683005 17:81679323-81679345 AGCTGTTTGGTGGTGGTAAGAGG + Intergenic
1152962365 18:87415-87437 TGGTGGTTGTTGGTAGTGAGTGG - Intergenic
1153614278 18:6920353-6920375 TGGTGTGTGGTGGTGGTGTGTGG + Intergenic
1153985773 18:10349971-10349993 TGGGGTTTGGTGGGAGAGAAAGG - Intergenic
1154427218 18:14281221-14281243 TGGTTTATGGTGGGGGTGAGGGG + Intergenic
1155436460 18:25817741-25817763 TCGTGTTAGCAGGTGGTGAAAGG - Intergenic
1156355166 18:36334440-36334462 TGGTGTTAGCTGTTGTTGAAAGG - Intronic
1156485265 18:37461621-37461643 TGGATTTTAGTGCTGGTGAAAGG + Intronic
1157020097 18:43771165-43771187 TGGTGTTTGCTGGAGGTGACTGG - Intergenic
1157869318 18:51215356-51215378 TGTTTTTTGTTGGTGGTGATTGG - Intronic
1158267555 18:55677025-55677047 TGGTGGGGGGTGGTGGTTAATGG + Intergenic
1159505995 18:69336578-69336600 TGGTGTTTGGTTACTGTGAATGG + Intergenic
1160029446 18:75246008-75246030 TGGTGTTTGCTGGGGGAGAGGGG - Intronic
1160334676 18:78028139-78028161 TTGTGTTTGTTGGAGGTGGAGGG + Intergenic
1160406529 18:78650301-78650323 GGGTGTGTGGTGGTGGTTATTGG + Intergenic
1160739031 19:677466-677488 TGGTGTTTGGTGGTGTTTGAGGG + Intronic
1162968170 19:14165528-14165550 GGGAGTTTGGTGCTGGTGAAGGG - Intronic
1164664174 19:30013089-30013111 CAGTTTTTGGTGGTGGTGCAGGG + Intronic
1165098209 19:33421906-33421928 TGGTGGCTGGGGATGGTGAATGG + Intronic
1165122935 19:33574027-33574049 TGGGGGTTGGTGGTGGTGGGTGG - Intergenic
1165353568 19:35290762-35290784 TGGGCTTTGGTGGTGGTGGTCGG - Intergenic
1165356514 19:35307819-35307841 TGGTGTTTGGTGCTAGTGGCAGG + Intronic
1166040345 19:40198544-40198566 TGATGTCTGGAGGTGCTGAAAGG + Exonic
1166342715 19:42148544-42148566 TGGTGTTGGGTGGAGGTGACTGG + Intronic
1167499263 19:49836257-49836279 TGGTGGCTGGAGGTGGTGGAGGG - Exonic
1168284766 19:55325412-55325434 TTGTGGTTGGTGGTGGGGACTGG + Intronic
1168460006 19:56546875-56546897 TGCAGTTTTGTGGAGGTGAAAGG - Intronic
925233027 2:2252684-2252706 TGGTCTTTGGTGGTGGGGACAGG - Intronic
925314927 2:2914195-2914217 TGGAGTTTTGTGGTGTTGCATGG - Intergenic
925333835 2:3078571-3078593 TGGTGTTTGGGGGGGCAGAAAGG - Intergenic
926748320 2:16178672-16178694 TGGAGATTGGTGGTGGTGGGAGG + Intergenic
927414381 2:22862594-22862616 TTGGGTTTGGTGGTGGTTCACGG + Intergenic
927414610 2:22865822-22865844 AGGTGTGTGGTGGGGGTGCAGGG + Intergenic
927495753 2:23550412-23550434 TGGTGCTTAATGCTGGTGAAAGG + Intronic
928914184 2:36454355-36454377 TTGTGTGTGGTGGTGGTGAGGGG - Intronic
930664018 2:54084123-54084145 TGGGCTTTGGTGGAGGTGAAAGG + Intronic
931099542 2:58980766-58980788 TGGTTGTGGGTGGTGGGGAATGG + Intergenic
931670435 2:64642622-64642644 TGGTTTTTGTTGGTGGTGGTAGG - Intronic
932092278 2:68816965-68816987 TAGTGCTTGTTGCTGGTGAAGGG - Intronic
932263574 2:70346808-70346830 TTGTGTGGGGTGGTGGTGAGGGG + Intergenic
932316840 2:70790348-70790370 AGGTGTTTGGTGGTAGAGCAGGG + Intronic
932524343 2:72447162-72447184 TGGTTTTTAGAGGTGGTAAAAGG - Intronic
932814352 2:74849891-74849913 TTGTAGCTGGTGGTGGTGAAAGG - Intronic
933651093 2:84850852-84850874 TGATGTTAGGTGGTGGAGGAAGG - Intronic
934543845 2:95198407-95198429 TGTTGTTTGGAGGTGGTGAAAGG + Intergenic
937262503 2:120595518-120595540 TGGTGTTTGGTGGAGGCCCAGGG + Intergenic
937429946 2:121829854-121829876 TGGTGAGTGGTGCTAGTGAAGGG + Intergenic
937446956 2:121966453-121966475 TGGTGTTGGGGGTGGGTGAATGG + Intergenic
938638168 2:133251267-133251289 TGGATTTTGGTACTGGTGAAAGG + Intronic
938736392 2:134190494-134190516 TGGGGTTGGGTGGTGGGGAAGGG - Intronic
939507994 2:143072603-143072625 TGGGTTTTGGGGGTGGTGGAAGG + Intergenic
939997520 2:148933620-148933642 TGGGGTGTGGTAGTGGTGTATGG - Intronic
940261048 2:151780162-151780184 TGGTGTAGGCTGGTGGTGATGGG - Intergenic
940464645 2:154013248-154013270 TGGTGTTTGATTGTGGTATAGGG + Intronic
940977122 2:159958519-159958541 GGGTGTATGATGGTGGGGAAGGG - Intronic
941604663 2:167582631-167582653 TGGTGTTTGGTGATGGGGCACGG + Intergenic
941860839 2:170278674-170278696 TGATGTTTGGTAGTGGAGTAGGG - Intronic
942089976 2:172480417-172480439 TGGTGGCTGGTGGTTGTGAAAGG + Intronic
942414847 2:175747816-175747838 TGGAGGTTGGTGGTGGTCCAAGG - Intergenic
942614498 2:177776408-177776430 TGTTGTGAGGTGGGGGTGAAAGG - Intronic
942789924 2:179749367-179749389 TGGAGTTTGGAGGAGGTGGAAGG - Intronic
943843123 2:192604636-192604658 TGGTGTGTGGAGGAGGAGAAGGG + Intergenic
945033720 2:205686600-205686622 TAGTGTTTGGAGGTGGGGGAGGG + Intronic
945781300 2:214175910-214175932 TGGTGTTTGGTTGTGGGGAATGG + Intronic
947277231 2:228406210-228406232 AGGAGATTGGTGGTGGAGAAAGG + Intergenic
948273103 2:236688791-236688813 TGGTGGTTGGGGGTGGGGAGGGG + Intergenic
948512301 2:238476711-238476733 TGGACTGTGGTGGTGGTGAATGG + Intergenic
948605887 2:239134479-239134501 TGGTGTGGGGTGGTGGTGATGGG - Intronic
1169544203 20:6634531-6634553 TTGTGTTAGGTGTTGTTGAATGG - Intergenic
1169888441 20:10428259-10428281 TGGTGATTGGTGGAGGAGAGGGG + Intronic
1170307142 20:14951035-14951057 TGATGTTTGTTGGTAGTGAGTGG - Intronic
1170774834 20:19366132-19366154 AGGTTTTTGGTGGTGGTGGTAGG + Intronic
1170867525 20:20172694-20172716 CTGTGTATGGTGGTGGAGAAGGG - Intronic
1171883706 20:30636240-30636262 AGGAGGTTGGTGGTGGTGGAAGG - Intergenic
1172266424 20:33618955-33618977 GAGAATTTGGTGGTGGTGAAGGG + Intronic
1173203045 20:40968125-40968147 TTTTTTTTGGTGGTGGTGAGCGG + Intergenic
1173340335 20:42147606-42147628 TGGTGTTTGTTGATGGTGAGAGG - Intronic
1175147050 20:56904842-56904864 TGGTGGCTGGTGGGGGTGGAGGG + Intergenic
1175337690 20:58206858-58206880 TGGCTTTTGGTGGTGGTGGTGGG - Intergenic
1175429227 20:58890752-58890774 TGGTGTCTGGTGGCGGTGGCGGG - Intronic
1176846579 21:13881146-13881168 AGGGGGTTGGTGGTGGTGGAAGG - Intergenic
1177256168 21:18665340-18665362 TAGTGTTTGTTGCTGGTGTAAGG + Intergenic
1178590633 21:33906661-33906683 TCATCTTTGGTGGTGGTGAGTGG - Intronic
1179078632 21:38148734-38148756 TGGTGTTTGGTCATGCTGACTGG + Intronic
1179408458 21:41144000-41144022 TGGTGGTTGCTGGTGATCAAAGG + Intergenic
1179879191 21:44286391-44286413 TGGAGTCAGGTGGTGGTGTAGGG - Intronic
1180094508 21:45549750-45549772 AGGTGGTTGGTGGTGGGGAGGGG + Intergenic
1181024936 22:20122783-20122805 TGGTGTCTGGGGGGGGTTAATGG + Intronic
1181528151 22:23501857-23501879 TGGTGGGTGGAGGTGGTGAGTGG - Intergenic
1181832700 22:25574635-25574657 AGGTATTTGGTGGTGGTGGCGGG + Intronic
1182386211 22:29943763-29943785 TGGGGTTTGGGGGTGGGGAAGGG - Intronic
1183193076 22:36334310-36334332 TGGTGTTGGGTGGTGGCCCAGGG + Intronic
1183976544 22:41515576-41515598 TGGTGGTTGGTGGGGATGAACGG + Intronic
1184583766 22:45434188-45434210 TGGTGTGGGGTGGGGGTGGAAGG + Intergenic
949213938 3:1541560-1541582 TAATGTTTTGTGGAGGTGAATGG + Intergenic
950445890 3:13037839-13037861 TGGTGGCTGCTGGGGGTGAAGGG + Intronic
951995801 3:28727093-28727115 TGGTGTATGGTTTTGGTGTATGG + Intergenic
952809813 3:37391710-37391732 TGTTTTTTGGTGGTGGAGATGGG - Intronic
952989685 3:38821008-38821030 TGGAGTTTGGAGGGGGTGAGAGG - Intergenic
953531018 3:43740050-43740072 TAGTTTTTGGTGGGGGGGAAGGG - Intergenic
953840942 3:46389819-46389841 TGTTGTTTGGTGGTGGGGGTTGG + Intergenic
954677931 3:52325855-52325877 TGGTGCTGGGTGGTGTGGAAAGG + Intronic
956259451 3:67322671-67322693 TGTTGTAAGTTGGTGGTGAAGGG + Intergenic
956318666 3:67969569-67969591 TGTTGTTTGATGGAGGGGAAAGG - Intergenic
956732351 3:72208182-72208204 TGGAATTTGGTGGGGGTGGAGGG - Intergenic
956863711 3:73349224-73349246 TGGTGTTTGGCGGGGGTGATGGG + Intergenic
956918965 3:73906151-73906173 TGGTATGTGGTGGTGGACAAGGG - Intergenic
957548244 3:81668209-81668231 TGTTGTGGGGTGGGGGTGAAGGG + Intronic
958498333 3:94874333-94874355 TGGTGCTTGGTGGTGGGGAGGGG + Intergenic
958733917 3:97988610-97988632 TGGGTGGTGGTGGTGGTGAATGG + Intronic
958733954 3:97988778-97988800 TGGCGTTTGGTAGTGGTGGATGG + Intronic
958734045 3:97989157-97989179 TGGTGGTTGATGGTGGTGGGTGG + Intronic
958734057 3:97989212-97989234 TGGTGGATGGTGGTGGTGGATGG + Intronic
958734091 3:97989356-97989378 TGGTGTGTGGTGGTGTTTGATGG + Intronic
958734095 3:97989366-97989388 TGGTGTTTGATGGTGGTTAGGGG + Intronic
958909124 3:99973827-99973849 TGGTGTTTGTTGTTGGTGGTGGG + Intronic
959094875 3:101943901-101943923 TGGAGTTTGGTGGGAGTGGAGGG + Intergenic
960157929 3:114317033-114317055 TGGTGTCAGTTGGTGGAGAAGGG - Intergenic
961077095 3:123992275-123992297 TGGGCTTTGCTGGTGGTGGAAGG + Intergenic
961307481 3:125969025-125969047 TGGGCTTTGCTGGTGGTGGAAGG - Intergenic
961424782 3:126836472-126836494 TGGTGTCAGATGGTGATGAAGGG - Intronic
961671469 3:128534812-128534834 TGGTGTTTGATGATGCTGAGTGG - Intergenic
962028247 3:131571711-131571733 GGGTGTTTGATGGTGGTGATGGG - Intronic
962357337 3:134706022-134706044 AGAGGTTTGGTGGTGGTGGAGGG + Intronic
963081498 3:141399260-141399282 TGGGGTTGGGAGGTGGGGAATGG - Intronic
963928126 3:150973196-150973218 TTGTTTTTGGTGGTGGGGGAAGG + Intergenic
964058788 3:152495289-152495311 GGGTGTTTGGTTGTGGTCAATGG - Intergenic
966975331 3:185077773-185077795 TGCTATTTGGTGGTGGTGGGGGG + Intergenic
967158847 3:186717913-186717935 GGGTGGTGGGTGGTGGTGGATGG - Intronic
967158853 3:186717930-186717952 TGGTGGTGGGTGGTGGTGGGTGG - Intronic
967158901 3:186718070-186718092 TGGTGGTTGGTGGTGGTGGGTGG - Intronic
967158909 3:186718093-186718115 TGGTGGTTGGTGGTGGTGGATGG - Intronic
967158938 3:186718178-186718200 TGGTGGATGGTGGTGGTGGTGGG - Intronic
967158985 3:186718306-186718328 TGGTGGGTGGTGGTGGTGGTGGG - Intronic
967158998 3:186718339-186718361 TGGTGGGTGGTGGTGGTGGTGGG - Intronic
967159003 3:186718352-186718374 TGGTGGTGGGTGGTGGTGGGTGG - Intronic
968027484 3:195454652-195454674 TGGTTTCTGGTGCTTGTGAAAGG - Intergenic
968236643 3:197035377-197035399 TGGTGTCTGATGCTGCTGAAGGG + Intergenic
968246100 3:197149937-197149959 TTCTGTTTGGTGCTGGAGAAAGG - Intronic
969335919 4:6510221-6510243 GGGTGGTGGGAGGTGGTGAAAGG - Intronic
970330240 4:14975136-14975158 TGGTGTTAGATGGTGCTGGATGG - Intergenic
970356906 4:15263626-15263648 GGCTGTTTGGTGGTGGTGCCAGG - Intergenic
970423222 4:15924193-15924215 TGGTGTGTGGTGGTGGTAGCAGG + Intergenic
971054640 4:22898439-22898461 TGATTTTTGGTGGAGGTGGAGGG + Intergenic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
972123821 4:35739664-35739686 TGGGGCTTGGTGGAGGTGATTGG - Intergenic
972385213 4:38559532-38559554 TGGTGGTGGGTGGTGGGGGAGGG - Intergenic
975529327 4:75384932-75384954 TGGGGTTTGGGAGTGGGGAAAGG - Intergenic
975670862 4:76779279-76779301 TGGTGTTTGTTCCTGATGAAAGG + Exonic
976350806 4:84057607-84057629 TGGTGGTTGGGGGTGGCAAAAGG - Intergenic
976659298 4:87522624-87522646 GTGTGTTTGGTGGTGGTGGCTGG - Intronic
978185123 4:105848529-105848551 TTGTTTTTGGTGGTGGTGGTGGG - Intronic
978481081 4:109191511-109191533 TGGTGGTTGGCCGAGGTGAAAGG - Intronic
978982029 4:114958475-114958497 TGGTGTTTGATGGAGATGATTGG - Intronic
979013269 4:115397575-115397597 TAGGGTTTGGTGGTGGGGCAGGG - Intergenic
980409405 4:132396791-132396813 TGGTATTTAATGGTGCTGAAAGG + Intergenic
982424461 4:155242156-155242178 GGGTGGTGGGTGGTGGTGAGGGG + Intergenic
982917652 4:161232911-161232933 TTGTTTTTTGTGTTGGTGAATGG - Intergenic
982967945 4:161938085-161938107 TGATGAATGGTGGTGGTGAAAGG - Intronic
983271926 4:165572177-165572199 TGGTGGTGGGTGGGGGTGAGGGG + Intergenic
983595054 4:169457069-169457091 TGGTGGTGGGTGGTGGGGGATGG + Intronic
984684914 4:182656524-182656546 GGGTGGTGGGTGGTGGTGCATGG - Intronic
985425710 4:189828463-189828485 TGGGGTGAGGTGGTGGGGAAAGG - Intergenic
985624505 5:978033-978055 TGCTGTTTGGTGGTACTGTAGGG - Intergenic
985859451 5:2459007-2459029 TGGGGTCTGTTGGTGGTGAGGGG + Intergenic
986581662 5:9272164-9272186 TGGAGCTTGGTGGGGGTGTAGGG + Intronic
986650557 5:9959428-9959450 TATTGTTTGGTGGTGGTGGTAGG - Intergenic
986763082 5:10897681-10897703 TGGGGATTGGTGGAGGAGAATGG + Intergenic
987069674 5:14323877-14323899 TGGTGTTTGGCAGTGCTGTAAGG - Intronic
987353602 5:17043005-17043027 TGGTGACAGGTGGTGGTGAGAGG + Intergenic
988098336 5:26646044-26646066 TGGTGGGTGGTGATGGTGATGGG + Intergenic
988375314 5:30428503-30428525 TGGTCTTTGATGATGGTGATGGG + Intergenic
988879792 5:35488997-35489019 TGCTGTTTGATAGTGGTGAAAGG - Intergenic
989160394 5:38385294-38385316 TGGTGTTTGTTGGCGGTGGCGGG - Intronic
989214116 5:38885890-38885912 TGGTATTTGTTGGTGATGGATGG + Intronic
989333527 5:40287993-40288015 TGGTGTTGGGTGGGCTTGAAAGG - Intergenic
990706850 5:58539577-58539599 AGGTGTGGTGTGGTGGTGAAAGG + Intergenic
991257276 5:64629117-64629139 TGGGGGTTGGTGGTGGCGCAGGG - Intergenic
991271266 5:64784646-64784668 TGGATTTTTGTGGTGATGAAAGG + Intronic
992227042 5:74629031-74629053 TGGGGTTTGGTTGTGCTGATAGG - Exonic
992531193 5:77653223-77653245 TGGTGTATGGCTGTGGTAAAGGG + Intergenic
992608111 5:78482434-78482456 CAGTGAGTGGTGGTGGTGAAGGG + Intergenic
992780405 5:80122030-80122052 TGTTATTTGGAGGTGGAGAAAGG - Intronic
992861611 5:80916570-80916592 TGGGGTTTGGTGGTAGAGATGGG - Intergenic
993100441 5:83532239-83532261 TGGTGGGTGGAGGTGGTGACAGG + Intronic
993133253 5:83925603-83925625 TGGTGTGTGGGGGTGGGGAAAGG + Intergenic
993331602 5:86606944-86606966 TGGTTTTTGTTAGTGGTAAATGG - Intergenic
993349429 5:86829962-86829984 TGGGGTTTGGTGGTAGTTAGTGG + Intergenic
993962779 5:94320477-94320499 GGGTGTGGGGTGGTGGTGAGGGG - Intronic
994594708 5:101817732-101817754 TGGGGTTTTATAGTGGTGAAGGG + Intergenic
996794028 5:127324780-127324802 TGGTGTTTGGTGGTGATAAAGGG - Intronic
996956719 5:129191957-129191979 TGCTGTGAGGTTGTGGTGAAAGG + Intergenic
997153478 5:131525732-131525754 TGGTGTTTGGTTGGGGTGTCAGG + Intronic
997631183 5:135369938-135369960 TGGTGTTGGCTGGTTATGAAAGG - Intronic
997991577 5:138548740-138548762 TGGTCTTTTGTGGGGGTGCAGGG + Intergenic
999018873 5:148141149-148141171 TGGTGTTTGAAGGTGTGGAAAGG - Intergenic
999130366 5:149278389-149278411 TGGGATTTGATGGAGGTGAAAGG - Intronic
999265110 5:150261949-150261971 AGGTGATTTGTGGTGGGGAAGGG - Intronic
999467272 5:151819582-151819604 TGGTGAATGGTGGTGAGGAAAGG - Intergenic
1000991387 5:167915475-167915497 TGGTGGTTGGTGGGGGTGTAGGG - Intronic
1001229096 5:169970467-169970489 TGCTGTTTGAAGGTGGTGGAGGG + Intronic
1002052106 5:176577071-176577093 TGGTGTTTGGTGTTGCTGTGGGG + Intronic
1002093686 5:176818645-176818667 TGGTGTGTGGTGGGGGAGATCGG - Intronic
1003142953 6:3486770-3486792 TGGAGTTGGATGGTGGTGATGGG + Intergenic
1004679022 6:17874282-17874304 TGTTTTTTGGTGGTGGTGGGGGG + Intronic
1005784666 6:29230967-29230989 TGGTGTGTGGTGTTAGGGAAGGG + Intergenic
1005786338 6:29249268-29249290 AGTTGTTTGGTGGTGGGGATTGG + Intergenic
1006098327 6:31670081-31670103 TGGTGCTTGCTGTTGGGGAAGGG + Intronic
1006407130 6:33851902-33851924 TGGGGTTTGGGGGTGGTGGTAGG + Intergenic
1007557973 6:42782631-42782653 TGGCGGTTGGTGGTGGGGAGGGG + Intronic
1007813904 6:44506473-44506495 TGATGGTTGGAGGTGGGGAAAGG + Intergenic
1009751855 6:67885834-67885856 AGTTGTTTGGTGGTGGGGATTGG + Intergenic
1010810996 6:80298845-80298867 TGCTGTTTGTTGGTCATGAAAGG + Intronic
1013032988 6:106354466-106354488 TGTTGTGTGGTGGGGGGGAAGGG - Intergenic
1013230002 6:108153973-108153995 TGGTGTGTGTTGGTGGGGAGGGG + Intronic
1013324493 6:109031410-109031432 TGAAGTTTGGTGGTGGTGTGAGG - Intronic
1013422716 6:109980218-109980240 TGGGGTGTGGTGTTGGTGAGAGG - Exonic
1014479855 6:121922362-121922384 ATGTGTGTGGTGGGGGTGAAGGG + Intergenic
1015536543 6:134272620-134272642 AAGAGTTGGGTGGTGGTGAAAGG - Intronic
1015686295 6:135866169-135866191 AGGTGAATGGTGGTGGTGAGAGG - Intronic
1016050284 6:139523525-139523547 AAGTGTTTGGTGGTGAGGAAAGG + Intergenic
1016514029 6:144873860-144873882 TGGTGGTTGGGGGTGGGGACAGG - Intergenic
1016588497 6:145716694-145716716 GGGTGTGTGGTGGTGATGAGGGG - Intronic
1017680670 6:156861171-156861193 GTGTGTTTGGTGGTGGGGAGGGG + Intronic
1017942592 6:159066165-159066187 TGGTGGTTGGTGGTGGGGGTGGG + Intergenic
1017979311 6:159385659-159385681 TAGTATTTGGTGGTGGGGTAGGG - Intergenic
1018560070 6:165092887-165092909 TGGAGTTTTGGGGTAGTGAAAGG + Intergenic
1018681033 6:166265521-166265543 TGGTGGATGGAGGTGGGGAAAGG + Intergenic
1020027230 7:4907664-4907686 TGGTTTTGGGTGGTGGGGACTGG - Intronic
1020036789 7:4968659-4968681 TGGTGGTTGGTGGGTGTGACTGG - Intergenic
1020277721 7:6635087-6635109 TGGTGGTTGGTGGTGGTTGGTGG - Intergenic
1020750171 7:12130800-12130822 AGGTGGATGGTGGTAGTGAAAGG - Intergenic
1020889140 7:13857041-13857063 AGGGGTTTGGTGGTGGTGACTGG - Intergenic
1021464953 7:20931930-20931952 TTGTTTTTGGTGGTGATGAAAGG - Intergenic
1021928098 7:25552571-25552593 TGGTGGTTGGTGATGGCGAGGGG + Intergenic
1022220403 7:28308580-28308602 TATTGTGTGCTGGTGGTGAATGG + Intronic
1022368774 7:29751205-29751227 TTGTGGTTGGTAGTGGTGACTGG - Intergenic
1022377727 7:29830113-29830135 TAGTGTTTGATGGCTGTGAAAGG - Intronic
1022392928 7:29959227-29959249 TGGTTTTTGCTGGTGGTGCCAGG - Intronic
1023761398 7:43468078-43468100 TGGTGGGGGCTGGTGGTGAAAGG - Intronic
1024317169 7:48031873-48031895 GGGTGTGTGGTGGTGGTGGGGGG + Intergenic
1024462654 7:49674567-49674589 TTGTGGTTGGTGGTGGTGGGGGG - Intergenic
1024639224 7:51316424-51316446 TGGTGTTGGGTGCTGGTGTTGGG - Intronic
1025079472 7:55969252-55969274 TGGAGTGTGGTGGTGGGGAGGGG + Intronic
1025756625 7:64350794-64350816 TTTTGTTTGGTGGTGGTGGTGGG + Exonic
1027056461 7:75053094-75053116 TGGGGTCTGGGGGTGGTGCACGG + Intronic
1027056527 7:75053274-75053296 TGGGGTCTGGGGGTGGTGCACGG + Intronic
1028646231 7:93099811-93099833 TGGGGTGTGGGGGTGGTGAAAGG - Exonic
1029196789 7:98811007-98811029 TGGTGGGTGGTGGTGGTGGCTGG + Intergenic
1029196794 7:98811020-98811042 TGGTGGCTGGTGGTGGTGGGTGG + Intergenic
1029709818 7:102293417-102293439 TGGTTTTTGGTGCTGGGGGATGG - Intronic
1030193715 7:106833295-106833317 AGTTGTTTGGTGGTGGGGATTGG - Intergenic
1030809283 7:113955542-113955564 TGGTGGTTGGTGGGGGTGGAAGG + Intronic
1030889896 7:114986533-114986555 TGGAGTTTGCAGATGGTGAAAGG - Intronic
1030924483 7:115434869-115434891 TAGTTTTTGGTTATGGTGAAAGG - Intergenic
1030937804 7:115607300-115607322 TGGTGTGTGGTGGTGATGGTGGG - Intergenic
1031075543 7:117208864-117208886 TTGTCTTTGGTGGTGGTGGTGGG + Intronic
1031147534 7:118013781-118013803 TGGGGTTTGGGGGTGGTGCAGGG - Intergenic
1032003473 7:128281921-128281943 TAGTGTTTGGTGCTGGAGCATGG + Intergenic
1033030383 7:137820600-137820622 TGGGGTTTGGTGGTGGAAGAGGG - Intronic
1033131340 7:138748242-138748264 TGGTGTGTGGTGCATGTGAATGG - Intronic
1033493763 7:141872231-141872253 TGGTGTCTGGTGGTGGTATAAGG + Intergenic
1033823891 7:145165819-145165841 TGGTGGTTTGTGGTGGGGGAAGG + Intergenic
1034037008 7:147835492-147835514 TCATCTTTAGTGGTGGTGAATGG + Intronic
1034334370 7:150311007-150311029 TGTTGTTTGGTGGTCGGGATAGG - Intronic
1034889803 7:154829811-154829833 TGGTGTTTGGTGGTGGTGAAGGG - Intronic
1034998515 7:155593591-155593613 TGGGGCTTGGCTGTGGTGAACGG - Intergenic
1035667126 8:1387702-1387724 TGGTGACTGGTAGGGGTGAAGGG + Intergenic
1036650843 8:10642741-10642763 TGGGTTTTGGTTGTGGTTAAGGG + Intronic
1036751333 8:11445314-11445336 TGGTGGGTGGAGGTGGTGAGGGG - Intronic
1037103466 8:15076630-15076652 TTGGGATTGGTGGTGGTGATGGG - Intronic
1037124373 8:15327650-15327672 TGGAGTTTGCTGGTGGTTTAGGG - Intergenic
1039136483 8:34329317-34329339 TGTTTTTTGGTGGTGGTGGTGGG + Intergenic
1039545845 8:38410705-38410727 TAGTGTGTGCTGGTGGTGAGTGG - Intergenic
1040372098 8:46787494-46787516 TGTTTTTTGGTGGTGGTGGTGGG + Intergenic
1040438113 8:47413103-47413125 TTGTGTTGGGTTGTGGTGGATGG + Intronic
1040886646 8:52270711-52270733 GGTTGTTTGGGGGTGGTGCAGGG + Intronic
1042401602 8:68355231-68355253 GTGTGTTTGGTGGTGGGGCAGGG - Intronic
1042752751 8:72176177-72176199 TGGTGTTTGCTGCTGGTGGGAGG + Intergenic
1043467695 8:80528719-80528741 GGGTGTTTGGTGGTGGGGGTTGG - Intergenic
1045243930 8:100426461-100426483 TGGTAATTGGTGGTGGTAATTGG - Intergenic
1045457454 8:102395290-102395312 GGGTGTCTGGTGGTGGTGTTTGG - Intronic
1045610022 8:103828731-103828753 TGATTTTTGTAGGTGGTGAAAGG + Intronic
1046583079 8:116117221-116117243 TGGTGTTTGGTTGTTGTGCATGG + Intergenic
1047333918 8:123918682-123918704 TGCTGTTAGGTGGTGGTGGCAGG + Intronic
1048997600 8:139804146-139804168 TGGTGCTTGGTGGTGGTGGTGGG - Intronic
1048997610 8:139804178-139804200 TGGTGCTTGGTGGCGGTGGTGGG - Intronic
1048997627 8:139804236-139804258 TGGTGTTTGGTGGTGGTGGTGGG - Intronic
1048997648 8:139804315-139804337 TGGTGCTTGGTGGCGGTGGTGGG - Intronic
1048997674 8:139804416-139804438 TGGTGCTTGGTGGCGGTGGTGGG - Intronic
1048997705 8:139804543-139804565 TGGTGCTTGGTGGCGGTGGTGGG - Intronic
1048997715 8:139804575-139804597 TGGTGCTTGGTGGCGGTGGTGGG - Intronic
1048997720 8:139804588-139804610 TTGTGTGTGGTGGTGGTGCTTGG - Intronic
1048997727 8:139804620-139804642 TGGTGCTTGGTGGCGGTGGTGGG - Intronic
1048997737 8:139804652-139804674 TGGTGCTTGGTGGCGGTGGTGGG - Intronic
1048997742 8:139804665-139804687 TTGTGTGTGGTGGTGGTGCTTGG - Intronic
1048997748 8:139804694-139804716 TGGTGGGTGGTGGTGGTGGGTGG - Intronic
1048997769 8:139804764-139804786 TGGTGCTTGGTGGTGGTGGTGGG - Intronic
1049658700 8:143810193-143810215 TGGGGTTTGGTTGTGGGGTAGGG - Intronic
1050077514 9:1880493-1880515 TGCTGTTTGCTGTTGGTTAAAGG - Intergenic
1050140703 9:2513099-2513121 TGTTGTTTGGTGATGGGGATTGG - Intergenic
1050296754 9:4212932-4212954 TGGGGTTTGCTGGAGATGAATGG + Intronic
1051176900 9:14370061-14370083 GGGTGTTTGGAGATGGCGAATGG - Intronic
1052211452 9:25909059-25909081 TGATGGTTGGTGGTCGTGGAAGG - Intergenic
1053530942 9:38879962-38879984 TGGTGTTTGATTGTGGTTTAAGG - Intergenic
1053663563 9:40301388-40301410 TGGATTTTGGTGGAGGTGAGGGG + Intronic
1053664127 9:40305676-40305698 GGGAGGTTGGTGGTGGTGGAAGG + Intronic
1053665094 9:40311881-40311903 GGGAGGTTGGTGGTGGTGGAAGG + Intronic
1053914075 9:42931930-42931952 TGGATTTTGGTGGAGGTGAGGGG + Intergenic
1053914673 9:42936931-42936953 AGGAGGTTGGTGGTGGTGGAAGG + Intergenic
1054375686 9:64447622-64447644 TGGATTTTGGTGGAGGTGAGGGG + Intergenic
1054376255 9:64451911-64451933 GGGAGGTTGGTGGTGGTGGAAGG + Intergenic
1054519522 9:66064403-66064425 GGGAGGTTGGTGGTGGTGGAAGG - Intergenic
1054520488 9:66070609-66070631 GGGAGGTTGGTGGTGGTGGAAGG - Intergenic
1054521052 9:66074897-66074919 TGGATTTTGGTGGAGGTGAGGGG - Intergenic
1055283974 9:74708167-74708189 TTGTTGTTGGTGGTGGTGATGGG - Intergenic
1056487343 9:87072455-87072477 TGGTGTTTCCTGGTGATGGAGGG + Intergenic
1056900185 9:90591945-90591967 AGGTGTTTGGTGTTGGTGGGAGG + Intergenic
1056952644 9:91055969-91055991 TTATGTTTGGTGGTGGTGTAAGG + Intergenic
1057068366 9:92075265-92075287 AGTTGTTTGGTGGTGGGGATTGG - Intronic
1057568061 9:96182457-96182479 TTTTGTTTGGTGCTGTTGAAGGG - Intergenic
1057689957 9:97275143-97275165 TGCTTTTTGTTTGTGGTGAAAGG + Intergenic
1058294550 9:103289239-103289261 TGGACTTTAGTGGTTGTGAATGG + Intergenic
1058567641 9:106303620-106303642 GGGTGCTTGGTCATGGTGAAAGG + Intergenic
1059312896 9:113400904-113400926 TGGTGGTTGGTGGGGGGGTAGGG - Intronic
1060060685 9:120456760-120456782 TGTTGTTTGGTGGTGAGTAATGG - Intronic
1060073936 9:120574965-120574987 AGGGGTGTGGTGGTGGTTAAGGG + Intronic
1060335818 9:122720924-122720946 TTGTGTTTGCTGGGGGTGAAGGG - Intergenic
1060358496 9:122932212-122932234 TCGTTTTTGGTGGTGGTGAGGGG + Intergenic
1060409750 9:123392381-123392403 TGGTCTCCGGAGGTGGTGAAGGG + Intronic
1060963000 9:127694471-127694493 TGCTCTTGGGTGGTAGTGAAGGG - Intronic
1061385213 9:130285586-130285608 TGGACTTTGATGGGGGTGAAAGG - Intronic
1062735776 9:138136702-138136724 TGGTGGTTGTTGGTAGTGAGTGG + Intergenic
1185890289 X:3816275-3816297 TGGTGTGTGCTAGTGGTGGAGGG + Intergenic
1186459663 X:9738181-9738203 TTTTGTTTGGTGGTGGTGATTGG + Intronic
1188557342 X:31427655-31427677 TGCAGTGTGGTGGTGGTGAGGGG + Intronic
1189222632 X:39385361-39385383 TGCTGATTGGGGGTGGTGAGGGG - Intergenic
1189365243 X:40383203-40383225 TGGTGATTGGTGGGGGTGGGGGG + Intergenic
1191778981 X:64846807-64846829 TGGTCATTGGGGATGGTGAAAGG - Intergenic
1192181500 X:68918546-68918568 TTGTGTCTGGTGGTGGTAAAGGG + Intergenic
1192630539 X:72774511-72774533 TGGTGGGTGGTGGTGGTGCATGG + Intergenic
1192651171 X:72946293-72946315 TGGTGGGTGGTGGTGGTGCATGG - Intergenic
1192982913 X:76366473-76366495 GGGTGTTTGATTGTGGTGTAAGG + Intergenic
1193304695 X:79934302-79934324 TGTTGTGGGGTGGTGGGGAAGGG + Intergenic
1193568402 X:83109329-83109351 TACTGTTTGCTGTTGGTGAAGGG - Intergenic
1194196803 X:90904172-90904194 TGGTGTTTGGAGGGGGAGCAGGG + Intergenic
1194440392 X:93925720-93925742 TGGTGTTTGGTGAGGGTGGCTGG + Intergenic
1195397353 X:104425768-104425790 GGGGGTTTGGTGATGGTGACTGG - Intergenic
1195740145 X:108056768-108056790 TTTTATTTGGTGGTGGTGAGGGG + Intronic
1196166834 X:112544725-112544747 TGGTGGTAGGGGATGGTGAAAGG - Intergenic
1196488403 X:116241015-116241037 TGCAGTTGGATGGTGGTGAAGGG + Intergenic
1197603724 X:128560593-128560615 TGGTCTTTGTTGGGGGTGAAGGG - Intergenic
1198474756 X:136984346-136984368 TAGGCTTTGGTGCTGGTGAACGG + Intergenic
1198960477 X:142177057-142177079 TGATGGTTGGTGTTGGTGTACGG - Intergenic
1199374245 X:147088360-147088382 GTGTGTGTGGTGGTGGTGATGGG - Intergenic
1200007582 X:153098052-153098074 TGTTGTTTGATGGTGGGGATTGG + Intergenic
1200371310 X:155727949-155727971 TGGTCTTTGATGTTGGTGGATGG + Intergenic
1200542650 Y:4478373-4478395 TGGTGTTTGGAGGGGGAGCAGGG + Intergenic
1201274209 Y:12283481-12283503 TGGTTATTGGGGTTGGTGAAAGG + Intergenic