ID: 1034889804

View in Genome Browser
Species Human (GRCh38)
Location 7:154829812-154829834
Sequence ATGGTGTTTGGTGGTGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1041
Summary {0: 1, 1: 0, 2: 15, 3: 136, 4: 889}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889804_1034889808 -6 Left 1034889804 7:154829812-154829834 CCTTCACCACCACCAAACACCAT 0: 1
1: 0
2: 15
3: 136
4: 889
Right 1034889808 7:154829829-154829851 CACCATCTCTGCTCCTCATGTGG No data
1034889804_1034889811 3 Left 1034889804 7:154829812-154829834 CCTTCACCACCACCAAACACCAT 0: 1
1: 0
2: 15
3: 136
4: 889
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889804_1034889810 2 Left 1034889804 7:154829812-154829834 CCTTCACCACCACCAAACACCAT 0: 1
1: 0
2: 15
3: 136
4: 889
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889804 Original CRISPR ATGGTGTTTGGTGGTGGTGA AGG (reversed) Intronic
900519176 1:3097465-3097487 ATGGTGGTAGGTGCTGGTCAGGG + Intronic
901118727 1:6872248-6872270 AGGGTATGTGGTGGTGGTGGTGG - Intronic
901127070 1:6937104-6937126 ATGGTGAATGGTGATGGTGATGG - Intronic
901127100 1:6937318-6937340 GTGGTGAATGGTGATGGTGATGG - Intronic
901127107 1:6937359-6937381 GTGGTGAATGGTGATGGTGATGG - Intronic
901127127 1:6937521-6937543 GTGGTGAATGGTGATGGTGATGG - Intronic
901218475 1:7568165-7568187 ATGATGGATGGTGGTAGTGATGG - Intronic
901218481 1:7568216-7568238 ATGATGGATGGTGGTGGTGATGG - Intronic
901218490 1:7568299-7568321 ATGAGGGATGGTGGTGGTGATGG - Intronic
901218501 1:7568382-7568404 ATGATGGATGGTGGTGGTGATGG - Intronic
901218510 1:7568456-7568478 ATGATGGTTGTTGGTGGTGATGG - Intronic
901218516 1:7568507-7568529 ATGATGGTTGTTGGTGGTGATGG - Intronic
901218522 1:7568558-7568580 ATGATGGTTGTCGGTGGTGATGG - Intronic
901218530 1:7568632-7568654 TTGATGGATGGTGGTGGTGATGG - Intronic
901218539 1:7568706-7568728 ATGTTGGATGGTGGTGGTGATGG - Intronic
901218549 1:7568780-7568802 ATGATGGATGGTGGTGGTGATGG - Intronic
901218560 1:7568889-7568911 ATGATGGATGGTGGTGGTGATGG - Intronic
901218602 1:7569281-7569303 ATGATGGTTGGTGGTGGTGATGG - Intronic
901218611 1:7569356-7569378 ATGATGGTTGGTGGTGGTGATGG - Intronic
901218652 1:7569801-7569823 ATGGTGATTGGTGATGGTGGCGG - Intronic
902102974 1:14008886-14008908 ATGGAGCTGGATGGTGGTGATGG - Intergenic
902776658 1:18679266-18679288 AAGTTGTTTGGAGGTGGAGATGG - Intronic
902944897 1:19828150-19828172 ATGGAGATGGATGGTGGTGAGGG - Intergenic
903308990 1:22437790-22437812 ATGGAGATGGATGGTGGTGATGG - Intergenic
903583078 1:24387011-24387033 ATCGTGCGTGGTGATGGTGATGG - Intronic
903780081 1:25815377-25815399 ATGGTGTCGGGTGCTGGCGAGGG + Intronic
903790817 1:25891800-25891822 ATTGTGTGTGTTGGTGGTGGGGG - Intronic
904509691 1:30993635-30993657 ATGGGGGCTGGTGGTGGTGGTGG - Intronic
904573321 1:31484394-31484416 CTGTTGATGGGTGGTGGTGATGG - Intergenic
904613099 1:31735936-31735958 ATGGTGTTTGAGGGTGGGGAGGG - Intronic
904771626 1:32884438-32884460 AAGGTGGTTGGTGGTGGGGGTGG + Intergenic
904798603 1:33076609-33076631 ATGGTGGAAGGTGGTGGAGAGGG + Intronic
904831189 1:33307618-33307640 GTGGTGTGAGGTGGGGGTGAGGG - Intronic
905010450 1:34743356-34743378 ATGAGCTTTGGTGGTGGTGGTGG - Intronic
905127600 1:35726467-35726489 ATGCTGGGTGGTGGTGGTGGGGG + Intronic
905195008 1:36269189-36269211 CTGATTTTTGTTGGTGGTGATGG + Intronic
905677027 1:39833825-39833847 ATGGTGTTGGCTGGGGGTGGAGG - Intergenic
905931571 1:41791819-41791841 ATGGGGTTTGGGGGTGGGGAGGG - Intronic
906038094 1:42765885-42765907 GGCTTGTTTGGTGGTGGTGATGG - Intronic
906059256 1:42937751-42937773 AGGGTTTATGGTAGTGGTGACGG + Intronic
906568456 1:46816942-46816964 TGAGTGTGTGGTGGTGGTGAGGG + Intronic
906703423 1:47876525-47876547 CTTGTGTATGGTGGTGGGGAGGG + Intronic
907384942 1:54120135-54120157 ATTGTGTGTGGTGGTTGTGATGG - Intergenic
907384952 1:54120275-54120297 ATTGTGTGTGGTGGCTGTGATGG - Intergenic
907668165 1:56451242-56451264 GGGGTGGTTGGTGGTGGTGGTGG - Intergenic
907853737 1:58281269-58281291 CTGGAGTTTGGTGGGGGTGGGGG - Intronic
907976327 1:59434785-59434807 ATGGTATTTGGAGGTGGGGGGGG - Intronic
908537523 1:65092016-65092038 ATGATGGATGGTGGTGGTGGTGG - Intergenic
908918713 1:69164029-69164051 ATGTTGTGTGGTGAAGGTGATGG - Intergenic
909418595 1:75435847-75435869 TGTGTGTGTGGTGGTGGTGATGG - Intronic
909921082 1:81380771-81380793 AATGTATTTGGTGGTGGTGGTGG + Intronic
910186295 1:84544419-84544441 CTGGAGATGGGTGGTGGTGATGG + Intergenic
910186729 1:84549513-84549535 CTGTTATTTGGTGGTGGTGGCGG + Intergenic
910325948 1:86007247-86007269 CTGGGTTTTGGTGGTGGTGGTGG - Intronic
910362763 1:86430668-86430690 ATGGTGGTAGGTGGTGGAGTAGG + Intronic
910830603 1:91457403-91457425 ATGGTGTTCTGTGGAGATGAAGG - Intergenic
911386769 1:97185792-97185814 ATGGTGTTTGCTTCTGGTGGTGG + Intronic
911412328 1:97525240-97525262 ATGGTGAGTGATTGTGGTGATGG + Intronic
911446653 1:98002315-98002337 ATGGTGGATGGTGGTGTTGATGG - Intergenic
911471738 1:98327638-98327660 TTTGTTTTTGGTGGTGGTGGTGG - Intergenic
911630704 1:100180556-100180578 ATGGAGATAGATGGTGGTGATGG + Intergenic
911744885 1:101430486-101430508 ATGGTGTTTTATTGTGGGGAGGG - Intergenic
912364085 1:109118649-109118671 ATGGTGTAGGGTGATGGTGACGG + Intronic
912479516 1:109970197-109970219 ATGGAGATGGATGGTGGTGATGG + Intergenic
913038078 1:114993808-114993830 ATGGAGCTGGATGGTGGTGATGG - Intronic
913097185 1:115529587-115529609 AAGGGGTTTGCAGGTGGTGAAGG + Intergenic
913174132 1:116258395-116258417 ATGGTGGTTGTTGGGGGTTAGGG + Intergenic
913377032 1:118163842-118163864 AGGGTGTATGGTGGTGGTGCTGG - Intronic
914408213 1:147398527-147398549 GTGGTTTTTGGTGGTGCTGGTGG + Intergenic
914731284 1:150372890-150372912 ATGGTGGGTGGTGTTGGGGAGGG + Intronic
915058757 1:153161970-153161992 GGGGTTTTTGGTGGTGGTGGTGG + Intergenic
915123003 1:153643690-153643712 AGGGTGGTATGTGGTGGTGATGG - Intronic
915302743 1:154960950-154960972 ATGGTGGTTGGTGGTGGGTTTGG - Intronic
915484672 1:156211988-156212010 ATGGGCAGTGGTGGTGGTGAAGG - Exonic
915707633 1:157861680-157861702 ATGGTGTTTGCTGGGGCTGGAGG + Intronic
916090132 1:161301570-161301592 AGGGTGGGTGGGGGTGGTGAGGG - Intergenic
916397520 1:164407702-164407724 ATGGGGATGGATGGTGGTGATGG - Intergenic
916712660 1:167425560-167425582 AGGGTGGATGATGGTGGTGATGG - Exonic
917619509 1:176781623-176781645 ATGGGGTTTGGAAGTGCTGATGG + Intronic
917659791 1:177165798-177165820 ATGGGTTTTGGTGGTGGTGGTGG - Intergenic
917915836 1:179700583-179700605 AAGGTGCTTGTTGGTGGTGGTGG + Intergenic
918018298 1:180659550-180659572 GTGGTGGGTGGTGGTGGTGGAGG - Intronic
918678202 1:187316987-187317009 ATGGTGTTTTATGGTGGTGGGGG - Intergenic
919134801 1:193494237-193494259 AAGGTGTTTGCTAGTGGGGAAGG + Intergenic
919768870 1:201144481-201144503 AAGGTGTGTGCTGGGGGTGAAGG + Intronic
921367079 1:214383953-214383975 GTGGTGCTTGGTGGCCGTGAGGG + Exonic
921622205 1:217337754-217337776 TTGATGTTTTGTGGTGGTGTGGG - Intergenic
922063330 1:222112365-222112387 AAGGTGTGGGGTGGTGGTGGGGG - Intergenic
922273753 1:224057671-224057693 ATTGTGTATGGTGGGTGTGAGGG + Intergenic
922461211 1:225815677-225815699 GGGTTGTTTGGTCGTGGTGAAGG - Intronic
922615659 1:226959992-226960014 TTGGTGCTTGGTGGTGGTGTTGG + Intronic
922615664 1:226960011-226960033 TTGGTGCTTGGTGGTGGTGGTGG + Intronic
922615678 1:226960071-226960093 GTGGTACTTGGTGGTGGTGGTGG + Intronic
922615684 1:226960096-226960118 ATGGTACTTGGTGGTGGTGGTGG + Intronic
922615698 1:226960156-226960178 GTGGTACTTGGTGGTGGTGGTGG + Intronic
922615707 1:226960196-226960218 GTGGTACTTGGTGGTGGTGGTGG + Intronic
922615718 1:226960240-226960262 GTGGTCCTTGGTGGTGGTGGTGG + Intronic
922615732 1:226960291-226960313 GTGGTACTTGGTGGTGGTGGCGG + Intronic
922615741 1:226960332-226960354 GTGGTACTTGGTGGTGGTGGTGG + Intronic
922615747 1:226960354-226960376 GTGGTGCTTGGTGGTGGTGGTGG + Intronic
922615775 1:226960478-226960500 GTGGTACTTGGTGGTGGTGGTGG + Intronic
922615780 1:226960497-226960519 GTGGTGCTTGGTGGTGGTGGTGG + Intronic
922615793 1:226960557-226960579 ATGGTACTTGGTGGTGGTGGTGG + Intronic
922615798 1:226960576-226960598 GTGGTGCTTGGTGGTGGTGGTGG + Intronic
922615816 1:226960643-226960665 GTGGTGCTTGGTGGTGGTGGTGG + Intronic
922644085 1:227267782-227267804 ATGCTGTTTTGTGATAGTGAGGG - Intronic
922658382 1:227406298-227406320 ATGTTTTTTGTTGGTGGTGGTGG - Intergenic
923203292 1:231733368-231733390 GTAGTGAGTGGTGGTGGTGATGG + Intronic
923268930 1:232337347-232337369 TTGCTGTTGTGTGGTGGTGATGG + Intergenic
923800358 1:237203141-237203163 GGTGTGTGTGGTGGTGGTGATGG - Intronic
923856772 1:237853596-237853618 ATGCTGTGTGGTGTTGGTGGGGG - Intergenic
924184626 1:241475367-241475389 TTGTTGGTTGTTGGTGGTGATGG - Intergenic
924591788 1:245410845-245410867 TTGGTGGTAGATGGTGGTGATGG - Intronic
924592725 1:245419098-245419120 ACGGTATTTGGTGGTGCTGGTGG - Intronic
924878225 1:248128889-248128911 ATCGAGTTTGGTGTTGGTGTGGG + Intergenic
1063534473 10:6869946-6869968 ATGGAGATGGGTGGTGGTGATGG + Intergenic
1063781187 10:9327148-9327170 ATGGTGTTTGGGTGAGGAGAGGG + Intergenic
1064212279 10:13370148-13370170 CTGGAGATCGGTGGTGGTGATGG + Intergenic
1066271838 10:33831680-33831702 AGGGGGGTTGGTGGGGGTGAGGG - Intergenic
1066467644 10:35667551-35667573 ATGGTGGGGGGTGGTAGTGATGG - Intergenic
1066467657 10:35667600-35667622 ATGGTGGGGGGTGGTAGTGATGG - Intergenic
1067546763 10:47197429-47197451 ATGGAGATGGATGGTGGTGATGG - Intergenic
1067713407 10:48668286-48668308 TTGGTATTTGGTGGTGGGGATGG + Intergenic
1068632084 10:59308550-59308572 ATGGTGGTTGGTGGTGCTGGTGG - Intronic
1068632091 10:59308578-59308600 ATGCTGGTTGGTGGTGCTGGTGG - Intronic
1068691795 10:59924101-59924123 ATGGAGATAGATGGTGGTGATGG + Intergenic
1069485253 10:68818395-68818417 TTGGTGGTTGGTGGAGGTGGAGG - Intergenic
1069613608 10:69792109-69792131 ATGGTGGGTGGTGGTGGTGGTGG - Intergenic
1069758906 10:70794187-70794209 ATGGGCTTTGGTGGGGGTCATGG + Intergenic
1070377407 10:75846724-75846746 TTGGTTTTTGTTGGTGGTGGGGG - Intronic
1070627637 10:78062497-78062519 ATGGTGTGTGTTGGTGGTTTGGG + Intergenic
1070701522 10:78604889-78604911 GTGGTGCTTGGTGGTGGTGGTGG + Intergenic
1071136632 10:82461358-82461380 ATGGTGGGTGCTGGTGGTGATGG - Intronic
1071360193 10:84838928-84838950 CAGGGGTTTGGTGGTGGTGGCGG - Intergenic
1072712898 10:97729201-97729223 ATGGAGATGGATGGTGGTGATGG - Intergenic
1072735852 10:97879212-97879234 ATTGGTGTTGGTGGTGGTGATGG - Intronic
1072782952 10:98262529-98262551 TTAGAGTTTAGTGGTGGTGACGG + Intronic
1073094361 10:100970569-100970591 TTTGTGTGTGGGGGTGGTGAGGG - Intronic
1073540982 10:104316009-104316031 CGTGTGTCTGGTGGTGGTGACGG - Exonic
1073562474 10:104508742-104508764 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1073986624 10:109216885-109216907 ATGGGGTTTGGGGGTGGAGGTGG + Intergenic
1074453648 10:113579305-113579327 ATGTGGGTTGGTGGTGATGATGG + Intronic
1074717739 10:116235481-116235503 ATGGTGGTGGGTGGTGATGATGG - Intronic
1075023440 10:118967484-118967506 ATGGGGGTGGGTGGTGGGGAGGG - Intergenic
1075088100 10:119427256-119427278 ATGGTGGTTGATGCTGATGATGG - Intronic
1075101121 10:119506987-119507009 ATGGTATTTGGTGCTGGGCATGG - Intronic
1075169740 10:120102119-120102141 AGGGTGAGTGGTGGTGGAGACGG + Intergenic
1075356323 10:121780324-121780346 ATTGTGTTTGGTGGTGGGGAGGG - Intronic
1075417460 10:122275507-122275529 ATAATGGGTGGTGGTGGTGACGG - Intronic
1075534029 10:123255289-123255311 ATGGTATATGATGGTGGTGGTGG - Intergenic
1075534035 10:123255325-123255347 ATGGTATATGATGGTGGTGGTGG - Intergenic
1076004311 10:126935779-126935801 ATGGAGTTAGATGGTGGAGATGG - Intronic
1076505646 10:130971094-130971116 ATGGCGTCTGTTGGTGGTGAGGG + Intergenic
1076691352 10:132225256-132225278 CTGGTGGTCGGTGGGGGTGATGG - Exonic
1077534175 11:3111671-3111693 ATTGTGTGTGGGGGTGGGGAGGG - Intronic
1078532076 11:12144411-12144433 TTGGAGTTTGGGGCTGGTGAGGG + Intronic
1078657701 11:13257432-13257454 ATGGAGATGGATGGTGGTGATGG + Intergenic
1078661569 11:13291412-13291434 CTGATGTGTTGTGGTGGTGATGG + Intronic
1078741082 11:14066869-14066891 ACGGTTTTTGGTGGGAGTGAGGG - Intronic
1079091940 11:17486899-17486921 CTGGAGATGGGTGGTGGTGATGG + Intergenic
1079360956 11:19770013-19770035 TTGTGGTTTGGTGGGGGTGAGGG - Intronic
1079416403 11:20240722-20240744 ATGGTGAGAGCTGGTGGTGAAGG + Intergenic
1079422871 11:20310831-20310853 CTGGTGTTTGGAGGTGCTCAGGG + Intergenic
1080112467 11:28583540-28583562 AGGATGTTGGTTGGTGGTGATGG + Intergenic
1080899599 11:36476264-36476286 ATGGAGATGGGTGGTGGTGATGG - Intergenic
1080943605 11:36946939-36946961 ATGATGATGGGAGGTGGTGAGGG + Intergenic
1081746678 11:45477957-45477979 TTGCTGTTGGGTGGTGGAGAAGG + Intergenic
1081801056 11:45859616-45859638 ATGTTGCTTGGTGGCGGGGAGGG + Intronic
1081842284 11:46211414-46211436 ATTGTGTGTGGTGGGGGTGCAGG - Intergenic
1083108295 11:60379893-60379915 CTGGAGTTGGGTGGTGGTGATGG - Intronic
1083713832 11:64564599-64564621 ATCGGGATTGGTGGTGGTGGTGG - Intronic
1083780457 11:64914877-64914899 CAGGTGCTTGGGGGTGGTGAGGG + Intronic
1083814801 11:65126623-65126645 ATCTTGTTTGGTGCAGGTGATGG + Exonic
1084309761 11:68310164-68310186 ATAGTGGGTGGTGGTGGTGGGGG + Intergenic
1084685605 11:70693127-70693149 ATGGTGGTTGGGGCTGGTGGAGG - Intronic
1084728674 11:71059345-71059367 GTGATGGTTGTTGGTGGTGATGG + Intronic
1084728683 11:71059393-71059415 GTGATGGTTGATGGTGGTGATGG + Intronic
1084730300 11:71068900-71068922 GTGGTGGTTGATGGTGATGATGG - Intronic
1084738794 11:71124122-71124144 ATGGTGATTGATGGTGATAATGG + Intronic
1084953623 11:72679951-72679973 TTGGAGGGTGGTGGTGGTGAGGG - Intergenic
1085343107 11:75746582-75746604 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1085531155 11:77192819-77192841 ATGATGGTTGGTGGTGATGGTGG + Intronic
1085583463 11:77677316-77677338 CTGGAGTTAGGTAGTGGTGATGG - Intronic
1085732724 11:79013212-79013234 CTGGTGGCTGGTGTTGGTGAAGG - Intronic
1086149103 11:83588490-83588512 TTGGTCTTTGATGATGGTGATGG - Intronic
1086260361 11:84932507-84932529 CTGTTGTGTGGTGGGGGTGAGGG - Intronic
1087444349 11:98229074-98229096 ATGGTGTTTGTATTTGGTGATGG + Intergenic
1087681966 11:101228440-101228462 ATGGTGATTAGTGGTGGGGCTGG + Intergenic
1087800712 11:102500883-102500905 CTGGAGATTGATGGTGGTGATGG - Intergenic
1088307966 11:108430052-108430074 ATGGAGATGGGTGGTGGTGATGG + Intronic
1088395282 11:109361269-109361291 ATTGTGTTTTGTGGAGGTGTGGG + Intergenic
1088998521 11:115027462-115027484 ATGGAGATGGATGGTGGTGATGG + Intergenic
1089022673 11:115233128-115233150 ATAGTGTTTGGTGGTGGTGGTGG + Intronic
1090011528 11:123049738-123049760 ATGGGCTTTGGTGGGGGTCATGG + Intergenic
1091138225 11:133212146-133212168 GTTGTGATTGGTGGTGGTGTGGG - Intronic
1091216260 11:133904199-133904221 ATGGGCCTTGGTGATGGTGATGG - Intergenic
1091270492 11:134308268-134308290 GTGGTATTTGGTGGTGGTGGTGG - Intronic
1091270538 11:134308458-134308480 GTGGTATTTGGTGGTGGTGGTGG - Intronic
1091270545 11:134308483-134308505 GTGGTATTTGGTGGTGATGGTGG - Intronic
1091481298 12:834452-834474 ATGGTGGGTGGTGGTGGATAGGG + Intronic
1091771326 12:3153061-3153083 GTGGGGTGTGGTGGTGGTGGTGG + Intronic
1091827753 12:3525952-3525974 CTGGAGATGGGTGGTGGTGATGG - Intronic
1092057007 12:5515855-5515877 ATGTTGTGGGGTAGTGGTGATGG - Intronic
1092313214 12:7381686-7381708 TTTGTGTGTGGTGGTGGGGAGGG + Intronic
1092888162 12:12943551-12943573 ATGATTATTGGTGGTGGTGCTGG + Intronic
1093198363 12:16156570-16156592 ATTGTTATTGGTGGTGGTGGAGG - Intergenic
1093617064 12:21238570-21238592 ATGGTGTAAGGTGCTGGAGAAGG + Intronic
1093782577 12:23154155-23154177 ATGGAGATGGCTGGTGGTGATGG - Intergenic
1094210464 12:27884998-27885020 ATTGGGTTTTTTGGTGGTGATGG + Intergenic
1094822378 12:34236401-34236423 ATGGTGATGGATGATGGTGATGG - Intergenic
1095092306 12:38118651-38118673 ATGGTGATGGGTGAAGGTGATGG + Intergenic
1095870229 12:47018635-47018657 ATGGTGCTTGGAGGAGGTAATGG - Intergenic
1095977105 12:47947292-47947314 CAGGTGGTTGGTGGTGGGGACGG - Intergenic
1096405317 12:51339879-51339901 ATGGTGTGTGCTGGTGGAGATGG - Exonic
1096685698 12:53286924-53286946 CTGTTGCTAGGTGGTGGTGATGG + Intronic
1097243525 12:57592121-57592143 ATCGTGTTTGGTGTAGGTGGTGG + Intronic
1097285100 12:57870999-57871021 ATGGTAAATGGTGGTGGTGGGGG + Intergenic
1098064490 12:66599135-66599157 GTGGAGGTTGGGGGTGGTGATGG - Intronic
1098256350 12:68620165-68620187 ATGCTGTTTCTTGGTGGTGGTGG + Intronic
1099129508 12:78809584-78809606 ATGGTCTTTGGTAGGGGTGGGGG + Intergenic
1099371602 12:81837855-81837877 TTGGTGATGGATGGTGGTGATGG + Intergenic
1099715831 12:86292171-86292193 TGGATGTTTGGTGGTGGTGGTGG + Intronic
1100155130 12:91789892-91789914 TTGTTGTTTGGTAGTGGTGGTGG + Intergenic
1100440278 12:94610564-94610586 GGGGTGGTTGGTGGTGGTGGTGG - Intronic
1100774711 12:97961448-97961470 TTGTTGGTTGGTGGGGGTGAGGG - Intergenic
1101072002 12:101085595-101085617 ATGGTGTTGGGGGGTGGTTCTGG + Intronic
1101373499 12:104151490-104151512 TAGGTGTTTGTTGGAGGTGAAGG - Intergenic
1101450772 12:104776738-104776760 TTGGTCATTGGTGGTGGTGAGGG + Intergenic
1101545757 12:105711098-105711120 AAGGTGTTGGGTTGGGGTGATGG + Intergenic
1101735953 12:107463327-107463349 ATGGTGGTTGATGATGATGATGG + Intronic
1101916361 12:108899134-108899156 ATGGTGGTGGCTGATGGTGAGGG + Intronic
1101926695 12:108977530-108977552 ATGCTGCTTGGTGCTGGGGAAGG + Intronic
1101971783 12:109319556-109319578 ACAATGTTAGGTGGTGGTGATGG + Intergenic
1102461228 12:113100774-113100796 ATGGTAGATGGTGATGGTGATGG - Intronic
1102913294 12:116735363-116735385 ATGGGGATGGATGGTGGTGATGG + Intronic
1103059742 12:117848776-117848798 ATGGTGGTGGGTGGTGATGGTGG + Intronic
1103059749 12:117848810-117848832 ATGGTGGTGGGTGGTGATGGTGG + Intronic
1103063252 12:117875859-117875881 TGGGTGTGTGGTGGTGGTGGGGG - Intronic
1103553179 12:121750817-121750839 GTGGTGTGTGGTGTTGGTGTGGG - Intronic
1103847043 12:123908847-123908869 ATGGTTGGTGGTGATGGTGATGG + Intronic
1103871103 12:124092626-124092648 ATGGTGATGGATGATGGTGATGG + Intronic
1104273497 12:127304287-127304309 AAGGTGGTAGGTGGTGGTGGGGG - Intergenic
1104624618 12:130340653-130340675 AGGGGGGTTGGTGGTGGTGGTGG + Intronic
1104932971 12:132349849-132349871 ATGGTGACTGATGATGGTGATGG - Intergenic
1105287817 13:19021254-19021276 ATGGAGATAGATGGTGGTGACGG + Intergenic
1105583856 13:21725902-21725924 ATGGTTGGTGGTGGTGGTGGTGG - Intergenic
1105583857 13:21725905-21725927 GTGATGGTTGGTGGTGGTGGTGG - Intergenic
1105583858 13:21725908-21725930 ATGGTGATGGTTGGTGGTGGTGG - Intergenic
1105782211 13:23715311-23715333 ACTGTGGTAGGTGGTGGTGATGG + Intergenic
1105800376 13:23897827-23897849 CTGGAGATGGGTGGTGGTGATGG + Intronic
1105806501 13:23954569-23954591 GCTGTGGTTGGTGGTGGTGATGG + Intergenic
1105848636 13:24315130-24315152 CTGGAGATGGGTGGTGGTGATGG - Intronic
1105988462 13:25593105-25593127 ATCGTATTTGGTGGTGGGGAGGG + Intronic
1106408082 13:29491188-29491210 GTGGTGTATGGTGGGGGTGTGGG + Intronic
1106542956 13:30706264-30706286 GTGCTGGTTGGTGGTGCTGATGG - Intergenic
1106658135 13:31769186-31769208 AATTTGTTAGGTGGTGGTGAGGG + Intronic
1106659088 13:31779582-31779604 ATGGTGGGTAATGGTGGTGAAGG - Intronic
1106858841 13:33882732-33882754 ATGGAGTTTCTTTGTGGTGATGG - Intronic
1107571246 13:41660623-41660645 ACGTTGTTTAGGGGTGGTGATGG + Intronic
1107808371 13:44175621-44175643 ATGGTGGGGGGTGGTGGTGTGGG + Intergenic
1108031015 13:46229862-46229884 CTGGTATTTGCTGCTGGTGAGGG + Intronic
1108780135 13:53820320-53820342 ATGTTTTGTGGTGGTGGTGGTGG - Intergenic
1108798537 13:54064579-54064601 CTGGTCTTTGATGGTGGTGGTGG - Intergenic
1108982707 13:56539001-56539023 ATGGTGTGTGGTGGTGAGGGTGG - Intergenic
1110170371 13:72492898-72492920 TTGTTTTTTGGTGGTGGGGAGGG - Intergenic
1110950507 13:81483398-81483420 GTGGTGATGGGTGATGGTGATGG + Intergenic
1111380367 13:87441988-87442010 ATGGTGGTTGGTGGTTGCCAAGG + Intergenic
1112035570 13:95493390-95493412 CTGGAGATGGGTGGTGGTGATGG - Intronic
1112095156 13:96124596-96124618 ATGGTGTTTGGGGTTAGTGTTGG + Intronic
1112630060 13:101150543-101150565 AGGGTGTGTGTTGGTGGTGGGGG + Intronic
1112649657 13:101380896-101380918 TTGGTTGTTGGTGGTGGTGATGG - Intronic
1113068594 13:106395814-106395836 ATGGCCTTTGATGGTAGTGAGGG + Intergenic
1113356198 13:109582706-109582728 AAGGTGTTTGGGGGTTGGGAGGG + Intergenic
1113717827 13:112526212-112526234 ATGGGGATGGGTGGTGATGATGG - Intronic
1114197803 14:20494550-20494572 AGGGTTTCTTGTGGTGGTGAAGG - Intergenic
1114647224 14:24262566-24262588 ATGTTGTTTGGTGGGGGTGAGGG - Intronic
1114933644 14:27506731-27506753 ATGGTGATTGGTGGTGGCAGGGG + Intergenic
1115074492 14:29370535-29370557 ATGGGTTTTGGTGGTGGTTTTGG - Intergenic
1115086422 14:29520954-29520976 TGTGTGTTTGGTGGTGGTGCTGG - Intergenic
1115119321 14:29921798-29921820 ACTGTGTATGGTGGTGGTGGTGG - Intronic
1115362388 14:32518191-32518213 TTGGTCTTTGATGATGGTGATGG - Intronic
1115402296 14:32975836-32975858 TTTGTGATTGTTGGTGGTGAGGG + Intronic
1116121114 14:40723176-40723198 ATTTTGTTGGGTGATGGTGATGG + Intergenic
1116296969 14:43123639-43123661 ATGGTGGTTGCTGGGGGTAAGGG + Intergenic
1116351197 14:43865614-43865636 TTTGTGTTTGGTAGTGGAGACGG - Intergenic
1116543845 14:46136923-46136945 ATGGTTTTTTGGGGTGGGGATGG - Intergenic
1116900721 14:50360287-50360309 CTGGTGATAGGTGGTGGTGATGG - Intronic
1117164860 14:53023031-53023053 CTGGTGCTTGGTGGGGGTGGGGG + Intergenic
1117554583 14:56871105-56871127 ATGGAGATGGATGGTGGTGATGG + Intergenic
1117873728 14:60227773-60227795 AATATGTTTGGTGGTGGTGTGGG - Intergenic
1118764260 14:68899553-68899575 ATGGTGTGTGGGGGATGTGATGG - Intronic
1119709453 14:76811398-76811420 ATGTCTTTTGGTGGTGGTGGTGG + Intronic
1120237594 14:81910480-81910502 ATGGTTTTTGCTGCTGGTGATGG - Intergenic
1120742836 14:88127371-88127393 TTGGTCTTTGATGATGGTGATGG + Intergenic
1120813510 14:88829035-88829057 ATGGTGTTTGGTAATGGGGAAGG + Intronic
1121176399 14:91893842-91893864 GTGGTGGTTGGTGGCGGGGAAGG + Intronic
1121586536 14:95066823-95066845 ATGGTGGTTGGTTGTGATGATGG - Intergenic
1121820967 14:96965721-96965743 ATGGTATATGGAGGTGGTGGGGG + Intergenic
1121883382 14:97520280-97520302 ATTGTAGTTGGTGGTGGTGGAGG - Intergenic
1121953530 14:98193599-98193621 ATGGTGTTTTGGGGAGTTGAGGG - Intergenic
1122180668 14:99952104-99952126 ATGTTTCATGGTGGTGGTGATGG + Intergenic
1122916185 14:104860059-104860081 GTGGTGATGGATGGTGGTGATGG - Intergenic
1122916699 14:104862539-104862561 GTGGTGATGGGTGGTGATGATGG - Intergenic
1124166502 15:27330843-27330865 CTGGTGTGTCGTGGTAGTGATGG + Intronic
1124466989 15:29949019-29949041 ATGGTGGTGGGTGTTTGTGAGGG - Intronic
1125598740 15:40903922-40903944 AGGATGGTCGGTGGTGGTGATGG + Exonic
1125645268 15:41267173-41267195 CTGGGGGATGGTGGTGGTGATGG + Intronic
1125770071 15:42159364-42159386 AGTGTCTTTGATGGTGGTGAGGG - Exonic
1126535993 15:49765055-49765077 ATGGTGATTAGAAGTGGTGAGGG + Intergenic
1126699320 15:51353800-51353822 TTTGTGTGTGGTGGTGGTGGTGG - Intronic
1126725759 15:51629973-51629995 TTGTTGTGTGGTGGTGGTGGTGG + Intergenic
1127053915 15:55112974-55112996 CTGGAGTTTGTTGGTGGTGAGGG - Intergenic
1127652165 15:61019969-61019991 ATGCTGAAGGGTGGTGGTGAAGG - Intronic
1127855909 15:62953479-62953501 ATGGAGTTTGATGTTGTTGAAGG + Intergenic
1128118144 15:65125369-65125391 AAGGTGTGTGGTAGTGGTGATGG - Intronic
1128272150 15:66319791-66319813 ATGGTCTTTGGTGGAGAAGAAGG - Intronic
1128296553 15:66525673-66525695 ATGGAGTTTGGTGGGGGCCAGGG - Intronic
1128636662 15:69306765-69306787 ATGGAGATGGATGGTGGTGATGG - Intronic
1128752971 15:70162186-70162208 TGTGTGTGTGGTGGTGGTGATGG + Intergenic
1129091410 15:73155203-73155225 CTGATGTTTGGTGGTGGTGGTGG + Intronic
1129121485 15:73399611-73399633 ATGGTGGTGGTGGGTGGTGATGG - Intergenic
1129162708 15:73755594-73755616 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1129280600 15:74481705-74481727 ACGGTGTTTGGAGCTGGAGATGG - Intergenic
1129769234 15:78193082-78193104 AGGGTGATGGGGGGTGGTGAGGG - Intronic
1129913954 15:79251602-79251624 AGGGTGTTTGGGGGTGGAGGGGG - Intergenic
1131257875 15:90873475-90873497 ACGGTGGTTGGTGGTGGTGGGGG + Intronic
1132006382 15:98231677-98231699 ATTGCTTTTGGTGGTGGTGGTGG - Intergenic
1133183731 16:4079643-4079665 ATGGTGTTTAATGGTGTTAATGG + Intronic
1133183733 16:4079662-4079684 ATGGTGTTTAATGGTGTTAATGG + Intronic
1133183735 16:4079681-4079703 ATGGTGTTTAATGGTGTTAATGG + Intronic
1133184540 16:4086104-4086126 ATGCTGCTTGGGGGTGGGGAAGG + Intronic
1133571537 16:7045212-7045234 GTGGAGTATGGTGGTGGTGGTGG + Intronic
1133579156 16:7126297-7126319 ATGGGCTTTGGTGGGGGTCATGG + Intronic
1133732951 16:8591530-8591552 GTGGTGGTTGGTGGTGATGGTGG - Intergenic
1133732952 16:8591533-8591555 ATGGTGGTGGTTGGTGGTGATGG - Intergenic
1133858150 16:9568972-9568994 TTTGTTTTTGGTTGTGGTGATGG + Intergenic
1134614066 16:15636125-15636147 ATGCGTTTTGGTGGTGGTGGTGG - Exonic
1134837432 16:17373602-17373624 ATGCTGTATGTTGGTGTTGATGG - Intronic
1135386069 16:22041472-22041494 TTGGGGGTTGGTGGTGATGAGGG - Intronic
1135531976 16:23262645-23262667 ATGGATTGTGGTGGTGGTGTGGG + Intergenic
1135666616 16:24340885-24340907 ATGGCGTTTGGTCTGGGTGACGG - Intronic
1136173526 16:28502591-28502613 ATGGGGATTGCTGGTGGGGAAGG - Intronic
1136236911 16:28919937-28919959 ATGGAGTCTGGTGGGGGAGAGGG + Exonic
1136354590 16:29735916-29735938 GGGGTGTTTGGAGGTGCTGATGG + Intergenic
1136392844 16:29976219-29976241 TGGGTGTGTGGTGCTGGTGAGGG + Intronic
1136525370 16:30826208-30826230 AAGGGGTTGGGTGGTGGTGGGGG - Intergenic
1137233989 16:46597651-46597673 ATGGTGTTTGCTGAAGGTTAAGG + Intronic
1137796506 16:51224650-51224672 ATGGGGTGGGGTGGGGGTGAGGG - Intergenic
1138026729 16:53528027-53528049 GGTTTGTTTGGTGGTGGTGATGG - Intergenic
1138119844 16:54391159-54391181 GGGCTGTTTGGTGCTGGTGATGG + Intergenic
1138916242 16:61468136-61468158 ATGGTGTGTGGTTGTGGTTAGGG - Intergenic
1139338673 16:66252057-66252079 TTGTTTTTTGGTGGTGGTGGTGG + Intergenic
1139562894 16:67755098-67755120 ATGGTGCTTGGTGGTTGGGTCGG - Intronic
1139871998 16:70115043-70115065 ATGGGGTCTGGTGGTGGAGGAGG + Intronic
1140259959 16:73369597-73369619 ATGCTGTTTTGTGGTGGAGCCGG - Intergenic
1140805922 16:78532264-78532286 AAGGAGTTGGGTGGTGGTGGGGG + Intronic
1140810951 16:78577289-78577311 GTTGTATTTGGTGGTGGTGCAGG + Intronic
1140937971 16:79692558-79692580 TTTGTGTTTGGTTGTGGTGCCGG + Intergenic
1141601248 16:85127687-85127709 ATTGTCTGTGGTGGTGGAGAAGG - Intergenic
1141726494 16:85792634-85792656 ATGGGGCTTGCTGGTGGTGTAGG + Intronic
1141879861 16:86850567-86850589 ATGCTGTCTGTTGGTGATGATGG - Intergenic
1141924129 16:87156069-87156091 ATGGAGATGGGTGGTGTTGATGG + Intronic
1141950362 16:87335624-87335646 CTGGTGGGTGGTGGGGGTGAGGG - Intronic
1142503036 17:344378-344400 ATGATGTCTGATGGTGGTGATGG - Intronic
1142503042 17:344427-344449 ATGATGTCTGATGGTGGTGATGG - Intronic
1142703889 17:1682089-1682111 ATGGTGGGTGGTGGTGGTGGTGG - Intronic
1143097075 17:4483835-4483857 AGGGGGTTTGGTGGTGGGCAGGG - Intronic
1143428573 17:6861859-6861881 TTTTTGTTTGGTGGTGGTGGTGG + Intergenic
1143601789 17:7951635-7951657 ATGGTGCAGGGTAGTGGTGATGG + Intergenic
1144461336 17:15460882-15460904 AGGGTGGTTGGCGGTGGGGAAGG - Intronic
1144576058 17:16430232-16430254 CTGGAGTTGGATGGTGGTGATGG - Intronic
1144601054 17:16613927-16613949 ATGTTGTTTGATTGTGGTGGTGG + Intergenic
1144698555 17:17322010-17322032 AAGTTGTTTGGAGGTGGGGAGGG + Intronic
1145723230 17:27091222-27091244 CATGTGTTTGGTGGTGGTGATGG + Intergenic
1146163428 17:30571729-30571751 CTGGTGGATGGTGGTGGTCATGG + Intergenic
1146638758 17:34524919-34524941 AAGGTGTTTGGAGCTGGGGATGG + Intergenic
1146954729 17:36930905-36930927 AATGTGTTTAGTGGTGGGGAGGG + Intergenic
1147185538 17:38711345-38711367 ACTGTGTTTGGTGGAGGGGAGGG + Intronic
1147303352 17:39547007-39547029 ATGGTATTTGGTACTGGAGAGGG + Intronic
1148460110 17:47834890-47834912 AGGCTGTTTGGTGGTGGTGGTGG + Intronic
1148749270 17:49935356-49935378 AAGGTGTTGGGGGGTGGTGATGG + Intergenic
1149035960 17:52134885-52134907 ACTGTGTATGGTGGGGGTGAGGG - Intronic
1149345833 17:55734431-55734453 GTGGGGGTTGATGGTGGTGAAGG - Intergenic
1149459816 17:56819362-56819384 ATGGAGAGTGGTGGTGGTGGGGG - Intronic
1149737738 17:59012242-59012264 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
1149795977 17:59520403-59520425 CTGGAGATGGGTGGTGGTGACGG - Intergenic
1150336373 17:64333449-64333471 GTGGTGTTTTGTGGTGGGGAGGG + Intronic
1150486029 17:65544383-65544405 AGTGTGTGTGGTGGTGGTGGTGG - Intronic
1150778803 17:68102170-68102192 GTGGTGTTTTGTGGAGGGGAGGG + Intergenic
1150980576 17:70137203-70137225 ATGAAGTTTGGTCTTGGTGAGGG - Intergenic
1151089328 17:71417857-71417879 ATGGTAAGTGCTGGTGGTGAGGG + Intergenic
1152390938 17:80003293-80003315 ATGGTGTTTGGGTGTTGGGATGG - Intronic
1152441638 17:80313432-80313454 ATGGTGATGGTTGGTGGTGGTGG + Intronic
1152441639 17:80313435-80313457 GTGATGGTTGGTGGTGGTGGTGG + Intronic
1152441650 17:80313481-80313503 ATGGTGATGGTTGGTGGTGGTGG + Intronic
1152441651 17:80313484-80313506 GTGATGGTTGGTGGTGGTGGTGG + Intronic
1152442170 17:80315612-80315634 ATGGTGGTCCGTGGAGGTGATGG + Intronic
1152634416 17:81424720-81424742 GTGTTGTGTGGTGGTGGTGATGG + Intronic
1152634652 17:81425798-81425820 ATGGTGGGTCGTGGTGGTGGTGG + Intronic
1153025390 18:667609-667631 ATGGAGATGGGTGATGGTGATGG + Intronic
1153433208 18:5041092-5041114 CTGGTGTTACGTGGTGGTGGAGG - Intergenic
1154063701 18:11087011-11087033 ATGGTGTTAGGTGGAGCTGTTGG + Intronic
1154089029 18:11339582-11339604 ATGGAGTTGGATGATGGTGATGG + Intergenic
1154427217 18:14281220-14281242 GTGGTTTATGGTGGGGGTGAGGG + Intergenic
1154971342 18:21412843-21412865 ATGTAGTTTGGTGGTGGGGGGGG - Intronic
1155075158 18:22348437-22348459 ACGGCGCTTGGTGGGGGTGAGGG - Intergenic
1155149727 18:23113446-23113468 ATGGAGATGGGTGGTAGTGATGG - Intergenic
1155485924 18:26342853-26342875 AAGGTGTTTGTTGCTGGTGTTGG + Intronic
1155520746 18:26666434-26666456 TTGGGGTTAGGTGGTGGAGAAGG + Intergenic
1156291485 18:35751916-35751938 AAGGAGGGTGGTGGTGGTGAAGG + Intergenic
1156376254 18:36517946-36517968 ATGGTGTTTGTTGGCATTGATGG + Intronic
1156704732 18:39866350-39866372 TTTGTTATTGGTGGTGGTGATGG + Intergenic
1156914138 18:42445691-42445713 ATGTAGTGTGGTGGTGGTGATGG - Intergenic
1157690326 18:49676661-49676683 CTGGAGATTGGTGTTGGTGATGG + Intergenic
1157769393 18:50332375-50332397 AGGCTTTTTGGTGGTGGTGTTGG - Intergenic
1158060458 18:53334505-53334527 CTGGAGATGGGTGGTGGTGATGG - Intronic
1158307511 18:56122788-56122810 AAGGTTTTTTGTGGTGGTGGTGG + Intergenic
1159590765 18:70332728-70332750 GTGGTGGTTGGGGGTGGGGAGGG - Intergenic
1160029447 18:75246009-75246031 GTGGTGTTTGCTGGGGGAGAGGG - Intronic
1160257252 18:77258482-77258504 ATGGTGGTGGGTGGTAGTGGTGG + Intronic
1160257358 18:77258978-77259000 ATGGTGGTGGATGGTGGTGGTGG + Intronic
1160257409 18:77259226-77259248 ATGGTGGTGGATGGTGGTGGTGG + Intronic
1160257434 18:77259344-77259366 ATGGTGGTGGATGGTGGTGGTGG + Intronic
1160332701 18:78010075-78010097 GTGGTGGGTGATGGTGGTGATGG + Intergenic
1160409906 18:78668201-78668223 ATGAGATTTGGTGTTGGTGAGGG - Intergenic
1160409920 18:78668273-78668295 ATGAGATTTGGTGTTGGTGAGGG - Intergenic
1160409934 18:78668345-78668367 ATGAGATTTGGTGTTGGTGAGGG - Intergenic
1160739030 19:677465-677487 CTGGTGTTTGGTGGTGTTTGAGG + Intronic
1161612221 19:5249675-5249697 ATGGAGTTTGGTATAGGTGATGG - Intronic
1161910027 19:7186573-7186595 CTGGAGATGGGTGGTGGTGATGG - Intronic
1162835464 19:13314306-13314328 ATTGTGTTTGGTGGTTGTGATGG + Intronic
1162968171 19:14165529-14165551 TGGGAGTTTGGTGCTGGTGAAGG - Intronic
1163028925 19:14530861-14530883 CTGGAGATGGGTGGTGGTGATGG - Intronic
1163030062 19:14538247-14538269 CAAGTGTGTGGTGGTGGTGAAGG + Intronic
1163283912 19:16334348-16334370 CTGGAGATGGGTGGTGGTGAAGG - Intergenic
1163322635 19:16583496-16583518 AGGGTGTTGGGTGGGGGTGGGGG + Intronic
1164664173 19:30013088-30013110 ACAGTTTTTGGTGGTGGTGCAGG + Intronic
1164813936 19:31179721-31179743 ATGATGGTAGGTGGTGGTGGTGG + Intergenic
1164813937 19:31179724-31179746 ATGGTAGGTGGTGGTGGTGGTGG + Intergenic
1165071811 19:33260290-33260312 ATTGCAATTGGTGGTGGTGATGG + Intergenic
1165250925 19:34533431-34533453 ATGGGCTTTGGTGGGGGTCATGG + Intergenic
1165467347 19:35982831-35982853 ATGGGGGTTGGGGGTGGTGTGGG - Intergenic
1165824635 19:38698734-38698756 ATGGTGAGAGGTGGTGGTGGGGG + Intronic
1167299219 19:48669618-48669640 GTGATGACTGGTGGTGGTGATGG - Intronic
1168274090 19:55266657-55266679 ATAGTGGTTGGTGGTGATGATGG - Intronic
925042941 2:747784-747806 GTTGTCATTGGTGGTGGTGATGG - Intergenic
925042948 2:747825-747847 GTCGTTGTTGGTGGTGGTGATGG - Intergenic
925042955 2:747866-747888 GTTGTCATTGGTGGTGGTGATGG - Intergenic
925042962 2:747907-747929 ATTGTCATTGGTGGTGGTGATGG - Intergenic
925042970 2:747951-747973 ATCGTCATTGGTGGTGGTGATGG - Intergenic
925042978 2:747992-748014 ATTGTCATTGGTGGTGGTGATGG - Intergenic
925043006 2:748162-748184 ATTGTTGTTGGTGGTGGTAATGG - Intergenic
925543711 2:4994828-4994850 TTTGTGTGTGGTGGTGGTGGTGG - Intergenic
925645336 2:6029879-6029901 AAGGTGTTTGGTCATGGGGATGG + Intergenic
926509543 2:13757640-13757662 ATGTTGTCAGGTTGTGGTGAGGG + Intergenic
926574689 2:14567007-14567029 ATTGTCTTTGGTGGTGATGGAGG - Intergenic
926615480 2:14992793-14992815 ATGGTGGTTGTAGGTGGTGGTGG - Intergenic
926910053 2:17844214-17844236 GTGGTGTTTGATGCTGGTGCAGG - Intergenic
927373013 2:22379566-22379588 TTTGTGTTTGGCGGGGGTGAAGG - Intergenic
927493794 2:23538607-23538629 ATGATCTTTGGTTGTGGGGAGGG + Intronic
927594957 2:24388162-24388184 CTGGTGATGGATGGTGGTGATGG - Intergenic
927777349 2:25912452-25912474 ATGGAGGATGGTGGTGTTGAGGG + Intergenic
928273272 2:29876414-29876436 ATGTGGTGTGGTGATGGTGATGG + Intronic
928914185 2:36454356-36454378 TTTGTGTGTGGTGGTGGTGAGGG - Intronic
928928165 2:36598833-36598855 ATGGAGATGGATGGTGGTGATGG + Intronic
929003505 2:37371509-37371531 ATTGTTTTTGGTGGTAGTTAGGG + Intronic
929377522 2:41307562-41307584 ATGGTGGTTGGTGATGGGGCGGG - Intergenic
930493320 2:52105587-52105609 AAGGTGTGTGGTGGAGGTAACGG - Intergenic
930493382 2:52106448-52106470 AAGGTGTGTGGTGGAGGTAACGG + Intergenic
931580514 2:63766822-63766844 ATGGAGTTATATGGTGGTGATGG - Intronic
931763272 2:65434505-65434527 GTGATGTGTGGTGGTGGGGAGGG + Intergenic
932091402 2:68809248-68809270 ATGGTGTGTTTTGGTGTTGAGGG + Intronic
932092279 2:68816966-68816988 ATAGTGCTTGTTGCTGGTGAAGG - Intronic
932263573 2:70346807-70346829 CTTGTGTGGGGTGGTGGTGAGGG + Intergenic
932354557 2:71058373-71058395 ATGGGGTTTGAAGGTGGAGAGGG + Intergenic
933384488 2:81592727-81592749 ATGGTGTTTGGCCATGTTGAGGG - Intergenic
933658713 2:84909298-84909320 ATGGTGATGGGTGCTGGTGGCGG - Intergenic
933658779 2:84909633-84909655 ATGGTCATTGGTGATGGTGATGG - Intergenic
933658871 2:84910107-84910129 ATTGTTGTTGGTAGTGGTGATGG - Intergenic
933822908 2:86130589-86130611 AGTGAGTTTGGTGGTGGTAAAGG + Intronic
934493995 2:94781948-94781970 ATTGTGTTTGGTTGGGGTTATGG - Intergenic
934545198 2:95208198-95208220 TTTGTTTTTGGTGGTGGTGGTGG + Intronic
934724085 2:96603899-96603921 ATGGATTTTGGTAGTGGTGAGGG + Intronic
934770021 2:96901710-96901732 ATGGAGATGGATGGTGGTGATGG + Intronic
934898300 2:98138077-98138099 ATGGTGTTAGAAGGTGGGGAGGG - Intronic
935076002 2:99744563-99744585 ATGGAAATTGGTGGTTGTGAGGG - Intronic
935488039 2:103682296-103682318 ATGCTTTTTGGTGGAGGTGCTGG - Intergenic
935547546 2:104417029-104417051 ATGGTGTTGGTTGGTGGAGGTGG - Intergenic
935688647 2:105710529-105710551 CTGGAGATTGATGGTGGTGATGG - Intergenic
935732647 2:106076934-106076956 TTTTTCTTTGGTGGTGGTGAAGG - Intronic
936267335 2:111020632-111020654 ATGGTGTTTGGTGCAGGGGAGGG - Intronic
937211933 2:120279638-120279660 TTGGTATTTGGTGGGGGTCATGG + Intronic
937431456 2:121842277-121842299 ATGGGGTGCTGTGGTGGTGATGG - Intergenic
937668887 2:124517691-124517713 ATGGAGGGTTGTGGTGGTGATGG + Intronic
937877146 2:126834367-126834389 GCTGTGTGTGGTGGTGGTGATGG - Intergenic
937929125 2:127191366-127191388 ATGGTATTTGGAGCTCGTGATGG - Intronic
938013333 2:127846735-127846757 ATGGGCTTTGGTGGAGGTCATGG + Exonic
938271622 2:129977269-129977291 GTGGTGGTTGGTGGTAGTGGTGG + Intergenic
938313780 2:130312819-130312841 ATGGTTGTTGTTGGTGGTGGTGG + Intergenic
938736393 2:134190495-134190517 GTGGGGTTGGGTGGTGGGGAAGG - Intronic
938996088 2:136679885-136679907 CCGGGGTTTGGTGGTGGTGGTGG - Intergenic
939278105 2:140027855-140027877 TTAGTGGGTGGTGGTGGTGATGG - Intergenic
939624310 2:144458167-144458189 AAGTTGTGTGGTGGTGGTGGTGG - Intronic
939995736 2:148917558-148917580 ATCGTGGTTGGTGATGGTGTTGG + Intronic
940023435 2:149180442-149180464 GTGGTTTTTGTTGGTGGTGGTGG + Intronic
940097469 2:149993850-149993872 TTGGTGTTTGTTGATGGGGAGGG - Intergenic
940261049 2:151780163-151780185 GTGGTGTAGGCTGGTGGTGATGG - Intergenic
940498077 2:154459095-154459117 AGGGTGCTTGGTAGGGGTGAGGG - Intergenic
940684766 2:156833179-156833201 ATGGTGTGTGGTGCAGGTGGAGG + Intergenic
940740691 2:157504168-157504190 ATGGTGGATGGTGGTGTTGGTGG - Intergenic
940840891 2:158580577-158580599 GTTGTTATTGGTGGTGGTGATGG + Intronic
940945423 2:159611895-159611917 ATGGTGTTTTTTGGTGGTAGAGG - Intronic
941173095 2:162163659-162163681 ATGTTGGATGGTGATGGTGATGG + Intergenic
941269758 2:163410308-163410330 ATCCTATTTGGTGGTGGTGGTGG + Intergenic
941634709 2:167924122-167924144 ATCGTGTGTTGTGTTGGTGAAGG + Intergenic
941732939 2:168938495-168938517 ATGGTGGTTGCTGGGGCTGAGGG + Intronic
942353146 2:175076345-175076367 CTGGTGGTTGGTGGTGGTGGTGG - Intronic
942364168 2:175205377-175205399 ATGGAGATGGATGGTGGTGATGG - Intergenic
942894112 2:181030159-181030181 GTTGTCTTTGGTGGTGGTGGTGG + Intronic
943681894 2:190777389-190777411 TTGGTCTTTGATGGTGGTAATGG + Intergenic
944194129 2:197034702-197034724 ATGGTGGTTGGTGGAGGCTATGG - Intronic
944991975 2:205248373-205248395 TTGGGATTTGGTGGTGGTGGTGG + Intronic
945878386 2:215302155-215302177 ATGGTTTTTGTTGGTGGTGGTGG - Intergenic
945888422 2:215401929-215401951 ATGGTGTTTGGTGGGGGGTGGGG + Intronic
947157252 2:227174998-227175020 ATGGGGTGTGGTGATGGAGAAGG + Intronic
947395380 2:229681557-229681579 TTGGTGTTTTTTGGTGGTGTGGG - Intronic
948008163 2:234627931-234627953 TTGGTGTTTTGTTGTTGTGAGGG + Intergenic
948015180 2:234683122-234683144 AAGGTGAATGGTGGTGGTAATGG + Intergenic
948183106 2:235998647-235998669 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948183178 2:235999093-235999115 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948183221 2:235999393-235999415 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948183252 2:235999592-235999614 ATGGTGAGAGGTGGTGGTGGTGG + Intronic
948273102 2:236688790-236688812 ATGGTGGTTGGGGGTGGGGAGGG + Intergenic
948500808 2:238392409-238392431 ATGGTGGTAGCTGGGGGTGAAGG - Intronic
948605888 2:239134480-239134502 GTGGTGTGGGGTGGTGGTGATGG - Intronic
949062378 2:241968880-241968902 ATGGAGTGTGGGGATGGTGATGG + Intergenic
949062383 2:241968899-241968921 ATGGAGTGTGGGGATGGTGATGG + Intergenic
949062410 2:241969015-241969037 ATGGAGTGTGGGGATGGTGATGG + Intergenic
949062415 2:241969034-241969056 ATGGAGTGTGGGGATGGTGATGG + Intergenic
949062612 2:241969899-241969921 ATGGGGTTTGGGGTTGATGACGG + Intergenic
1169146531 20:3256115-3256137 TTGGAGTCTGGTGGTGGTGTGGG + Exonic
1169186140 20:3618821-3618843 ATGAACTTTGGTGGTGGTGGTGG + Intronic
1169412937 20:5389132-5389154 AGGGTGTGTGCTGGTGGGGAGGG + Intergenic
1169587072 20:7096950-7096972 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1169629851 20:7618583-7618605 ATAGATTTTGGTGGGGGTGAGGG - Intergenic
1169888440 20:10428258-10428280 CTGGTGATTGGTGGAGGAGAGGG + Intronic
1170136435 20:13079490-13079512 AGTGTTTTTGGTGGTGGTGGTGG - Intronic
1170439698 20:16366435-16366457 CTGGAATATGGTGGTGGTGAGGG + Intronic
1170533214 20:17315217-17315239 GTGTGGTGTGGTGGTGGTGATGG + Intronic
1170741647 20:19063806-19063828 AAGGAGTTTGGTGGTTGTGGGGG + Intergenic
1171089684 20:22271881-22271903 ATGGTTAGTGGTGGTGGGGATGG + Intergenic
1172044096 20:32067312-32067334 ATGGAGATGGATGGTGGTGAGGG - Intronic
1172173161 20:32955676-32955698 TTGCTGTTTGGAGGTGGGGAAGG - Intronic
1172679254 20:36699661-36699683 ATGGTAACTGGTGGTGGTGGTGG + Intronic
1172957750 20:38773286-38773308 ATTGAGTTTTGTGGTGGTGATGG + Intergenic
1173927453 20:46791400-46791422 CTGGAGATGGGTGGTGGTGATGG + Intergenic
1174231923 20:49052606-49052628 AAGGGATTTGGTGGTGGTGGTGG + Intronic
1174526389 20:51175310-51175332 GTGGTGTTTGTGGGTGATGAGGG + Intergenic
1174722242 20:52825232-52825254 ATGGACTTTTTTGGTGGTGATGG - Intergenic
1174984520 20:55435600-55435622 ATGATGGTTGATGATGGTGATGG - Intergenic
1175127371 20:56762589-56762611 CTGGTGTGTGATGATGGTGATGG + Intergenic
1175305820 20:57974848-57974870 GTGGTGATGGTTGGTGGTGATGG - Intergenic
1175337691 20:58206859-58206881 TTGGCTTTTGGTGGTGGTGGTGG - Intergenic
1175429228 20:58890753-58890775 GTGGTGTCTGGTGGCGGTGGCGG - Intronic
1176422789 21:6529743-6529765 CTGGAGGTTGGTGGTAGTGATGG - Intergenic
1176516432 21:7787691-7787713 AATGGTTTTGGTGGTGGTGATGG - Intergenic
1176872905 21:14098267-14098289 ATGGTGATGGGTGATGGTGATGG - Intergenic
1177343747 21:19840575-19840597 ATGGAGATGGATGGTGGTGATGG + Intergenic
1177626175 21:23663403-23663425 ATGGCATTTTGTGGTTGTGATGG - Intergenic
1178340834 21:31784623-31784645 GTGGTGTGTGGTGTTGATGATGG - Intergenic
1178340838 21:31784648-31784670 GTGGTGGTTGGTGGTGGTGGTGG - Intergenic
1178650460 21:34417703-34417725 AATGGTTTTGGTGGTGGTGATGG - Intergenic
1178920261 21:36734120-36734142 GTGGTGTGGTGTGGTGGTGACGG - Intronic
1178951681 21:36990524-36990546 GTGGTGTTTGGTGCCGGTCAGGG - Intergenic
1179069626 21:38059621-38059643 GTGATGGTTGGTGGTGGTGATGG + Intronic
1179305352 21:40149193-40149215 ATGATGGATGGTTGTGGTGATGG - Intronic
1179500586 21:41806255-41806277 GTGGTGATGGGTGGTGGTGATGG - Intronic
1179500633 21:41806439-41806461 ATGGTGATGGGTGGTGGTGATGG - Intronic
1179500688 21:41806683-41806705 GTGATGGGTGGTGGTGGTGATGG - Intronic
1179698282 21:43138060-43138082 CTGGAGGTTGGTGGTAGTGATGG - Intergenic
1180094507 21:45549749-45549771 CAGGTGGTTGGTGGTGGGGAGGG + Intergenic
1181135691 22:20764633-20764655 GTGGTGTCTGGTGGTCATGAAGG + Intronic
1181185400 22:21099860-21099882 TGGGTGGTTGGTGGTGGAGAGGG - Intergenic
1181528183 22:23501952-23501974 ATGGTGGGTGGTGGAGGTGGCGG - Intergenic
1181832699 22:25574634-25574656 GAGGTATTTGGTGGTGGTGGCGG + Intronic
1181923785 22:26341678-26341700 ATGCTGTTGGGTAGTGGTGGTGG - Intronic
1182095019 22:27620290-27620312 GTGGTGGTGGGTGGTGGTGGTGG - Intergenic
1182386212 22:29943764-29943786 GTGGGGTTTGGGGGTGGGGAAGG - Intronic
1182617349 22:31596366-31596388 ATGGTTTTAGGTGGTGGCCACGG + Intronic
1182719717 22:32387283-32387305 ATGGAGGTAGGTGGTGGTGCTGG - Intergenic
1182778044 22:32845573-32845595 ATTGGGTTGGGTGCTGGTGAGGG - Intronic
1182782660 22:32880529-32880551 CTGGTGGGTGGTGGTGGAGAGGG + Intronic
1183083584 22:35472920-35472942 ATGGTGCTGGGTGATGGGGATGG + Intergenic
1183193075 22:36334309-36334331 ATGGTGTTGGGTGGTGGCCCAGG + Intronic
1183196942 22:36360063-36360085 CTGATGTTAGGTGGTGGTGGTGG - Intronic
1183341759 22:37285344-37285366 GGGGTGTGTGGTGGTGGTGGTGG + Intronic
1183785666 22:40027847-40027869 ATGGTGGTGGGTGGTGGTGGGGG - Intronic
1183968275 22:41456730-41456752 TAGCTGTTTGGTGGTGGTGGTGG - Intergenic
1184162750 22:42707669-42707691 TTGGTATTTGTTGGTGGTGGTGG - Intronic
1184183931 22:42851262-42851284 AGGGTTTTTGGTAGAGGTGATGG + Intronic
1184291351 22:43499541-43499563 ATGGTGGGTGGTGGTGGAGGTGG + Intronic
1184359719 22:44007753-44007775 CTGGAGATGGGTGGTGGTGATGG - Intronic
1184382858 22:44156932-44156954 CTGGAGATGGGTGGTGGTGAGGG + Intronic
1184412791 22:44335101-44335123 ATGGTGTGTGGTGGTGTTTGGGG + Intergenic
1184537633 22:45098303-45098325 CTGGAGATGGGTGGTGGTGATGG + Intergenic
1184611939 22:45609689-45609711 GTGTTGTTTGGGGCTGGTGAAGG - Intergenic
1184870950 22:47238207-47238229 ATGGAGCTGGGTGGTGGTCAGGG - Intergenic
1185416108 22:50711499-50711521 ATGGTTTTTGGGGGAGGTGGTGG + Intergenic
949099879 3:130958-130980 AAGGTGTTCTGTGGTGGTGGTGG - Intergenic
949584260 3:5422603-5422625 ATTTTTTTTGGTCGTGGTGATGG - Intergenic
949741213 3:7236689-7236711 ATGGCTCTTGGTTGTGGTGAGGG - Intronic
950185026 3:10939577-10939599 ATGGTGGTAGGTGGAGGTTAGGG - Exonic
950445889 3:13037838-13037860 ATGGTGGCTGCTGGGGGTGAAGG + Intronic
950933542 3:16815244-16815266 ATGTGTTTTGTTGGTGGTGATGG + Intronic
951019370 3:17765951-17765973 AGGGTTATTAGTGGTGGTGATGG + Intronic
952208972 3:31209969-31209991 ATGGAGATGGATGGTGGTGATGG + Intergenic
952492539 3:33885940-33885962 TAGTTGGTTGGTGGTGGTGATGG + Intergenic
952809814 3:37391711-37391733 TTGTTTTTTGGTGGTGGAGATGG - Intronic
952892925 3:38055790-38055812 TTGCTGTGTGGTGTTGGTGAGGG - Intronic
953339588 3:42122371-42122393 ATGCTGTTTGGTGGTGGGGAAGG - Intronic
953430437 3:42835304-42835326 TTGCTGTGTGGTGTTGGTGAGGG + Intronic
953500567 3:43429224-43429246 GTTGAATTTGGTGGTGGTGAGGG + Intronic
953571326 3:44073926-44073948 ATGGAGTTGGATGGTGGTGATGG + Intergenic
953899729 3:46833322-46833344 AGGGTTTTTGGTGATGGCGATGG - Intronic
954419639 3:50411961-50411983 AAGGTGTTTGGGGGTTGTGGGGG - Intronic
955159951 3:56455108-56455130 CTGGAGATTGATGGTGGTGATGG + Intronic
955291704 3:57698061-57698083 ATGGTGGTTGGGTGTGGTGGTGG + Intergenic
955339360 3:58113125-58113147 ATGGAGATGGATGGTGGTGATGG - Intronic
955736263 3:62041797-62041819 ATGGACTTTGATGATGGTGATGG + Intronic
955797682 3:62654755-62654777 ATGGTATTTGGTGTGGGTGGGGG + Intronic
955959937 3:64330139-64330161 ATGGTTTTAGGTGGTGAAGAAGG - Intronic
956863710 3:73349223-73349245 ATGGTGTTTGGCGGGGGTGATGG + Intergenic
957227573 3:77469456-77469478 ATGGTAACTGGTGGTGGTGGTGG + Intronic
957236748 3:77602710-77602732 CTGGTGTGTGGTGGTGGTGGAGG - Intronic
958498332 3:94874332-94874354 GTGGTGCTTGGTGGTGGGGAGGG + Intergenic
958733998 3:97988943-97988965 GTGGTGGTAGGTGGTGGTGGGGG + Intronic
958734067 3:97989254-97989276 ATGGTGTTGGGTGGTGGGGATGG + Intronic
958734094 3:97989365-97989387 GTGGTGTTTGATGGTGGTTAGGG + Intronic
958734115 3:97989446-97989468 GTGGTGGGTGGTGGTGGTGGTGG + Intronic
958769334 3:98407576-98407598 TTGGTCTTTGATGATGGTGACGG - Intergenic
958909123 3:99973826-99973848 CTGGTGTTTGTTGTTGGTGGTGG + Intronic
959094874 3:101943900-101943922 ATGGAGTTTGGTGGGAGTGGAGG + Intergenic
960812195 3:121635944-121635966 ATGTTGTTTTGTGGTAGAGAGGG + Intronic
961026256 3:123560541-123560563 AGCATGTTTAGTGGTGGTGATGG - Intronic
961229447 3:125290032-125290054 GTGGTGGATGGTGGTGGTGGTGG - Intronic
961537674 3:127579949-127579971 CTGGTGTAGGGGGGTGGTGAGGG - Intronic
961728830 3:128952069-128952091 ATGCAGTTTGGTGTTGGAGAAGG + Intronic
961790210 3:129370530-129370552 ATAGTGTGTGGTGTGGGTGAGGG + Intergenic
961903339 3:130236720-130236742 ATGGTGATTGATGATAGTGATGG - Intergenic
961924256 3:130460691-130460713 AAGGTGTTTGCTGTTGCTGATGG + Intronic
962028248 3:131571712-131571734 TGGGTGTTTGATGGTGGTGATGG - Intronic
962508742 3:136077014-136077036 TTAGTGTTTGGAGGTGATGATGG + Intronic
965403777 3:168246323-168246345 TTGGTGTTTGGAGGTTGTTATGG - Intergenic
966141303 3:176759532-176759554 ATGGTGGTTGGGAGTGGTGGTGG - Intergenic
966277419 3:178191280-178191302 ATGGGGTGTGGTGGAGGTGGAGG - Intergenic
966420796 3:179732416-179732438 ATGCTCTGTGCTGGTGGTGAAGG + Intronic
966595384 3:181720572-181720594 CTGGGGCTTGGTAGTGGTGATGG - Intergenic
966920962 3:184611059-184611081 GTGGTGGTCGGTGGTGGTCATGG - Intronic
966975330 3:185077772-185077794 ATGCTATTTGGTGGTGGTGGGGG + Intergenic
967158837 3:186717885-186717907 GTGGTGGTGGGTGGTGGTGGTGG - Intronic
967158843 3:186717901-186717923 GTGGTGGATGGTGGTGGTGGTGG - Intronic
967158903 3:186718074-186718096 ATGGTGGTGGTTGGTGGTGGTGG - Intronic
967158939 3:186718179-186718201 GTGGTGGATGGTGGTGGTGGTGG - Intronic
967158986 3:186718307-186718329 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
967158987 3:186718310-186718332 GTGGTGGTGGGTGGTGGTGGTGG - Intronic
967158999 3:186718340-186718362 GTGGTGGGTGGTGGTGGTGGTGG - Intronic
967159000 3:186718343-186718365 GTGGTGGTGGGTGGTGGTGGTGG - Intronic
967452851 3:189646603-189646625 AAGGTGTATGGTGGTGGGGGTGG - Intronic
967854570 3:194106945-194106967 ATCCTGTTTGGTAGTGGTGGTGG - Intergenic
968505326 4:968639-968661 AGGGTGCTAGGTGGTGGGGATGG - Intronic
968602183 4:1515113-1515135 ATGGTGATGGATGGTGGTGGTGG + Intergenic
968602184 4:1515119-1515141 ATGGATGGTGGTGGTGGTGATGG + Intergenic
968624474 4:1620708-1620730 TTTGTTTTTGGTGGTGGTGGTGG - Intronic
969104271 4:4793333-4793355 ATTGATTTTGTTGGTGGTGATGG + Intergenic
969234618 4:5856945-5856967 ATAGTGGATGGTGGTGGTGATGG - Intronic
969347660 4:6579425-6579447 ATGGTGAAGGGTGGTGGTGATGG - Intronic
969347665 4:6579444-6579466 GTGGTGAAGGGTGGTGGTGATGG - Intronic
969347678 4:6579514-6579536 GTGGTGAAGGGTGGTGGTGATGG - Intronic
969550415 4:7862480-7862502 ATGGAGCTGGATGGTGGTGATGG + Intronic
970213066 4:13731064-13731086 GTGGTGTTTGGTGGGTGTGATGG + Intergenic
970454140 4:16205309-16205331 GTGGTATTTGGTGGTTGTGGTGG - Intronic
970511762 4:16788309-16788331 AGGGACTTTGGGGGTGGTGATGG + Intronic
970828598 4:20307883-20307905 ATGGGCTTTGGAGGTGGTCAGGG - Intronic
971368522 4:25996341-25996363 TTGGAGTTAGATGGTGGTGATGG - Intergenic
971743169 4:30545947-30545969 ATGGGGTTTGGAGCTGGGGATGG - Intergenic
972364132 4:38357670-38357692 ATTCTTTTTGGTGGTGGTGGTGG - Intergenic
972376320 4:38475182-38475204 ATGTTGTTTGGTTGAGGTGAGGG - Intergenic
972385214 4:38559533-38559555 ATGGTGGTGGGTGGTGGGGGAGG - Intergenic
972650653 4:41014302-41014324 AGGGTGTTTGGTGGTGTGGCTGG + Exonic
973671375 4:53221853-53221875 ATGGTGCTTGATGGTGTTCAAGG - Intronic
974023772 4:56713614-56713636 TTGGTCTTTGATGATGGTGATGG - Intergenic
974465560 4:62250992-62251014 ATAGTGTTTGGTTGTAGTTACGG - Intergenic
974496881 4:62641070-62641092 ATGGAGATGGATGGTGGTGATGG + Intergenic
974676477 4:65096306-65096328 ATGGTGTTTGTTGGAGATGATGG - Intergenic
974716489 4:65674867-65674889 ATGGTGATTGTTGATGGTGGTGG + Intergenic
974759697 4:66259006-66259028 ATTCAGTTTGGTGGTGGTGTTGG + Intergenic
976070363 4:81233338-81233360 ACAGTGTGTGGTGGTGGTGGTGG + Intergenic
976082783 4:81375154-81375176 TGGGTCTGTGGTGGTGGTGATGG - Intergenic
977501155 4:97839516-97839538 ATTGTGCTTGATGATGGTGATGG + Intronic
978185124 4:105848530-105848552 TTTGTTTTTGGTGGTGGTGGTGG - Intronic
978213010 4:106161106-106161128 ATGGAGATAGATGGTGGTGATGG + Intronic
978619535 4:110624679-110624701 ATAGGGTTTGGGGGTGGTCAGGG - Intronic
979384475 4:120048187-120048209 ATGGAGATGGATGGTGGTGATGG + Intergenic
980402173 4:132305328-132305350 ATGTGGTTTGGTGATTGTGAAGG - Intergenic
980419316 4:132540455-132540477 ATGGTGCTTGGGGGTGGGGTGGG - Intergenic
980639173 4:135552660-135552682 AGTGTGTGTGGCGGTGGTGAGGG - Intergenic
980886039 4:138763735-138763757 ATGGAGATGGATGGTGGTGATGG + Intergenic
981107664 4:140899526-140899548 CTGGAGATTGGTGGTGGTGGTGG + Intronic
981212784 4:142128781-142128803 ATGATGTGTGGAGGAGGTGAGGG - Intronic
981448758 4:144871461-144871483 CTGGAGATGGGTGGTGGTGATGG + Intergenic
981839392 4:149093731-149093753 ATGGTCTTTGATGATGGTGATGG + Intergenic
982424460 4:155242155-155242177 TGGGTGGTGGGTGGTGGTGAGGG + Intergenic
982761203 4:159286068-159286090 TTAGTATTTGGTGGTGGTGGTGG - Intronic
982767718 4:159367420-159367442 AGGGTGGGTGGTGATGGTGAGGG - Intergenic
982989913 4:162259917-162259939 ATGGTGTGTGTTTGTGGTGATGG - Intergenic
983271925 4:165572176-165572198 GTGGTGGTGGGTGGGGGTGAGGG + Intergenic
984452181 4:179916176-179916198 ATGGAGATTGAGGGTGGTGATGG - Intergenic
984625350 4:182001080-182001102 TTGGTGGGTGGTGGTGGTGAAGG - Intergenic
985446787 4:190026353-190026375 TTGGTGTTTGTTGTTGGTGGTGG - Intronic
985770523 5:1807346-1807368 CTGGAGATGGGTGGTGGTGATGG + Intronic
985799929 5:1998587-1998609 ATGGTGACTGGTGATGGTCATGG + Intergenic
985859450 5:2459006-2459028 TTGGGGTCTGTTGGTGGTGAGGG + Intergenic
986681604 5:10238159-10238181 CTGGAGATGGGTGGTGGTGATGG + Intronic
987594489 5:19979192-19979214 AAGGTGATTGTTGGTGGGGATGG + Intronic
987602332 5:20087541-20087563 ATGGTGTTTGCTGAAGGTTAAGG - Intronic
987828251 5:23061812-23061834 ATGTTGTTTGCTGATGGTGATGG - Intergenic
987927990 5:24365852-24365874 AAGGTCTTTGCTGGGGGTGAGGG - Intergenic
988085504 5:26470256-26470278 AAGGTGTTTGTTCTTGGTGAGGG - Intergenic
988098335 5:26646043-26646065 CTGGTGGGTGGTGATGGTGATGG + Intergenic
988375313 5:30428502-30428524 TTGGTCTTTGATGATGGTGATGG + Intergenic
989068739 5:37489341-37489363 ATTGTGCATGGTGTTGGTGATGG + Intronic
989160395 5:38385295-38385317 TTGGTGTTTGTTGGCGGTGGCGG - Intronic
990257425 5:53985387-53985409 ATGGCGATGGATGGTGGTGATGG - Intronic
990836729 5:60029809-60029831 GTGCTTGTTGGTGGTGGTGATGG + Intronic
991301783 5:65135338-65135360 TTGGTGTTGGATGGTGATGACGG - Intergenic
991437724 5:66613758-66613780 TTGGTGTTTGCAGGTGGAGAGGG + Intronic
991720473 5:69490963-69490985 ATGGAATTAGATGGTGGTGATGG + Intergenic
991972396 5:72153596-72153618 GTGGCGTGTGGTGGTGGTGGTGG + Intronic
992031808 5:72728591-72728613 TTGGTCTTTGATGATGGTGATGG - Intergenic
992074685 5:73180761-73180783 ATGGTGTTTGCTGAAGGTTAAGG - Intergenic
992284404 5:75219011-75219033 ATGATGTTTGGTGGTGGCTGTGG - Intronic
992300552 5:75374783-75374805 ATGGGCTTTGGTGGGGGTCATGG - Intronic
992861612 5:80916571-80916593 TTGGGGTTTGGTGGTAGAGATGG - Intergenic
993962780 5:94320478-94320500 GGGGTGTGGGGTGGTGGTGAGGG - Intronic
994090085 5:95802302-95802324 ATTGTTGTTGGTGGTGGTGGTGG - Intronic
994092910 5:95824420-95824442 ATGGGGAGTGGTGGTGGTGGTGG - Intergenic
994131324 5:96231829-96231851 ATGGTATATGTTGGTGGTAATGG - Intergenic
994561864 5:101384193-101384215 TTAGTTTTTGGTGGTGGTGGTGG + Intergenic
994933962 5:106227487-106227509 ATCATGTGTGGTAGTGGTGAAGG - Intergenic
996794029 5:127324781-127324803 GTGGTGTTTGGTGGTGATAAAGG - Intronic
996963398 5:129278801-129278823 ATAGAGTATGGTGGTGGTGGTGG + Intergenic
997648212 5:135495378-135495400 TTGGTGTTGGCTGTTGGTGAGGG + Intergenic
997897395 5:137731920-137731942 CTGGAGATGGGTGGTGGTGATGG - Intronic
997991576 5:138548739-138548761 ATGGTCTTTTGTGGGGGTGCAGG + Intergenic
998089804 5:139358412-139358434 ATTGTGTCTGGTGGTGGGGAGGG + Intronic
999188248 5:149728798-149728820 ATAATGTGTGGTGGTGGTGGTGG + Intergenic
1000585897 5:163098676-163098698 ATGGTGCTTGGCGGTGTGGAAGG - Intergenic
1000991388 5:167915476-167915498 CTGGTGGTTGGTGGGGGTGTAGG - Intronic
1000993553 5:167935609-167935631 ATGGTTCCTGGAGGTGGTGAAGG + Intronic
1001091704 5:168746675-168746697 ATGGTGGTGTGTGGTGGTGTGGG + Intronic
1001273239 5:170331586-170331608 ATGGTGTGGGGAGGTGGGGAAGG + Intergenic
1001442147 5:171751188-171751210 ATGGTGGTGGGTGGTGGGAATGG - Intergenic
1001472428 5:172024024-172024046 TTGGAGATGGGTGGTGGTGATGG - Intergenic
1001715459 5:173811494-173811516 ATAGTGGTTGGTGATGGTGTTGG + Intergenic
1002052079 5:176576959-176576981 ATGGTGTTAGGTGATACTGAGGG + Intronic
1002052105 5:176577070-176577092 GTGGTGTTTGGTGTTGCTGTGGG + Intronic
1002140075 5:177133034-177133056 TTGGTCTGTGGTGGTGGTGGTGG + Intronic
1002257106 5:177966080-177966102 ATGAGGATTGGTGGTGATGAAGG + Intergenic
1002345211 5:178544032-178544054 ATGGTGTTAGGAGGTGATTAGGG - Intronic
1002852512 6:1009188-1009210 CTGGAGTTGGATGGTGGTGATGG - Intergenic
1002933832 6:1654651-1654673 CTGGAGATGGGTGGTGGTGATGG + Intronic
1003106727 6:3222312-3222334 ATGGGATTTGGTGGTGCTGATGG - Intergenic
1003142952 6:3486769-3486791 CTGGAGTTGGATGGTGGTGATGG + Intergenic
1003546431 6:7063343-7063365 ATGGTTTTTTTTGGTGGTGGTGG + Intergenic
1003635264 6:7826119-7826141 AGGGTGGTTGGCAGTGGTGATGG + Intronic
1004133936 6:12948426-12948448 AGGGTTGTTGGTGGTGGTCATGG + Intronic
1004407476 6:15347668-15347690 TTTGTGTATGTTGGTGGTGATGG + Intronic
1004679021 6:17874281-17874303 TTGTTTTTTGGTGGTGGTGGGGG + Intronic
1005229330 6:23682093-23682115 TTGTGGTTTGGTGGTGGTGATGG + Intergenic
1005333182 6:24768578-24768600 GTTGTTGTTGGTGGTGGTGATGG + Intergenic
1006826556 6:36940198-36940220 ATGGTGTTGAGGGGTGGTCAGGG + Intergenic
1007229914 6:40341010-40341032 GTGGTTTTTGGTGCTGGTGGTGG + Intergenic
1007262144 6:40571486-40571508 ATGGGGTTTGCTGGGGGTTAGGG - Intronic
1007325961 6:41059706-41059728 TTGGTGATGGGTGGGGGTGAGGG + Intronic
1007411480 6:41664585-41664607 TTGGCGTGTGGTGGTGGTGGGGG - Intergenic
1007557972 6:42782630-42782652 GTGGCGGTTGGTGGTGGGGAGGG + Intronic
1007694511 6:43723875-43723897 CTGGTGTTTGGGTGTGGTCACGG + Intergenic
1009317077 6:62233256-62233278 ATGGTGTGGGGTGGAGGAGAAGG - Intronic
1010816143 6:80360061-80360083 ATGGTGATTGGAGGTGGTTAGGG + Intergenic
1010994617 6:82519080-82519102 GTGGTCTCTGGTGGTGGTGATGG + Intergenic
1011470175 6:87701222-87701244 ATAGTGTTTGGAGGTGGGTAGGG - Intronic
1011665650 6:89630307-89630329 ATGGTGGGTGGTGATGGAGAAGG + Intronic
1012104776 6:95143073-95143095 GTTGTTTTTGGTGGTGGTGGTGG + Intergenic
1013230001 6:108153972-108153994 CTGGTGTGTGTTGGTGGGGAGGG + Intronic
1013897991 6:115114897-115114919 GTGGGGTGTGGTGGTGGGGAGGG + Intergenic
1014244660 6:119054973-119054995 ATGGAATTTGGTAGTGGTGATGG - Intronic
1014668995 6:124276110-124276132 GTGGTGTTTCGTTGTGGTGGCGG + Intronic
1015099243 6:129455353-129455375 TGCGTGTTTGGTGGTGTTGAGGG + Intronic
1015220520 6:130799904-130799926 ATGGAGATGGATGGTGGTGATGG - Intergenic
1015428874 6:133106271-133106293 ATGGTGTTTGATGTTGGCAAAGG + Intergenic
1016222923 6:141698064-141698086 ATGGTGTTTGCTGAAGGTTAGGG - Intergenic
1016495568 6:144657889-144657911 TGTGTGTGTGGTGGTGGTGATGG + Intronic
1016588498 6:145716695-145716717 TGGGTGTGTGGTGGTGATGAGGG - Intronic
1016605735 6:145922843-145922865 ATTGTGTGTGGTGCTGGTGTGGG - Intronic
1017097603 6:150818512-150818534 CTGGTTTTTGGTGGTGGTAGAGG - Intronic
1017264197 6:152423440-152423462 ATAGTGTGTGTTGGTGGGGAGGG - Intronic
1017680669 6:156861170-156861192 TGTGTGTTTGGTGGTGGGGAGGG + Intronic
1017935105 6:158998902-158998924 TTGGTTTTTTGTGGTGGTGGTGG - Intronic
1017942591 6:159066164-159066186 CTGGTGGTTGGTGGTGGGGGTGG + Intergenic
1018699587 6:166416091-166416113 AGGGTGGATGGTGGAGGTGATGG - Intronic
1018714770 6:166523481-166523503 GTATTGTTTGGAGGTGGTGAAGG - Intronic
1019332527 7:467474-467496 ATGGTTGTGGGAGGTGGTGATGG - Intergenic
1019332542 7:467547-467569 ATGGTTTTGGGAGGAGGTGATGG - Intergenic
1019956543 7:4419306-4419328 ATTTTTTTTGGTGGTGGTGGAGG - Intergenic
1020085639 7:5308858-5308880 ATGGAGGTAGGTGGTGGTGGTGG - Exonic
1020277718 7:6635078-6635100 GTGGTGGTTGGTGGTGGTGGTGG - Intergenic
1020438858 7:8196002-8196024 ATTGTTTTTGGTGTTGGTGTTGG - Intronic
1020448533 7:8296019-8296041 TTGTTTTTTGGTGGTGGTGGTGG - Intergenic
1020720389 7:11737290-11737312 TTTATGTGTGGTGGTGGTGAGGG + Intronic
1021207448 7:17801342-17801364 ATGGTCCTTGGTGGAGGCGAAGG + Intronic
1021352223 7:19608980-19609002 GTGGAGTTGGATGGTGGTGATGG + Intergenic
1021498408 7:21302017-21302039 CTGGAGTTGGATGGTGGTGAGGG + Intergenic
1021549391 7:21853697-21853719 ATGTTGGTTGATGGTGGTGCTGG + Intronic
1021928097 7:25552570-25552592 ATGGTGGTTGGTGATGGCGAGGG + Intergenic
1022227940 7:28382746-28382768 ATGTGGTTTGATGGGGGTGAGGG - Intronic
1022589248 7:31645591-31645613 GTGGTGGGTGGTGGTGATGATGG - Intronic
1023256759 7:38320021-38320043 GTGGAGGTTTGTGGTGGTGAAGG + Intergenic
1023928065 7:44685192-44685214 TTGGAGATGGGTGGTGGTGATGG - Intronic
1024032606 7:45476326-45476348 ATGTTGATTGGTGGTGGAGGGGG + Intergenic
1024213655 7:47228181-47228203 CTGGAGTTGGATGGTGGTGATGG + Intergenic
1024215403 7:47244224-47244246 ATGGTTTGCAGTGGTGGTGATGG + Intergenic
1024317168 7:48031872-48031894 TGGGTGTGTGGTGGTGGTGGGGG + Intergenic
1024462655 7:49674568-49674590 TTTGTGGTTGGTGGTGGTGGGGG - Intergenic
1024478059 7:49834886-49834908 ACTGTGTGTGGTGGTGGTGGAGG + Intronic
1024639225 7:51316425-51316447 CTGGTGTTGGGTGCTGGTGTTGG - Intronic
1024668540 7:51568974-51568996 ATGCAGATGGGTGGTGGTGATGG + Intergenic
1024962173 7:54989065-54989087 TTCATGTTTGGTGGTGGTGGTGG - Intergenic
1025079471 7:55969251-55969273 ATGGAGTGTGGTGGTGGGGAGGG + Intronic
1025208670 7:57008306-57008328 ATGGAGGTAGGTGGTGGTGGTGG + Intergenic
1025554172 7:62283172-62283194 ATGGAGATGGGTGGTAGTGATGG + Intergenic
1025560609 7:62370102-62370124 ATGGAGATGGGTGGTAGTGATGG - Intergenic
1025663277 7:63568572-63568594 ATGGAGGTAGGTGGTGGTGGTGG - Intergenic
1025756624 7:64350793-64350815 GTTTTGTTTGGTGGTGGTGGTGG + Exonic
1026263645 7:68777428-68777450 CTGGGCTTTGGTGATGGTGAGGG + Intergenic
1026544638 7:71311267-71311289 AAGGTGTGTGGTGTTGGTCAGGG + Intronic
1026733732 7:72934691-72934713 TTTGTGTTTGGTGGTGTTGGTGG + Intronic
1026784014 7:73289244-73289266 TTTGTGTTTGGTGGTGTTGGTGG + Intergenic
1026849699 7:73717168-73717190 GTGGTGTTGGGTGGGGGAGAAGG + Intronic
1027472139 7:78586655-78586677 CTGGAGATGGGTGGTGGTGATGG - Intronic
1029047015 7:97640458-97640480 ATTGTGTTTGCTTGTGCTGAAGG - Intergenic
1029148018 7:98460323-98460345 CTGGAGATGGGTGGTGGTGATGG - Intergenic
1029150728 7:98478555-98478577 ATGGGCTTTGGTGGGGGTCATGG + Intergenic
1029196788 7:98811003-98811025 GTGGTGGTGGGTGGTGGTGGTGG + Intergenic
1029196812 7:98811088-98811110 GTGGTTGTTGGTAGTGGTGATGG + Intergenic
1029196844 7:98811236-98811258 GTAGTGGTTGGTAGTGGTGATGG + Intergenic
1029196880 7:98811381-98811403 GTGGTGGTTGGTAGTGGTGATGG + Intergenic
1029196904 7:98811495-98811517 GTAGTGGTTGGTAGTGGTGATGG + Intergenic
1029196913 7:98811526-98811548 ATGGTAGTGGGTGGTGGTGGTGG + Intergenic
1029196922 7:98811560-98811582 GTGATGGTTGGTGGTGGTGGTGG + Intergenic
1029196923 7:98811563-98811585 ATGGTTGGTGGTGGTGGTGGTGG + Intergenic
1029789878 7:102831281-102831303 ATGTTCTCTGGTGGAGGTGAGGG - Intronic
1030094546 7:105886257-105886279 ATGTTTTTTGGTAGTGATGATGG - Intronic
1030151242 7:106407370-106407392 AGGGTTATTGGGGGTGGTGAGGG - Intergenic
1030469537 7:109946342-109946364 GGGGTTTTTGTTGGTGGTGATGG + Intergenic
1030517558 7:110557287-110557309 ATGGGGTTTGGGTGTGGTGAAGG - Intergenic
1030788678 7:113695826-113695848 ATTTTGTTTGGTTGTGATGATGG - Intergenic
1030789576 7:113707307-113707329 ATTATCCTTGGTGGTGGTGAAGG - Intergenic
1030817608 7:114055918-114055940 TTGGTCTTTGATGATGGTGACGG - Intronic
1030937805 7:115607301-115607323 ATGGTGTGTGGTGGTGATGGTGG - Intergenic
1030940423 7:115640313-115640335 ATGGTATTTTTTGGTGGTGATGG - Intergenic
1031075542 7:117208863-117208885 TTTGTCTTTGGTGGTGGTGGTGG + Intronic
1031147535 7:118013782-118013804 CTGGGGTTTGGGGGTGGTGCAGG - Intergenic
1031614522 7:123865130-123865152 ATGTTCTATGGTGGTGATGAGGG + Intronic
1032097728 7:128947777-128947799 ATGGGGGTTGCTGATGGTGAGGG - Exonic
1032204347 7:129848783-129848805 ATTATTTTTGGTGGTGGTGGTGG + Intronic
1032306361 7:130735078-130735100 ATGGTGTTTTGTGATTGTGGAGG + Intergenic
1032956077 7:136973314-136973336 ATGGTGGCAGGTGATGGTGACGG + Intronic
1033250073 7:139751337-139751359 AAGGTGGTTGGAGGTGGTGGTGG - Intronic
1033519667 7:142148135-142148157 ATGGTGTTAGGTAATGGTGGTGG - Intronic
1033985173 7:147216533-147216555 TTAGTGTTTAGTGTTGGTGAAGG - Intronic
1034228921 7:149504028-149504050 ATTTTGTTTGTTGGTGGAGATGG + Intergenic
1034319442 7:150166321-150166343 ATGGTGTATGTTTGAGGTGATGG - Intergenic
1034773317 7:153800890-153800912 ATGGTGTATGTTTGAGGTGATGG + Intergenic
1034889804 7:154829812-154829834 ATGGTGTTTGGTGGTGGTGAAGG - Intronic
1034897673 7:154887846-154887868 GTGGGCTTTGGTGCTGGTGAGGG - Intronic
1035032263 7:155869272-155869294 ATGGGGGTGGGTGGTGGTGTAGG + Intergenic
1035142885 7:156781910-156781932 CTGGAGATGGGTGGTGGTGATGG - Intronic
1035340207 7:158155811-158155833 ATGGTGGGTGATGGTGATGATGG - Intronic
1035463384 7:159060329-159060351 ATGGTGGTTGGATGAGGTGAGGG - Intronic
1036103295 8:5811416-5811438 ATGGTGTTTAGAGGTTGGGAAGG + Intergenic
1036751334 8:11445315-11445337 GTGGTGGGTGGAGGTGGTGAGGG - Intronic
1037103467 8:15076631-15076653 TTTGGGATTGGTGGTGGTGATGG - Intronic
1037190075 8:16113898-16113920 ATGGTGGTTGGGGGTGGTTGGGG - Intronic
1038799782 8:30739108-30739130 ATGGGGGTTGATGGTGGTGAGGG + Intronic
1039136482 8:34329316-34329338 TTGTTTTTTGGTGGTGGTGGTGG + Intergenic
1039254323 8:35702457-35702479 ATGGTTCTTGGTGGTGGTGTTGG - Intronic
1040040549 8:42912495-42912517 CTGGAGATGGGTGGTGGTGATGG + Intronic
1040372097 8:46787493-46787515 TTGTTTTTTGGTGGTGGTGGTGG + Intergenic
1040754162 8:50750581-50750603 ATGGTGATTGCTGGTGGTTGGGG - Intronic
1040759976 8:50828978-50829000 CTGGATTTTGATGGTGGTGATGG - Intergenic
1041189579 8:55340279-55340301 GTGGTGTTTGGTGGTGGCATTGG + Intronic
1041296996 8:56367451-56367473 ATGGTATTTGGTTTTGGTGGGGG - Intergenic
1042462203 8:69082716-69082738 AAGGTGGGTGGTGGTGGTGGTGG - Intergenic
1043247664 8:78025946-78025968 ATTTTGTTTGGTGATGGTGGGGG + Intergenic
1043367366 8:79549226-79549248 ATGATGTTTGTTTCTGGTGATGG - Intergenic
1043402198 8:79894845-79894867 CTGGTGATGGATGGTGGTGATGG - Intergenic
1043494265 8:80782881-80782903 TTGGTGTTTGGTTGTGGACATGG + Intronic
1043804469 8:84654005-84654027 TTGTTTTTTGGTGGTGGTGGTGG + Intronic
1043874274 8:85466331-85466353 ATTTTGTTTGGTGGTGGTGTGGG + Intronic
1044019912 8:87093329-87093351 ATGGCGTTGTGTGGTGGTTAGGG + Intronic
1045072980 8:98529937-98529959 ATGGAAATTGATGGTGGTGATGG + Intronic
1045351468 8:101344605-101344627 GAGGTCTTTGGTGGTGGTGATGG + Intergenic
1045364797 8:101466051-101466073 ATAATGATGGGTGGTGGTGATGG + Intergenic
1045384223 8:101655794-101655816 AAGGAATTTGGTGGTGGTGATGG + Intronic
1045531931 8:102993472-102993494 ATGGTGCTATGTGGGGGTGATGG - Intergenic
1045575312 8:103414616-103414638 ATGGTGCTTGGTGGAGGGGTCGG - Intronic
1045816271 8:106280641-106280663 CTGGAGATGGGTGGTGGTGATGG + Intronic
1046379099 8:113430882-113430904 CTGTTGTTTGGTGCTGGTTAAGG - Intronic
1046624759 8:116564555-116564577 AGGGGGGTAGGTGGTGGTGAAGG - Intergenic
1047371401 8:124258972-124258994 ATGGTGTTGGGGGATGGGGAAGG - Intergenic
1047759488 8:127943654-127943676 ATGTTCTTTTGTGGTGGTGTTGG + Intergenic
1048871846 8:138805437-138805459 ATGGTGTGTGGTGTGTGTGATGG + Intronic
1048997601 8:139804147-139804169 GTGGTGCTTGGTGGTGGTGGTGG - Intronic
1048997611 8:139804179-139804201 GTGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997624 8:139804224-139804246 GTGGTGGTGGGTGGTGGTGATGG - Intronic
1048997628 8:139804237-139804259 GTGGTGTTTGGTGGTGGTGGTGG - Intronic
1048997649 8:139804316-139804338 GTGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997655 8:139804338-139804360 GTGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997675 8:139804417-139804439 ATGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997680 8:139804436-139804458 GTGGTGGTGAGTGGTGGTGATGG - Intronic
1048997706 8:139804544-139804566 GTGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997716 8:139804576-139804598 GTGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997728 8:139804621-139804643 GTGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997738 8:139804653-139804675 GTGGTGCTTGGTGGCGGTGGTGG - Intronic
1048997761 8:139804733-139804755 GCGGTGCTTGGTGGTGGTGGTGG - Intronic
1048997770 8:139804765-139804787 GTGGTGCTTGGTGGTGGTGGTGG - Intronic
1049019672 8:139947297-139947319 ATGCTATTTGGTGGCGTTGATGG - Intronic
1049270921 8:141695798-141695820 ATGGTGTGGGGTGCTGGAGAAGG + Intergenic
1049543219 8:143218020-143218042 GTGGTGTTGGGTGGTGTTGGGGG - Intergenic
1049543257 8:143218121-143218143 GTGGTGTTGGGTGGTGTTGGGGG - Intergenic
1049658701 8:143810194-143810216 ATGGGGTTTGGTTGTGGGGTAGG - Intronic
1049925077 9:400460-400482 AAGGAGGTGGGTGGTGGTGATGG - Intronic
1050572521 9:6956102-6956124 AGGGTAGTTGGGGGTGGTGATGG + Intronic
1050946932 9:11534805-11534827 TTGTTGTTCGGTGGTGGTGGTGG - Intergenic
1051691250 9:19715054-19715076 ACGGTGTTTGGTGGTGGTGGTGG - Intronic
1051973804 9:22924131-22924153 GTGCTGTTTGGTGGTGGTGATGG - Intergenic
1051995939 9:23218180-23218202 AAGGTGCTGGGTGGTGTTGATGG + Intergenic
1052910965 9:33881391-33881413 CTGGAGTTAGATGGTGGTGATGG - Intronic
1053038711 9:34850740-34850762 TTGGTCTTTGATGATGGTGATGG + Intergenic
1053186356 9:36019879-36019901 GGGGTTTTTGGTGGTGGTGGTGG + Intergenic
1053419718 9:37969782-37969804 ATGGTGTCTGGGGGTGGTGCAGG - Intronic
1053663562 9:40301387-40301409 GTGGATTTTGGTGGAGGTGAGGG + Intronic
1053790233 9:41681463-41681485 AAGGTGTGTGGTGGTGGTGGTGG - Intergenic
1053914074 9:42931929-42931951 GTGGATTTTGGTGGAGGTGAGGG + Intergenic
1054154909 9:61633292-61633314 AAGGTGTGTGGTGGTGGTGGTGG + Intergenic
1054178579 9:61893164-61893186 AAGGTGTGTGGTGGTGGTGGTGG - Intergenic
1054375685 9:64447621-64447643 GTGGATTTTGGTGGAGGTGAGGG + Intergenic
1054474697 9:65564417-65564439 AAGGTGTGTGGTGGTGGTGGTGG + Intergenic
1054521053 9:66074898-66074920 GTGGATTTTGGTGGAGGTGAGGG - Intergenic
1054658954 9:67687665-67687687 AAGGTGTGTGGTGGTGGTGGTGG + Intergenic
1054992157 9:71340939-71340961 ATGATTTTTGGTGGTGGTGATGG - Intronic
1055283975 9:74708168-74708190 GTTGTTGTTGGTGGTGGTGATGG - Intergenic
1055649870 9:78396692-78396714 TTGCTGTTTGGGGGTGGGGAGGG + Intergenic
1056201013 9:84276734-84276756 TTTGTTTTTTGTGGTGGTGAAGG - Exonic
1056609523 9:88115411-88115433 CATGTGGTTGGTGGTGGTGATGG + Intergenic
1056719515 9:89060082-89060104 ATGGTGTTAGGAGGTGGTGGAGG + Intronic
1056841742 9:90003511-90003533 AAGGTCTTTGGTGCTGGTGGTGG + Intergenic
1057040639 9:91845187-91845209 AGGGTGCTGGGTGGTGGGGAGGG - Intronic
1057048281 9:91902583-91902605 ATGGTGTCTGTTGGGGGTGGGGG - Intronic
1057771697 9:97974089-97974111 CTGGAATTTGGTAGTGGTGATGG - Intergenic
1057805256 9:98215339-98215361 ATGCTGCGTGGTGTTGGTGATGG - Intronic
1058162569 9:101585692-101585714 AGGGTGGTTGGTGGAGGTGGTGG - Intronic
1058543037 9:106031662-106031684 ATGGTGTGGTGTGGTGGGGAGGG + Intergenic
1058566483 9:106290554-106290576 ATGGTGATGGATGGTGGTAATGG + Intergenic
1059387903 9:113979283-113979305 ATGCTGATTGGTGGTCATGATGG + Intronic
1059404599 9:114092118-114092140 ATGGTGTATGGGGGTGGGGTGGG - Intronic
1059436222 9:114278137-114278159 CTGGTGGTGGCTGGTGGTGATGG + Intronic
1059718554 9:116936269-116936291 ATGGTGGGTGGTAGTGGTGATGG - Intronic
1060335819 9:122720925-122720947 ATTGTGTTTGCTGGGGGTGAAGG - Intergenic
1060358495 9:122932211-122932233 TTCGTTTTTGGTGGTGGTGAGGG + Intergenic
1060621611 9:125072617-125072639 ATGGAGATGGATGGTGGTGATGG - Intronic
1060803284 9:126558059-126558081 GTGGTGGTTGGGGGTGGTGGTGG - Intergenic
1061210949 9:129192874-129192896 ATTGTTGGTGGTGGTGGTGATGG - Intergenic
1061255977 9:129454308-129454330 ATGGTGGGTGGAGGTGGTGGAGG + Intergenic
1061456570 9:130702502-130702524 TTGGTGTTTGTTGGTGGAGGTGG + Intronic
1061844474 9:133379331-133379353 ATGGTGGGAGGTGGTGGTGTTGG - Intronic
1062153773 9:135034616-135034638 CTGGAGGTGGGTGGTGGTGATGG - Intergenic
1062510934 9:136905504-136905526 ATGGAGGTAGATGGTGGTGATGG + Intronic
1185466430 X:357779-357801 GTGGAGTTTGGTGGAGGTGAAGG + Intronic
1185895075 X:3850920-3850942 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1185900193 X:3889345-3889367 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1185905309 X:3927776-3927798 CTGGAGATAGGTGGTGGTGATGG + Intergenic
1186059216 X:5685616-5685638 ATTGTGTTTGTTGTTGGTGGTGG - Intergenic
1186368827 X:8925864-8925886 TTGGTTTTTGGTGGTGGTGATGG + Intergenic
1186425001 X:9457072-9457094 ATTCTGTTTGGTGATGATGATGG - Intergenic
1186883370 X:13888650-13888672 GTGGGGGTTGGTGGTGGCGAGGG - Intronic
1187119673 X:16392159-16392181 AGGGTGAGTGGTGGTGGTGGTGG - Intergenic
1187285956 X:17903830-17903852 ATAGAATTTGGTGGTGGCGAAGG + Intergenic
1187379136 X:18784568-18784590 ATGGTGGTTGGTGGTTGCCAGGG - Intronic
1187813831 X:23209517-23209539 TTGGGGTTTGGTGGTGATGGTGG - Intergenic
1187951650 X:24476590-24476612 ACTGTGTTTGGGGGTGGGGAGGG - Intronic
1188557341 X:31427654-31427676 TTGCAGTGTGGTGGTGGTGAGGG + Intronic
1188871917 X:35382906-35382928 GTGGTGGTGGGTGGTGGTGATGG + Intergenic
1189219018 X:39355084-39355106 TTGCTGTTTTGTGGTGGTGAGGG + Intergenic
1189222633 X:39385362-39385384 TTGCTGATTGGGGGTGGTGAGGG - Intergenic
1189365242 X:40383202-40383224 TTGGTGATTGGTGGGGGTGGGGG + Intergenic
1189457219 X:41203271-41203293 TTGGAGATGGGTGGTGGTGATGG - Intronic
1190732390 X:53234413-53234435 ATGGTGACTGGGGGTGGTGGGGG + Exonic
1191203995 X:57815611-57815633 ATCCTGTTTGTTGGTGTTGATGG + Intergenic
1192116080 X:68412548-68412570 CTGGAGATGGGTGGTGGTGATGG + Intronic
1192181499 X:68918545-68918567 TTTGTGTCTGGTGGTGGTAAAGG + Intergenic
1193383705 X:80846337-80846359 TTTGGGTTGGGTGGTGGTGAAGG - Intergenic
1193568403 X:83109330-83109352 ATACTGTTTGCTGTTGGTGAAGG - Intergenic
1193857472 X:86622910-86622932 CTGGTGTTTGATGGCAGTGAAGG + Intronic
1194083881 X:89501994-89502016 TCTGTGTGTGGTGGTGGTGATGG - Intergenic
1194910850 X:99642826-99642848 GTGGTCTCTGGTGGTGGTGATGG - Intergenic
1195740144 X:108056767-108056789 CTTTTATTTGGTGGTGGTGAGGG + Intronic
1195956641 X:110338130-110338152 ATGGAGATGGATGGTGGTGATGG + Intronic
1196027243 X:111054121-111054143 GTGGTGGCTGGTGGTGGGGATGG - Intronic
1196044794 X:111246020-111246042 ATGGTGGTGAGTGGTGGTGGTGG + Exonic
1196044795 X:111246023-111246045 GTGGTGAGTGGTGGTGGTGGTGG + Exonic
1196809960 X:119620991-119621013 AAGGTATTGGGTGGTGGTGCTGG - Intronic
1197510434 X:127363086-127363108 TTGGTCTTTGATGATGGTGATGG - Intergenic
1197603725 X:128560594-128560616 TTGGTCTTTGTTGGGGGTGAAGG - Intergenic
1197778962 X:130140789-130140811 CTGGAGTTTTGGGGTGGTGATGG - Intronic
1197829234 X:130624071-130624093 ATTGTGTGTGGTGGTGGTTGTGG - Exonic
1197857461 X:130931567-130931589 GGGGTTTTTGGTGGTGGTGATGG - Intergenic
1197977915 X:132184990-132185012 ATGGAGTGTGGGGGTGGGGAGGG - Intergenic
1198066428 X:133101050-133101072 ATGGTATGTGGTGCTCGTGAGGG + Intergenic
1199156180 X:144551394-144551416 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1199346184 X:146743979-146744001 CTGGTGATAGATGGTGGTGATGG - Intergenic
1199374246 X:147088361-147088383 TGTGTGTGTGGTGGTGGTGATGG - Intergenic
1199534984 X:148892440-148892462 TTGTTGTTTGGTGGTGGTCATGG + Intronic
1199686098 X:150267098-150267120 CTGGTGATGGATGGTGGTGATGG - Intergenic
1199952081 X:152715024-152715046 ATGGGGTTTGGGGGTGGGGTTGG - Intronic
1199957602 X:152753424-152753446 ATGGGGTTTGGGGGTGGGGTTGG + Intronic
1200030855 X:153293976-153293998 CTGGTGATGGATGGTGGTGATGG - Intergenic
1200396634 X:155993659-155993681 GTGGAGATGGGTGGTGGTGATGG + Intergenic
1201560434 Y:15310437-15310459 ATGGTGGTTGGTCATGGTGATGG + Intergenic
1201768430 Y:17594705-17594727 ATGGTGATGGGTGATGGTGATGG - Intergenic
1201833124 Y:18311280-18311302 ATGGTGATGGGTGATGGTGATGG + Intergenic