ID: 1034889805

View in Genome Browser
Species Human (GRCh38)
Location 7:154829818-154829840
Sequence GCAGAGATGGTGTTTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 0, 2: 3, 3: 93, 4: 801}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889805_1034889810 -4 Left 1034889805 7:154829818-154829840 CCACCACCAAACACCATCTCTGC 0: 1
1: 0
2: 3
3: 93
4: 801
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889805_1034889811 -3 Left 1034889805 7:154829818-154829840 CCACCACCAAACACCATCTCTGC 0: 1
1: 0
2: 3
3: 93
4: 801
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889805 Original CRISPR GCAGAGATGGTGTTTGGTGG TGG (reversed) Intronic
900975209 1:6012297-6012319 GCAGAGGTGGTGGGTGGAGGTGG + Intronic
901100808 1:6717133-6717155 GCAGATGTGGTGTCTGGTGAGGG + Intergenic
901324548 1:8358813-8358835 GCAGCAATGGTGGTTGGTGGTGG + Exonic
901671174 1:10857132-10857154 GCCGGGGTGGTGTCTGGTGGGGG - Intergenic
903000112 1:20259191-20259213 GAAGAGATGGAGGTTGGGGGTGG + Intergenic
903350416 1:22713268-22713290 GGGGAGATGGTGTGAGGTGGAGG + Intronic
903482160 1:23661642-23661664 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
903929557 1:26854421-26854443 GCAGGGTTGGTGGTGGGTGGGGG + Exonic
905953375 1:41971980-41972002 GCAGATTTGGTGTCTGGTGAGGG - Intronic
905978008 1:42194004-42194026 GCAGATATGGTGTCTGGCGAGGG - Intronic
906368065 1:45227629-45227651 GCAGATTTGGTGTCTGGTGAGGG - Intronic
906370159 1:45247209-45247231 GCAGATTTGGTGTTTGGTAGGGG - Intronic
906463224 1:46053628-46053650 GCAGATTTGGTGTCTGGTGAGGG - Intronic
906509820 1:46404659-46404681 GCAGAGATGTGGCTTGGGGGAGG + Intronic
906555118 1:46704576-46704598 GCAGATTTGGTGTCTGGTGGAGG - Intronic
906707978 1:47908790-47908812 ACAGAGATGGTTTTGGGAGGGGG + Intronic
906989628 1:50724043-50724065 GTAGAGATGGGGTTTTGTGCTGG - Intronic
907414872 1:54307261-54307283 GTAGAGCGGGTGTTTGCTGGAGG - Intronic
907461102 1:54606192-54606214 GCAGAGAGGTGATTTGGTGGTGG + Intronic
908032390 1:60015313-60015335 GCAGATTTAGTGTTTGGTGAGGG - Intronic
908181731 1:61612469-61612491 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
908259385 1:62327677-62327699 GCAGGGATGATGTGTGGGGGTGG + Intergenic
908347107 1:63245279-63245301 GCAGATATGATGTCTGGTGAAGG + Intergenic
908470208 1:64436933-64436955 GCAGATGTGGTGTCTGGTGAGGG + Intergenic
909029394 1:70522211-70522233 GCAGATATGGTGTCTGGTGAGGG + Intergenic
909187222 1:72503181-72503203 GCAGATATGGTGTCTGGTGAGGG + Intergenic
909858431 1:80572235-80572257 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
909987759 1:82183622-82183644 GCAGATCTGGTGTTTGGTGAGGG + Intergenic
910041394 1:82855915-82855937 GCAGATATGGTGTCTAGTGAGGG - Intergenic
910090813 1:83461820-83461842 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
910544637 1:88400058-88400080 GCAGATCTGGTGTCTGGTGATGG + Intergenic
911168155 1:94743538-94743560 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
911554138 1:99322253-99322275 GCAGAGATGGTTACTGGAGGTGG + Intergenic
911556126 1:99347123-99347145 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
912076851 1:105885551-105885573 GCAGGTTTGGTGTTTGGTGAGGG - Intergenic
912453354 1:109781278-109781300 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
913085108 1:115429683-115429705 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
913415090 1:118596686-118596708 CCAGAGATTGTATCTGGTGGGGG + Intergenic
913425936 1:118729559-118729581 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
915488696 1:156239716-156239738 GCAGTGATGGAATTTGCTGGAGG + Exonic
915666764 1:157452055-157452077 GCAGAGTATGTGTGTGGTGGGGG + Intergenic
915729148 1:158040777-158040799 GCTAAGATGGTGGTTGGTGGGGG + Intronic
916554511 1:165882572-165882594 GCAGGGTTGGTGTCTGGTGAGGG + Intronic
916821566 1:168403891-168403913 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
916870212 1:168905752-168905774 AAAGGGAAGGTGTTTGGTGGTGG + Intergenic
916871015 1:168914655-168914677 GCAGAGACGGAATTTGGAGGTGG - Intergenic
917450663 1:175144970-175144992 GCAGATTTGGTTCTTGGTGGTGG + Intronic
917742352 1:177972959-177972981 GCAGATCTGGTGTCTGGTGAGGG - Intronic
918153096 1:181815505-181815527 GCAGATACGGTGTCTGGTGAGGG - Intergenic
918313091 1:183300461-183300483 GCAGATGTGGTGTCTGGTGAAGG - Intronic
918507941 1:185278364-185278386 GCAGATTTGGTGTCTGGTGAGGG - Intronic
919823649 1:201488859-201488881 GCGGAGAAGGTGATTGGTGCTGG - Exonic
919841490 1:201612537-201612559 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
920253747 1:204640162-204640184 GCAGATTTGGTGTCTGGTGAAGG + Intronic
920831214 1:209467329-209467351 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
921130728 1:212217401-212217423 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
921417251 1:214903524-214903546 GCAGAATTGGTGTCTGGTGTAGG - Intergenic
922223462 1:223626315-223626337 GGAGATGTGGTTTTTGGTGGAGG - Intronic
922271137 1:224035830-224035852 GGAGACAAGGTGGTTGGTGGAGG + Intergenic
922437694 1:225622591-225622613 ACAGATATGGTGTTTGGTGAGGG + Intronic
922990890 1:229910223-229910245 GCAGGTGTGGTGTTTGGTGCAGG - Intergenic
923068040 1:230538201-230538223 GCAGAGCTGGTGTCTGATGAGGG + Intergenic
923274370 1:232383860-232383882 GCAGATCTGGTGTCGGGTGGGGG + Intergenic
923489234 1:234468731-234468753 GCAGAGTTGGTGTGTGGAGTGGG - Intronic
923525061 1:234766266-234766288 GCAGGGTTGGTGTTGGGTGAGGG - Intergenic
923647576 1:235839621-235839643 GTAGAGATGGGGCGTGGTGGGGG - Intronic
924226880 1:241929169-241929191 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
924281750 1:242445267-242445289 GCAGATTTGGTGTCTGGTGAGGG - Intronic
924330466 1:242936027-242936049 GTAGAATTGGTGTTTGGTGGGGG - Intergenic
924678269 1:246203316-246203338 GCAGAGATTGTGTCTGATGGTGG - Intronic
924814040 1:247427096-247427118 GCAGATCTGGTGTTTGGTGAGGG + Intronic
1063023583 10:2155150-2155172 GCAGATTTGGTGTTTGGTGAGGG - Intergenic
1063026930 10:2189013-2189035 GCAAAGATGGTGTTGAGTGCAGG - Intergenic
1063419262 10:5898241-5898263 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1063610702 10:7559740-7559762 GCAGACATGGTGTCTGGTGAGGG + Exonic
1064218109 10:13417368-13417390 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1064298060 10:14096271-14096293 GCAGATCTGGTGTCTGGTGAGGG - Intronic
1064352223 10:14586631-14586653 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1064780856 10:18836449-18836471 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1064963333 10:20990506-20990528 GCAGATCTGGTGTCTGGTGAGGG - Intronic
1065261884 10:23932075-23932097 GCAGAGATGGAAGTTGGAGGAGG - Intronic
1065500957 10:26381944-26381966 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1066094241 10:32057103-32057125 ACAGAGATGCTGTGTGATGGGGG - Intergenic
1067173396 10:43925580-43925602 GCAGATCTGGTGTCTGGTGGGGG + Intergenic
1069613610 10:69792115-69792137 GCAGTGATGGTGGGTGGTGGTGG - Intergenic
1069717632 10:70531166-70531188 GCAGGGATGGTGTGGGGTGCAGG + Intronic
1069732634 10:70628367-70628389 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1069801041 10:71081724-71081746 GCAGCTTTGGTGTTTGGTGAGGG + Intergenic
1069869236 10:71523116-71523138 GCAGGGAGGGTGTTTGGTTAGGG + Intronic
1070532483 10:77349306-77349328 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1070683842 10:78467598-78467620 GCAGACCTGGGGCTTGGTGGAGG + Intergenic
1071899142 10:90100327-90100349 ACAGATTTGGTGTCTGGTGGGGG + Intergenic
1072537569 10:96375012-96375034 GCAGAGATGGAGGTTGGGAGGGG + Intronic
1073054225 10:100688782-100688804 GCAGAAATGGAGTGAGGTGGCGG + Intergenic
1073470632 10:103720097-103720119 GCAGATTTGGTGTCTGGTGAAGG + Intronic
1073956331 10:108875607-108875629 GCAGAAATGGTGGTGGGTTGGGG - Intergenic
1073986622 10:109216879-109216901 GCAGCTATGGGGTTTGGGGGTGG + Intergenic
1074277473 10:112017784-112017806 GCAGATCTGGTGTCTGGTGAAGG - Intergenic
1074300090 10:112225692-112225714 ACAGAGATGCTGGGTGGTGGTGG - Intergenic
1074422930 10:113325301-113325323 GAAGAGATGGCGTGGGGTGGGGG - Intergenic
1074819694 10:117168737-117168759 GACAAGAGGGTGTTTGGTGGTGG - Intergenic
1075023444 10:118967490-118967512 GGAGAGATGGGGGTGGGTGGTGG - Intergenic
1075436188 10:122444620-122444642 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1075448405 10:122529861-122529883 GCAGATATAGTGTCTGGTGGGGG + Intergenic
1075591454 10:123694334-123694356 CCAGAGATGGTGTCAGGTGAGGG + Exonic
1076521683 10:131085163-131085185 GCAGAGTTGGCGTCTGGTGAGGG - Intergenic
1076577215 10:131477345-131477367 GCAGAGTTGGTGTCTGGAGAGGG - Intergenic
1076739513 10:132476439-132476461 GTGGAGATGGGGTTTGGAGGTGG - Intergenic
1077392459 11:2306501-2306523 GCAGAGAGGATCTTGGGTGGTGG - Intronic
1078128134 11:8588003-8588025 GCAGATCTGATGCTTGGTGGGGG + Intronic
1078710153 11:13783535-13783557 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1078717625 11:13854909-13854931 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1078778081 11:14411894-14411916 GCAGGGATGGGGGTGGGTGGTGG - Intergenic
1079258415 11:18852957-18852979 GCAGAGATCCTGGTTCGTGGAGG + Intergenic
1079532865 11:21476559-21476581 GCAGGGATGATTATTGGTGGAGG - Intronic
1079752661 11:24218077-24218099 GTACAGATGGGGTTTTGTGGTGG - Intergenic
1080368434 11:31607139-31607161 GCAGAGTTGGTGCCTGGTGAGGG - Intronic
1080542317 11:33279789-33279811 GCAGATTTGGTGTGTGGTGAGGG + Intronic
1080827049 11:35857193-35857215 GCAGATCTGGTGTCTGGTGAAGG + Intergenic
1080848917 11:36050861-36050883 ACAGATTTGGTGTTTGGTGAGGG + Intronic
1081537843 11:44008213-44008235 TCAGAGATGGCTTTTGGTGGTGG + Intergenic
1081953488 11:47067662-47067684 GCAGAGTTGGTGTCTGGTAAAGG - Intronic
1082122850 11:48398102-48398124 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1082788129 11:57328556-57328578 GCAGTGTTGGGGATTGGTGGTGG - Intronic
1082909469 11:58353976-58353998 GCAGGGATGGAGTGGGGTGGGGG + Intergenic
1082994002 11:59234219-59234241 GCAGAGTTGGTGCATGGTGCTGG - Intergenic
1083043191 11:59708072-59708094 GCAGATTTGGTGTCTGGTGACGG + Intergenic
1083140875 11:60720490-60720512 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1083339341 11:61948867-61948889 GCAAAAATGGTGTGTGGGGGTGG + Intergenic
1084355102 11:68633291-68633313 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
1084627710 11:70321217-70321239 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1084993918 11:72956578-72956600 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1085235911 11:75015286-75015308 GCAGATTTGGTGTCTGGTGACGG - Intronic
1085294305 11:75422214-75422236 GCAGATCTGGTGTTTGATGAGGG - Intronic
1085311414 11:75519127-75519149 GGAGAGATGGTGTGGGTTGGTGG + Intronic
1085320075 11:75568670-75568692 GCTGTGATTGTGTTTGGGGGCGG + Intronic
1085446235 11:76603022-76603044 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1085447598 11:76611006-76611028 GCAGGGATGCTGGTGGGTGGGGG + Intergenic
1085730932 11:78998021-78998043 GCAGATTTGGTTTTTGGTGAGGG - Intronic
1085908092 11:80788763-80788785 GCAGATTTGGTTTTTGGTGAGGG + Intergenic
1086348552 11:85922334-85922356 GTAGAGATGGTGTGGGGCGGCGG + Intergenic
1086432007 11:86745150-86745172 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1087071836 11:94089299-94089321 GCAGAGAGGGTGTATGATGTGGG + Intronic
1087136073 11:94721459-94721481 GAGGAGATGGTATTTGGAGGTGG + Intronic
1087545272 11:99576709-99576731 GCAGATTTGGTGTTTGGGGAGGG + Intronic
1087840696 11:102917957-102917979 ACAGATTTGGTGTTTGGTGATGG - Intergenic
1087889500 11:103520600-103520622 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1088112329 11:106277114-106277136 GCAGTGGTGCTTTTTGGTGGAGG + Intergenic
1088747375 11:112815497-112815519 GCAGATTTGGTGTCTTGTGGGGG + Intergenic
1089009501 11:115121051-115121073 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1089157049 11:116410542-116410564 GCAGAGATGGAGCCTGGGGGAGG - Intergenic
1089825451 11:121271775-121271797 GCAGATATGGTGTCTGGTGAGGG + Intergenic
1090346452 11:126075542-126075564 GCAGATTTGGTGTTAGGTGAGGG - Intergenic
1090415975 11:126540762-126540784 GCAGAGTGGGTTTATGGTGGGGG + Intronic
1090518069 11:127449769-127449791 GCAGAGATGGTTTCAGGTGAGGG + Intergenic
1090912382 11:131132721-131132743 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1090918555 11:131188060-131188082 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1091053158 11:132393136-132393158 GCAGAATTGGTGTCTGGTGAGGG - Intergenic
1091187156 11:133657141-133657163 GCAGAGCTGGTGTCTGGTGAGGG - Intergenic
1091322725 11:134663407-134663429 GCAGAGTTGGTGTCTGGAGAGGG + Intergenic
1091447279 12:551257-551279 GCTGAGTTGGTGTGTGTTGGGGG - Intronic
1091637156 12:2205814-2205836 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1091667508 12:2430044-2430066 GCAGACTTGGTGTCTGGTGAGGG + Intronic
1092674551 12:10901242-10901264 GCAGAAATCTTGGTTGGTGGGGG + Intronic
1092730100 12:11523210-11523232 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1092762420 12:11821795-11821817 ACAGAGTTGTTGTATGGTGGTGG - Intronic
1092932717 12:13332006-13332028 GCAGATTTGGTGTTTGGTGAGGG + Intergenic
1093821352 12:23622128-23622150 GCTGCCATGGTGTTTGATGGTGG - Intronic
1094037712 12:26088497-26088519 GCAGATTTGGTGTCTGGTGACGG + Intergenic
1094126947 12:27033269-27033291 GCAGGTCTGGTGTCTGGTGGGGG + Intronic
1094622915 12:32097349-32097371 GCAGAGTTGGTGTCTGGCGAGGG - Intergenic
1095343152 12:41116607-41116629 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1095671525 12:44866150-44866172 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1095870230 12:47018641-47018663 CAAGAGATGGTGCTTGGAGGAGG - Intergenic
1095933481 12:47652575-47652597 GCAGACCTGGTGTTTGGTGAGGG + Intergenic
1096121637 12:49092591-49092613 GCAGAGTTGGGGTTGGGTGGGGG + Intronic
1096219846 12:49822182-49822204 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1097464889 12:59909803-59909825 GCAGATTTGGTGTCTGGTGGGGG + Intergenic
1097776092 12:63648169-63648191 GCAGATTTGGTGTCTGGTGAAGG - Intronic
1097833032 12:64245592-64245614 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1097927108 12:65141068-65141090 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1098113007 12:67144002-67144024 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
1098217831 12:68238694-68238716 GCAGGTTTGGTGTTTGGTGAGGG + Intergenic
1098235529 12:68414604-68414626 GCTGAGTTGGTGTCTGGTGAGGG - Intergenic
1098451145 12:70619274-70619296 ACAGAGATAGTGGGTGGTGGTGG + Intronic
1098653989 12:73006516-73006538 GGAGAGAAGGGGTTGGGTGGGGG + Intergenic
1098954510 12:76675836-76675858 GCAGATCTGGTGTATGGTGAGGG - Intergenic
1099028476 12:77495275-77495297 GCAGAGTTGGTGTCTGGTGAGGG + Intergenic
1099282281 12:80665883-80665905 GGAGAGATGGTGTTTCATTGTGG - Intronic
1099652057 12:85441296-85441318 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1100440280 12:94610570-94610592 GCAGATGGGGTGGTTGGTGGTGG - Intronic
1100610102 12:96184760-96184782 ACAGACTTGGTGTCTGGTGGAGG - Intergenic
1100984673 12:100192633-100192655 GCAGATTTGGTGTCTGGTGGGGG - Intergenic
1101071039 12:101076340-101076362 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1101757603 12:107633286-107633308 GCAGACTCGGTGTTTGGTGAGGG - Intronic
1102187133 12:110957657-110957679 GCAGAGATGGTGGATGAAGGAGG - Intergenic
1102546736 12:113662790-113662812 GCAGAGATGGTGGCTCGTGTTGG - Intergenic
1102646264 12:114405814-114405836 GCAGAGGAGGTGTGTGTTGGAGG - Intronic
1103093326 12:118113170-118113192 GCAAACTTGGTGTCTGGTGGGGG - Intronic
1103701238 12:122849728-122849750 ACAGAGAGGGTGGTTGGTGGAGG + Intronic
1104781410 12:131422802-131422824 AGAGAGATGGCGTTTGGTGCAGG - Intergenic
1105610376 13:21963951-21963973 GCAGATTCGGTGTTTGGTGAGGG - Intergenic
1105822216 13:24089842-24089864 GCAGGTTTGGTGTTTGGTGAGGG + Intronic
1105847470 13:24306070-24306092 TCAGAAATAGTGTTTGATGGTGG - Exonic
1105932421 13:25065409-25065431 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1106757428 13:32836982-32837004 GCAGCTTTGGTGTCTGGTGGGGG + Intergenic
1107057163 13:36118838-36118860 GCAGATTTAGTGTTTGGTGAGGG + Intronic
1107161102 13:37229134-37229156 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1107817661 13:44258568-44258590 GCAGATTTGGTGTGTGGTGAGGG - Intergenic
1108033784 13:46265465-46265487 GCAGATGTGGTGTCTGGTGAGGG + Intronic
1108281467 13:48866350-48866372 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1109120533 13:58450205-58450227 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1110753038 13:79137663-79137685 GCAGATCTGGTGTCTGGTGATGG - Intergenic
1110838829 13:80117464-80117486 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1110925320 13:81143407-81143429 GCAGATTTGGTGTTTGGTGAAGG + Intergenic
1111258058 13:85698268-85698290 GCAGATGTGGTGTTTGGTGAGGG - Intergenic
1111920232 13:94402547-94402569 GCAGATATGGGGCATGGTGGTGG - Intronic
1112187093 13:97137945-97137967 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1112287261 13:98115236-98115258 GCATAGATGGAGTTTGCTGTGGG + Intergenic
1112778289 13:102869042-102869064 CGTGAGATGCTGTTTGGTGGTGG + Intronic
1112784600 13:102938182-102938204 TCAGAGAAGGTGTCTGGTGTAGG + Intergenic
1113257096 13:108517844-108517866 GCAGATTTGGTGTCTGGTGGGGG + Intergenic
1114844197 14:26301247-26301269 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1114888750 14:26888972-26888994 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1114902747 14:27085194-27085216 AGAGAAATGGTTTTTGGTGGTGG - Intergenic
1115341080 14:32293495-32293517 GCAGATTTGGTGTCTGGTGATGG + Intergenic
1115828206 14:37301349-37301371 AAATAGATGGTGGTTGGTGGGGG - Intronic
1115977026 14:39008096-39008118 GCAGATTCGGTGTCTGGTGGGGG + Intergenic
1116053592 14:39835793-39835815 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1116121113 14:40723170-40723192 GCAGAGATTTTGTTGGGTGATGG + Intergenic
1116239773 14:42325337-42325359 GCAGAGATGGTGGTGATTGGTGG - Intergenic
1116723777 14:48534392-48534414 GCAGATTTGGTGTTTGGGGAGGG - Intergenic
1116870422 14:50064433-50064455 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1117013438 14:51493932-51493954 GCTGATATGGTGTCTGGTGAGGG + Intronic
1117118021 14:52536272-52536294 GCAGATTTGGTGTTGGGTGAGGG - Intronic
1117173810 14:53128388-53128410 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1118074303 14:62281660-62281682 GCAGATTTGGTGTTTGGTGAGGG + Intergenic
1118868663 14:69723534-69723556 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1119140592 14:72263725-72263747 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1119323808 14:73746774-73746796 GCAGGGAGGGTGTGTGGTGGGGG - Intronic
1119773616 14:77235971-77235993 GGGGAGATGGTGATGGGTGGGGG + Intronic
1120465049 14:84845630-84845652 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1120845414 14:89120910-89120932 GCAGGTTTGGTGTTTGGTGAGGG + Intergenic
1120898952 14:89559194-89559216 GCAGAGATGGGGTTGGGCGGGGG - Intronic
1121007000 14:90496710-90496732 GCAGTGATGGGGTTGGGAGGTGG - Intergenic
1121099149 14:91237942-91237964 ACAGAAATGGTGGTTGCTGGGGG - Intronic
1121138608 14:91521235-91521257 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1121356056 14:93216035-93216057 GCAGAGTCAGTGTTTGGTTGAGG + Intronic
1121382728 14:93488726-93488748 GCAGAGTTGATGTCTGGTGAGGG + Intronic
1121499281 14:94420652-94420674 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1121525673 14:94617311-94617333 GCTGAGATGGTCTTTGGGGAGGG + Intronic
1121534815 14:94684151-94684173 GGAGAGCTGGTGTTTGAAGGTGG - Intergenic
1121893980 14:97628202-97628224 GGAAAGATGGTACTTGGTGGTGG + Intergenic
1121963254 14:98280867-98280889 GAGGAGATGGTGGTTGGGGGAGG - Intergenic
1121979316 14:98440583-98440605 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1122671533 14:103376449-103376471 GCAGACATAGTGTCTGGTGAGGG - Intergenic
1123028121 14:105438199-105438221 GCAGGGCTGGTGGCTGGTGGTGG + Intronic
1123711440 15:22990584-22990606 ACAGAGTTGGTGTCTGGTGAGGG - Intronic
1124149993 15:27168747-27168769 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1125166054 15:36706253-36706275 GCACAGATTGGGTTTTGTGGAGG + Intronic
1125347586 15:38733658-38733680 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1125910544 15:43434666-43434688 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1125987388 15:44067529-44067551 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1126451984 15:48818390-48818412 GCAGATTTGGTGTCTGATGGGGG + Intergenic
1126573908 15:50179764-50179786 GCAGATGTGGTGTTTGGTGAAGG - Intronic
1127457084 15:59165045-59165067 GCAGATGTGGTGTCTGGTGAAGG - Intronic
1129493152 15:75949223-75949245 GTAGAGACGGGGTTTGGTGTTGG - Intronic
1129714994 15:77842213-77842235 GCAGATTTGGTGTCTGATGGGGG - Intergenic
1129717327 15:77859956-77859978 GCAGGGATGGAGCTTGGAGGAGG + Intergenic
1129751698 15:78069854-78069876 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1129851517 15:78796539-78796561 GCGGGGATGGTGTTGGGGGGTGG - Intronic
1130323234 15:82857272-82857294 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1130363745 15:83213814-83213836 GCAGAGCTGGTGTCTGGTGAGGG - Intergenic
1130461428 15:84160229-84160251 GCAGGGATGGAGCTTGGAGGAGG - Intergenic
1131122351 15:89830418-89830440 GCAGAGCTGGTGTTGGCAGGTGG - Intergenic
1131322198 15:91405257-91405279 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1131360770 15:91788709-91788731 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1131624539 15:94103659-94103681 GGAGAAATGGTGTTTGGTGGTGG + Intergenic
1131717923 15:95133619-95133641 GCAGTGATGGTGATGGGTGAGGG - Intergenic
1132086671 15:98914044-98914066 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1132406146 15:101542835-101542857 GCAGTGCTGGGGTTGGGTGGGGG - Intergenic
1132406159 15:101542871-101542893 GCAGTGCTGGGGTTGGGTGGGGG - Intergenic
1132907616 16:2291051-2291073 GTAGAGATGGTGGCTGGGGGTGG + Intronic
1133451623 16:5908951-5908973 GCAGATTTGGTGTTTGGTGAGGG - Intergenic
1134351897 16:13445279-13445301 GCTGAGATTGTGTTAGGTGCTGG - Intergenic
1135658263 16:24270766-24270788 GCAGAGAAGGTGTGTTGGGGTGG + Intronic
1135907589 16:26527325-26527347 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1136481554 16:30545219-30545241 GAAGAGATGGTAGTTGCTGGGGG + Intronic
1136563159 16:31053122-31053144 GCAGGGCTGGTTTTTGTTGGTGG + Intergenic
1136714208 16:32263990-32264012 GGAGAGATGCTGTATGGAGGAGG + Intergenic
1136753690 16:32665428-32665450 GGAGAGATGCTGTATGGAGGAGG - Intergenic
1136814423 16:33204937-33204959 GGAGAGATGCTGTATGGAGGAGG + Intronic
1136820899 16:33315017-33315039 GGAGAGATGCTGTATGGAGGAGG + Intergenic
1136827462 16:33371556-33371578 GGAGAGATGCTGTATGGAGGAGG + Intergenic
1136832528 16:33470327-33470349 GGAGAGATGCTGTATGGAGGAGG + Intergenic
1136930019 16:34410288-34410310 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1136974555 16:35001517-35001539 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1137283509 16:46997849-46997871 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1137394777 16:48109127-48109149 GCAGAGATGGCATTTGGGAGGGG + Intronic
1137515484 16:49139971-49139993 GCAGATTTGGTGTCTGGTGTGGG + Intergenic
1138101333 16:54254446-54254468 GCAGGGATGGGGTGGGGTGGGGG + Intronic
1138241146 16:55428093-55428115 GCAGATTGGGTGTCTGGTGGGGG + Intronic
1138351423 16:56348037-56348059 GCAGTGATGGGGTTGGGAGGTGG - Exonic
1138990248 16:62382245-62382267 GCAGAGATGGGGTTGGGAGGGGG - Intergenic
1139601027 16:67987324-67987346 CCAGTGCTGGTGGTTGGTGGGGG - Intergenic
1139891903 16:70258505-70258527 GCAGTGGTGGTGGTTGGTGGAGG - Intronic
1140015121 16:71175093-71175115 GTAGAGTTGGTGGGTGGTGGTGG - Intronic
1140022746 16:71254194-71254216 GCAGGTTTGGTGTCTGGTGGGGG + Intergenic
1140160394 16:72485129-72485151 GAAGCTATGCTGTTTGGTGGCGG - Intergenic
1140389525 16:74573008-74573030 GCAGAATTGGTTGTTGGTGGGGG + Intronic
1140412929 16:74752410-74752432 GGAGGGATGGAGTCTGGTGGGGG - Intronic
1140886572 16:79249510-79249532 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1141676424 16:85520139-85520161 GCAGATGAGGTGTTTGGTGAGGG + Intergenic
1141947947 16:87323208-87323230 GCACAGTTGGTGTTTGGGGCCGG - Intronic
1142171145 16:88623499-88623521 GCAAGGCTGGTGTTTGGTGGGGG - Intronic
1142367138 16:89656726-89656748 GCAGTGATGCTGTTTGGGGCAGG + Intronic
1202992999 16_KI270728v1_random:27911-27933 GGAGAGATGCTGTATGGAGGAGG + Intergenic
1203055845 16_KI270728v1_random:925779-925801 GGAGAGATGCTGTATGGAGGAGG - Intergenic
1143213261 17:5205052-5205074 GCAGATTTGGTGTTTGGTGAGGG - Intergenic
1143570908 17:7757781-7757803 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1143653479 17:8278947-8278969 GGAGAGGTGGTGTGTGGTGACGG - Intergenic
1144001965 17:11063647-11063669 GCAGATGTGGTGTCTGGTGAAGG + Intergenic
1144362543 17:14508942-14508964 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1144901139 17:18591752-18591774 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1146484499 17:33232095-33232117 GAAGTGATGGTATTTGGAGGTGG + Intronic
1146511662 17:33454750-33454772 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1146655294 17:34631399-34631421 GCAGAGAAGGTGCTGGGTGAGGG - Intronic
1147259970 17:39204036-39204058 GAAGAGATGCTGGTTGGTGATGG - Intronic
1148968426 17:51457781-51457803 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1149430462 17:56593164-56593186 GCAGAGCCGGTGTTTGGGGAGGG - Intergenic
1150151404 17:62811746-62811768 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1150650928 17:67009688-67009710 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1151107013 17:71626705-71626727 GCAGAGTTGGTGTCTGGTCAGGG - Intergenic
1151146843 17:72049161-72049183 GCAGATATGGTATCTGGTGAGGG - Intergenic
1151239191 17:72744621-72744643 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1151393879 17:73806946-73806968 GCAGATTTGGTGTTTGTTGAGGG + Intergenic
1151822391 17:76503605-76503627 GTAGAGATGGTGGTGGGCGGTGG + Intergenic
1152567288 17:81106004-81106026 GCATGGATGGTGGTCGGTGGGGG + Intronic
1152891838 17:82886425-82886447 GTAGAGATGGGGTGTGGTCGTGG + Intronic
1153585304 18:6614733-6614755 GCAGATTTGGTGTTTGATGAGGG + Intergenic
1154079798 18:11244929-11244951 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1154305838 18:13230190-13230212 GCAGATCTGGTGTGTGGTGAGGG - Intronic
1157238160 18:45983340-45983362 GCAGAGATGGTGTCTCGCAGAGG + Intergenic
1157716923 18:49894267-49894289 GTAGAGATGGTGGTGGGAGGGGG + Intronic
1157818876 18:50751004-50751026 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1157952231 18:52052595-52052617 GCAGAGATGAAGGTAGGTGGAGG + Intergenic
1158429848 18:57375503-57375525 GCAGAGTTGGTGTCTGGTGAGGG - Intergenic
1158625346 18:59066516-59066538 GCAGATTTAGTGTTTGGTGAAGG + Intergenic
1158847172 18:61456808-61456830 GCAGATCTGGTGTCTGGTGAGGG + Intronic
1158943616 18:62429075-62429097 GCAGATTTGGTGTCTGGTGGGGG - Intergenic
1159007646 18:63026682-63026704 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1160029449 18:75246015-75246037 GGTGAGGTGGTGTTTGCTGGGGG - Intronic
1160098040 18:75893590-75893612 GCTGAGTTGGAGTTGGGTGGGGG + Intergenic
1160173100 18:76570621-76570643 GCAGACATGGCCTTTCGTGGGGG + Intergenic
1160394146 18:78559625-78559647 GCAGGGATGGGGCTGGGTGGTGG - Intergenic
1160632427 18:80255926-80255948 GCTGAGAGTGTGTTTTGTGGTGG - Intergenic
1160912589 19:1481777-1481799 CCAGACCTGGGGTTTGGTGGGGG + Exonic
1161352772 19:3803219-3803241 GGAGAGAGGGTGTGAGGTGGAGG + Intergenic
1161584833 19:5099821-5099843 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1161772507 19:6238744-6238766 GCGGAGAAGGTGTTTGCTGCTGG - Intronic
1162002270 19:7753084-7753106 GTAGAAATGGTGTTTGCTGTGGG - Intergenic
1163728936 19:18938891-18938913 GGGGAGAGGGTGTTTGGTGGGGG + Intronic
1164570516 19:29371351-29371373 GGAGAGACGGTGTTTTGTAGAGG - Intergenic
1164603327 19:29578213-29578235 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1166706936 19:44913223-44913245 GCAGATAGAGTGTTTGGGGGAGG + Intergenic
1166709110 19:44925778-44925800 GCAGATAGAGTGTTTGGGGGAGG + Intergenic
1166902460 19:46076041-46076063 GCAGAGTCAGTGTTTGGTGAGGG + Intronic
1166982265 19:46638379-46638401 GGTGAGATGGTGTGTGGTGCTGG - Intergenic
1167428115 19:49440062-49440084 GCAGTGACGGAGGTTGGTGGTGG - Intronic
1167538886 19:50072939-50072961 GCAGACTTGGTGTCTGGTGAGGG - Intergenic
925233030 2:2252691-2252713 GGAGATGTGGTCTTTGGTGGTGG - Intronic
925630182 2:5883998-5884020 ACAGAGATGCTGTTTGGTACAGG + Intergenic
925657493 2:6165561-6165583 GCTGAGATGGGGTTTGCAGGAGG - Intergenic
925766228 2:7238323-7238345 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
926351851 2:12002795-12002817 GCAGAGTTGGTGTCTGGTGAGGG - Intergenic
926678023 2:15642803-15642825 GAAGAGATGGCATTTGGTGAAGG - Intergenic
926798368 2:16637483-16637505 GCAGACCTGGTGTCTGGTGAGGG - Intronic
927473946 2:23397641-23397663 GCTGAGATGGGGTTGGGTGGAGG + Intronic
927531727 2:23811433-23811455 GCAGATTTGGTGTCTGGTGGGGG - Intronic
928309669 2:30198948-30198970 GCAGAGTTGGTGTCTGATGAGGG + Intergenic
929348467 2:40917515-40917537 GCAGATGTGATGTTTGGTGAAGG + Intergenic
929446284 2:42003901-42003923 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
929581031 2:43082000-43082022 CCAGAGTTGGTGGTTGGAGGGGG + Intergenic
930099514 2:47592009-47592031 GCAGAGATGGTGTGTTGTTTGGG - Intergenic
930272177 2:49269917-49269939 GCAGCCATGGTGTCTGGTGAGGG + Intergenic
931504321 2:62907498-62907520 GCAGATTTGGTGTCTGGTGAGGG + Intronic
931697774 2:64884563-64884585 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
931815858 2:65899886-65899908 GCAGATTTGGTGTTTGATGAGGG + Intergenic
931836524 2:66104829-66104851 GCAGAGATGGTGTTTTTTATGGG - Intergenic
932359300 2:71091394-71091416 GCCGATTTGGTGTTTGGTGAAGG - Intergenic
933341773 2:81034657-81034679 GCAGGGAGGATGATTGGTGGAGG + Intergenic
933881817 2:86677214-86677236 GCAGAGTCAGTGTCTGGTGGGGG - Intronic
933949186 2:87313747-87313769 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
934493996 2:94781954-94781976 GGAGGGATTGTGTTTGGTTGGGG - Intergenic
935179582 2:100677516-100677538 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
935235313 2:101133540-101133562 GCAGATTTGGTGTCTGGTGAGGG + Intronic
935337420 2:102029705-102029727 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
935346486 2:102112835-102112857 CCAGTGATGGTGTTAGGAGGTGG + Intronic
935474223 2:103498464-103498486 GCAGTGATGGTTTAGGGTGGTGG - Intergenic
935730516 2:106061492-106061514 GCAGATTTGGTGTCTGGTGGGGG + Intergenic
935984738 2:108661663-108661685 GAAGAGAGGGCGTTTGCTGGTGG + Intronic
936331011 2:111547850-111547872 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
937139156 2:119583879-119583901 GCAGATTTGGTGTCTGGTGCAGG - Intronic
937262500 2:120595511-120595533 ACAGCCGTGGTGTTTGGTGGAGG + Intergenic
937440993 2:121915935-121915957 ACAGATTTGGTGTCTGGTGGGGG + Intergenic
937797626 2:126042592-126042614 GCAAATTTGGTGTTTGGTGAAGG - Intergenic
938408902 2:131047706-131047728 GCAGTGCTGGAGTGTGGTGGAGG - Intergenic
938556847 2:132432214-132432236 GCAGATTTGGTGTCTGGTGATGG + Intronic
938928690 2:136067082-136067104 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
938945868 2:136211577-136211599 GCAGATTTGGTGTGTGGTGAGGG + Intergenic
939455930 2:142435614-142435636 GCAGATCTAGTGTCTGGTGGAGG + Intergenic
939459835 2:142485746-142485768 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
939489955 2:142865471-142865493 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
939627666 2:144497775-144497797 ACAGAGATGATACTTGGTGGAGG + Intronic
939982891 2:148802071-148802093 ACAGATATGGTGTTTGGTGAGGG + Intergenic
939988210 2:148853015-148853037 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
940038875 2:149338612-149338634 GCAGATCTGGTGTCTGGTGAGGG - Intronic
940327124 2:152437003-152437025 GCAGATCTGGTGTCTGGTGAAGG + Intronic
940377929 2:152978317-152978339 TCAGAGATTGTGTTTGGTGAAGG + Intergenic
940514657 2:154666759-154666781 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
941620224 2:167769300-167769322 GCATGGAAGGTGTTTGGAGGGGG - Intergenic
941835981 2:170021383-170021405 GCAGATTTGGTGTCTGGTGAGGG + Intronic
942103960 2:172614176-172614198 GCAGGGATGGGGGTTGGGGGGGG - Intergenic
942683152 2:178500526-178500548 GCTGAGATGCTGTTAGGTGGTGG + Intronic
943389319 2:187243990-187244012 GCAGATCTGGTGTCTGGTGAAGG + Intergenic
943719479 2:191188860-191188882 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
944005744 2:194903198-194903220 CAAGTGATGGTGTTTGGAGGTGG + Intergenic
944150723 2:196555265-196555287 GCAGATTTGGTGTCTGGTGAGGG + Intronic
944171353 2:196782246-196782268 GCAGATTTGGTGTCTGGTGAGGG - Intronic
944754787 2:202750061-202750083 GCAGGGTTGGTATTTGGTTGAGG + Intronic
944783728 2:203046585-203046607 GCAGATTTGGTGTCTGGTGAGGG + Intronic
945164901 2:206932900-206932922 GCAGATTCGGTGTTTGGTGAGGG + Intergenic
945765381 2:213970001-213970023 GCAGATTTGGTGTTTGGTGAGGG + Intronic
946218555 2:218205916-218205938 GAAGATTTGGTGTTTGGTGAGGG + Intergenic
946484484 2:220088150-220088172 GCAGGGTTGGTGTCTGGTGAGGG - Intergenic
947158401 2:227186873-227186895 GCAGATTTGGTGTCTGGTGAGGG + Intronic
947950455 2:234142594-234142616 GCAGTGTTGGTGTCTGGTGAGGG - Intergenic
948097314 2:235346761-235346783 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
948680965 2:239634388-239634410 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
948752903 2:240142769-240142791 GCAGTGATGGTGTTGGACGGTGG + Intronic
948783144 2:240337287-240337309 GGGGACATGGGGTTTGGTGGAGG - Intergenic
1168865367 20:1081422-1081444 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1168884089 20:1233025-1233047 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1169011674 20:2256303-2256325 GCAGGGAGGGTGAGTGGTGGAGG - Intergenic
1169652793 20:7888354-7888376 GCAGAAGTTGTGTTTGGGGGAGG - Intronic
1170483794 20:16794543-16794565 GCAGAAATGGTTTGTGCTGGGGG + Intergenic
1170542251 20:17401321-17401343 GCAGATGTGGTGTCTGGTGAAGG + Intronic
1170555220 20:17509319-17509341 GCAGAATTGGTGTCTGGTGAGGG - Intronic
1170663089 20:18361564-18361586 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1170684704 20:18559063-18559085 ACAGGGAAGGTGGTTGGTGGGGG + Intronic
1170766006 20:19290556-19290578 GCAGGCTTGGTGTCTGGTGGAGG - Intronic
1171061588 20:21968732-21968754 GCAGATTTGGTGTCTGGTGATGG - Intergenic
1171948131 20:31396713-31396735 GCTGAGCTCGTGGTTGGTGGAGG - Intergenic
1172055636 20:32152515-32152537 GCAGAGATGGGGGTGGGAGGGGG - Intronic
1172217892 20:33249385-33249407 GAAGTGATGGTGTTGGGAGGTGG - Intergenic
1173536740 20:43820539-43820561 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1173676054 20:44836523-44836545 GCAGAGATGCTGGTTATTGGAGG + Intergenic
1173749565 20:45466799-45466821 GCAGAGAGGGAGGATGGTGGTGG + Intergenic
1173823624 20:46033662-46033684 GAAGAGAAGGAGTTTGGAGGTGG - Intronic
1174590848 20:51643603-51643625 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1174958972 20:55133839-55133861 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1175079518 20:56407518-56407540 GGAGAGAGGGTGTCTGGTGTTGG + Intergenic
1175415793 20:58800230-58800252 GCAGAGAGGGTGGCTGGTGCAGG - Intergenic
1175486078 20:59347340-59347362 GCAGACTTGGTGCATGGTGGTGG - Intergenic
1175680991 20:60988771-60988793 GCAAATATGGTGTCTGGTGAGGG - Intergenic
1176047094 20:63098371-63098393 TCAGAGCTGCTGTTTTGTGGGGG - Intergenic
1176920585 21:14683436-14683458 GCAGAGTTGGTGTCTGATGTGGG - Intergenic
1177036278 21:16047146-16047168 GTTGAGTTGGTGTTTGGTGAGGG + Intergenic
1178237538 21:30859772-30859794 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1178910361 21:36668901-36668923 GCTGAGATGGGGCTTGGTGGGGG - Intergenic
1179261907 21:39764962-39764984 GCAGAGTTGGTTTTTTATGGAGG + Intronic
1179960633 21:44765389-44765411 GCAGAGTTGGCGTGGGGTGGCGG - Intergenic
1180115834 21:45704352-45704374 GGAAACATGGTGGTTGGTGGGGG + Intronic
1180616149 22:17129132-17129154 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1181460544 22:23083554-23083576 GCAGAGCTGGTGCTTGGGGGAGG + Intronic
1181528152 22:23501864-23501886 GCAGAGGTGGTGGGTGGAGGTGG - Intergenic
1181725256 22:24806645-24806667 GCAGCGAGGGAGTTTGGGGGTGG + Intronic
1182447242 22:30397082-30397104 GCGGGGATGGGGTTTGGGGGCGG - Exonic
1182695430 22:32195944-32195966 GGAGAAATGGGCTTTGGTGGAGG - Intronic
1182835918 22:33341266-33341288 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1182934622 22:34209363-34209385 GCAGAGATGGTGTATGTTTTAGG + Intergenic
1182943150 22:34297531-34297553 GCAAAGACGCTTTTTGGTGGAGG - Intergenic
1183193073 22:36334303-36334325 GCAGCCATGGTGTTGGGTGGTGG + Intronic
1183349603 22:37327510-37327532 GCAGTTTGGGTGTTTGGTGGAGG - Intergenic
1184197139 22:42937486-42937508 TCAGAGGTGGACTTTGGTGGTGG - Intronic
1184722800 22:46325097-46325119 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1184749999 22:46479824-46479846 GCAGAAATGGTATTTGGTAACGG + Intronic
1184888433 22:47363752-47363774 GTAGAGATGGGGTTTGCGGGGGG + Intergenic
1184912269 22:47543970-47543992 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1185146589 22:49140271-49140293 GCAGACATTGTGCTTGGTGTTGG - Intergenic
949234843 3:1795675-1795697 GCAGATTTGGTGTTTGGTGAGGG - Intergenic
949237832 3:1832006-1832028 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
949256559 3:2054107-2054129 GCAGATCTGGCGTTTGGTGAGGG - Intergenic
949697631 3:6717608-6717630 GCAGAGCTGGTGGCTGGTGAGGG - Intergenic
949787083 3:7753573-7753595 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
950069313 3:10139463-10139485 ACAGAGATGGTGTATCCTGGTGG - Intergenic
950688867 3:14639742-14639764 GCAGAATTGGTGTTTGGTGAGGG + Intergenic
950801231 3:15553205-15553227 GCAAGGATGATGATTGGTGGAGG + Intergenic
950978485 3:17276139-17276161 GCAGAGCTGGTGTCTGGTAAGGG + Intronic
951319875 3:21231405-21231427 GCAGATTTAGTGTTTGGTGAGGG - Intergenic
951362102 3:21737578-21737600 GCACCTATGGTGGTTGGTGGGGG + Intronic
952118680 3:30215538-30215560 GCAGAGATGGGGTTTTGGTGTGG + Intergenic
952631261 3:35470741-35470763 CCAGAGATGGTGTAGGGTGATGG - Intergenic
952664551 3:35888239-35888261 GCACAGCTGGTGTCTGGTGAAGG - Intergenic
952815584 3:37444430-37444452 GCAGAGTTGGTGTCTGGTGAGGG - Intergenic
952834767 3:37593483-37593505 GCATAGTTGGTGTGTGGTGTGGG + Intronic
952883507 3:37999279-37999301 GCGGAGATGGTGTTGGGGGGGGG + Intronic
952893492 3:38060548-38060570 GCTGAGAAGGTGTTTGGGGTGGG + Intronic
953827292 3:46264899-46264921 GCAGAAATGTTGTGGGGTGGTGG - Intronic
954140582 3:48603119-48603141 TCAGAGTTGGAGTTTGGGGGAGG - Intronic
954272818 3:49522959-49522981 GCAGTGTTGGTGTTTGGTGTTGG + Intronic
954977062 3:54706225-54706247 GCTGAGATGGAGTTTGGGGATGG + Intronic
955289746 3:57680507-57680529 GCTGATATGGGGTTTGGTGAGGG - Intronic
955466605 3:59243477-59243499 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
956139999 3:66137175-66137197 GTAGATTTGGTGTTTGGTGAAGG - Intronic
956318122 3:67962196-67962218 GTAGTGGTGGTGCTTGGTGGGGG + Intergenic
956417990 3:69053014-69053036 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
956487970 3:69741172-69741194 GCATAGATTGTGTGTGTTGGGGG + Intronic
956582147 3:70826023-70826045 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
956914642 3:73858527-73858549 GCAGATTTGGTGTCTGGTGGGGG + Intergenic
957839167 3:85644149-85644171 GCAGCGTTGGTGTCTGGTGAGGG + Intronic
959021337 3:101190756-101190778 GCTGAGATGAGGTTTGGAGGAGG + Intergenic
960117476 3:113911031-113911053 GCAGAGTTGGTTTCTGGTGAGGG + Intronic
960169487 3:114442004-114442026 CCAAAGCTCGTGTTTGGTGGGGG + Intronic
960567999 3:119156070-119156092 ACAGAGCTAGTGATTGGTGGTGG - Intronic
961409883 3:126712641-126712663 GCAGAGACGGTGGTTGATGCTGG - Intronic
961776047 3:129286361-129286383 GCAGATTTGGTGTCTGGTGAGGG - Intronic
961843377 3:129737574-129737596 GCAGATTTGGTGTCTGGTGAAGG - Intronic
961993373 3:131215758-131215780 GCAGAGGTGGGGATTGGTGATGG + Intronic
962013984 3:131421838-131421860 GCAGAGATGGGGAATGCTGGAGG + Intergenic
962016649 3:131447878-131447900 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
963262330 3:143205563-143205585 GCAGATTTGGTGTTTGTTGAGGG + Intergenic
963462796 3:145638227-145638249 GCAGAGTTGGTGTCTGGTGAGGG - Intergenic
963731559 3:148978945-148978967 GCAGAGATAGTGTTTGGTGACGG - Intergenic
964027620 3:152096815-152096837 GCAGAAATGTTATTTGGTGGGGG - Intergenic
964417896 3:156468813-156468835 GCAGGGATGCTGTTTGGGTGAGG - Intronic
964626184 3:158762279-158762301 GCAGATTTGGTGTCTGGTGAGGG - Intronic
964850149 3:161087444-161087466 GGAGAGGTGGTGTTTGGGGCAGG - Intronic
965733874 3:171800764-171800786 GCAGATTTGGTGTCTGGTGAAGG + Intronic
965876683 3:173331627-173331649 GCAGGTCTGGTGTTTGGTAGGGG + Intergenic
966358149 3:179104189-179104211 GCAGATTTGGTGTCTGGTGATGG + Intergenic
966583341 3:181593212-181593234 GCAGAGTTGATGTTTGGTAAGGG + Intergenic
966750960 3:183321928-183321950 GCAGATTTGGTGTCTGGTGGAGG + Intronic
966803922 3:183790941-183790963 CCAGAGATGGGGTTTGGTGTAGG - Exonic
967013104 3:185457423-185457445 GCAGAGTTGGTGTCTGGTGAGGG + Intronic
967248388 3:187512450-187512472 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
968266064 3:197364314-197364336 TCAGGGATGGCGTGTGGTGGGGG + Intergenic
968895478 4:3399435-3399457 GTAGAGATGGTGTTTTGTCCAGG - Intronic
968947419 4:3672641-3672663 GCAGATATGGTGTGTGGTGAGGG + Intergenic
969088120 4:4671602-4671624 GCCAAGATGCTGTTTGGAGGAGG - Intergenic
969661168 4:8529065-8529087 GGAGAGTTGGTGTCTGGTGAGGG + Intergenic
970096678 4:12471536-12471558 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
970205493 4:13651517-13651539 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
970225749 4:13855282-13855304 GCAGATTTGGTGTTGGGTGAAGG - Intergenic
970805259 4:20023589-20023611 GCAGGTTTGGTGTTTGGTGAGGG + Intergenic
970974222 4:22024467-22024489 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
971190202 4:24420889-24420911 GCAGATATGGTGTCTGGTGAGGG + Intergenic
971450796 4:26799711-26799733 GCAGTTTTGGTGTTTGGTGAGGG - Intergenic
971511318 4:27428738-27428760 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
972165989 4:36284775-36284797 GCAGATTTGGTGTCTGGTGAGGG + Intronic
972181631 4:36474073-36474095 GCAGATCTGATGTTTGGTGAGGG + Intergenic
972379650 4:38507568-38507590 GCAGATATGGTGTCTGGTGAGGG + Intergenic
972382031 4:38527910-38527932 GCAGATTTGGTGATTGGTGAGGG - Intergenic
972515152 4:39804676-39804698 ACATTGGTGGTGTTTGGTGGTGG - Intergenic
972914695 4:43861094-43861116 GCAGATTTGGTGTATGGTGAGGG - Intergenic
973152099 4:46900794-46900816 GCAGATTTGGTGTCTGGTGAGGG - Intronic
973659576 4:53089062-53089084 GCAGATTTGGTGTCTGGTGAGGG - Intronic
973762673 4:54133969-54133991 GCAGATTTGGTGTCTGGTTGAGG + Intronic
974068652 4:57104006-57104028 CCAGAGATGGGGTTGGGAGGAGG - Intronic
974083997 4:57240142-57240164 GTAAAGATGGGGGTTGGTGGTGG - Intergenic
974331449 4:60484049-60484071 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
974598780 4:64048395-64048417 GCAGATTTGATGTTTGGTGATGG - Intergenic
974637374 4:64582588-64582610 GCAGATTTGGTGTCTGGTGATGG + Intergenic
975805048 4:78103429-78103451 TCAGAGGTGGGGTGTGGTGGAGG + Intronic
976295901 4:83471718-83471740 CCAGGCATGGTGTGTGGTGGCGG + Intronic
976738908 4:88338872-88338894 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
977709897 4:100112803-100112825 CCAGATTTGGTGTTTGGTGAGGG - Intergenic
978855517 4:113389790-113389812 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
979071226 4:116209196-116209218 GCAGATTTTGTGTTTGGTGATGG - Intergenic
979151474 4:117321449-117321471 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
979157265 4:117412077-117412099 GCAGATTTGGTATTTGGTGAGGG - Intergenic
979160696 4:117457125-117457147 ACAGAGATGGTGTTATCTGGGGG - Intergenic
979446532 4:120820288-120820310 GCAGATTTGGTGTCTGGTGAGGG - Intronic
979915839 4:126432159-126432181 GAAGAGGTGGGGTGTGGTGGTGG + Intergenic
980900745 4:138902735-138902757 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
981102674 4:140847392-140847414 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
981260425 4:142712144-142712166 GCAGATTTGGTGTCTGGTGAGGG - Intronic
981301566 4:143192587-143192609 GCAGATTTGGTGTCTGGTGAGGG + Intronic
981407120 4:144385003-144385025 GCAGCGGGGGTGTGTGGTGGGGG + Intergenic
981422154 4:144563521-144563543 GCAGATATGGTGTCTAGTGAGGG + Intergenic
981698494 4:147582811-147582833 GCAAAGTTGGTGTCTGGTGAGGG + Intergenic
982666036 4:158264856-158264878 GGTGAGAGGGTGTGTGGTGGGGG - Intergenic
982832720 4:160084600-160084622 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
983827854 4:172286690-172286712 GCAGCGATGGTGGTTGGGGGAGG + Intronic
985025340 4:185734419-185734441 CCAGAGTTGGTTTTAGGTGGGGG + Intronic
985213556 4:187622681-187622703 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
985931026 5:3057986-3058008 GCAGATTTGGGGTTTGGTGGAGG + Intergenic
986448752 5:7846425-7846447 GCAGATTTGGTGTCTGGTGAGGG + Intronic
986830322 5:11569874-11569896 GCAGATTTGGTGTCTGGTGAGGG - Intronic
987141369 5:14950355-14950377 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
987432677 5:17855563-17855585 AGAGAGAAGGTGTGTGGTGGAGG - Intergenic
987544169 5:19290822-19290844 GCAGATTTGGTGTCTGGTGTGGG + Intergenic
988406915 5:30835672-30835694 GCAGATTTAGTGTTTGGTGAGGG - Intergenic
988786295 5:34568463-34568485 GCAAAGAAGGTATTTGATGGAGG - Intergenic
989428602 5:41325873-41325895 GTAGATTTGGTGTTTGGTGAGGG + Intronic
989439543 5:41454367-41454389 GCAGATTTGGTATTTGGTGAGGG + Intronic
990354450 5:54952116-54952138 GCAGATTTGGTGTCTGATGGGGG + Intergenic
991058152 5:62342229-62342251 GTAGAGATGGTGATTGATGCGGG + Intronic
991202890 5:64014746-64014768 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
991601100 5:68351912-68351934 GCTGTGATGGGGATTGGTGGGGG - Intergenic
992357357 5:75999792-75999814 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
992646988 5:78820164-78820186 GCAGATTTGGTGTCTGGTGAGGG - Intronic
992862978 5:80930677-80930699 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
993558811 5:89377415-89377437 GTTGAGATGGAGGTTGGTGGGGG - Intergenic
993780929 5:92064320-92064342 GCTGAGAAGGTGTTTGCTGTAGG + Intergenic
994153185 5:96473553-96473575 GCAGAGGTGATGTCTGGTGTTGG - Intergenic
994999318 5:107106874-107106896 GAAGAGATTGTGTCTGGTGAGGG - Intergenic
995103310 5:108343097-108343119 GCAGGTTTGGTGTTTGGTGAGGG - Intronic
995336252 5:111002927-111002949 GCAGAGTTGGTGTCTGGTGAGGG - Intergenic
995365209 5:111351911-111351933 GCAGATTTGGTGTTTGATGAGGG + Intronic
995784408 5:115813897-115813919 GCAGTGGTGGTGGTTGGTTGTGG - Intronic
996042939 5:118836798-118836820 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
996683581 5:126255678-126255700 GCAGACTTGGTGTCTGGTGAAGG + Intergenic
996758814 5:126966177-126966199 GCAAAGTGGGTGTTGGGTGGGGG + Intronic
997242375 5:132316964-132316986 GCAGGGTTGGTGTCTGGTGAGGG + Intronic
997318137 5:132955007-132955029 GCAGAGATTGTATTGAGTGGTGG + Intronic
997622735 5:135309389-135309411 ACAGAGATGGCCTTGGGTGGTGG + Intronic
997997313 5:138597140-138597162 GCCCAGATGGTATTTGGAGGTGG + Intergenic
998037301 5:138927806-138927828 GTAGAGATGATGTTAGGAGGTGG + Intronic
998132097 5:139656326-139656348 GCAGGGGTGGTGTCAGGTGGGGG + Intronic
998630174 5:143889336-143889358 ACAAAGATGGTGTATGCTGGTGG - Intergenic
999443540 5:151621014-151621036 GCAGAGGTGGGGGGTGGTGGAGG + Intergenic
999481189 5:151949605-151949627 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
999805799 5:155080164-155080186 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1000136970 5:158362439-158362461 GAAGATTTGGTGTTTGGTGAGGG + Intergenic
1000149828 5:158488877-158488899 GGAGAGATGGAGTCTGCTGGTGG + Intergenic
1000456271 5:161453532-161453554 GCAGATATGGTGTCTGATGAGGG - Intronic
1000476641 5:161716299-161716321 GCAGATTTGGTGTTTGGTTTGGG + Intergenic
1001031816 5:168268812-168268834 CCAGAGATGAGGTTTGTTGGAGG + Intergenic
1001195115 5:169666115-169666137 GCAGATCTGGTTTCTGGTGGGGG + Intronic
1001551931 5:172609055-172609077 GCTTTGATGCTGTTTGGTGGAGG + Intergenic
1002610018 5:180411214-180411236 GCAGATTTGGTGTTTGGTGAGGG + Intergenic
1003380784 6:5622700-5622722 GCAGATTTGGTGTCTGGTGAAGG - Intronic
1003687603 6:8320117-8320139 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1003709689 6:8575559-8575581 GCAGATTTGGTGTTTGATGAGGG + Intergenic
1004086549 6:12455025-12455047 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1004564601 6:16784314-16784336 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1004572717 6:16863381-16863403 GCAGAGTTTGGGTTTGGGGGTGG + Intergenic
1004997745 6:21210482-21210504 GCAGATTTGGTGTCTGGTGGGGG - Intronic
1005404394 6:25470673-25470695 GCAGACTTGGTGTCTGGTGAGGG + Intronic
1005702119 6:28412569-28412591 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
1005995242 6:30926871-30926893 GATGAGATGGTGTTTGGCGTGGG - Intergenic
1006207177 6:32357689-32357711 TCAGAGATGGGATTTGATGGTGG + Intronic
1006814819 6:36843004-36843026 GCAGGTATGGTGTCTGGTGAGGG + Intergenic
1007145409 6:39625098-39625120 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1007165819 6:39828277-39828299 GCAGAGTTGTTGTCTGGTGAGGG + Intronic
1007283268 6:40728505-40728527 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1007364320 6:41380411-41380433 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1007442326 6:41873148-41873170 GCAGAGCTGGGATTAGGTGGGGG + Intronic
1007674615 6:43582710-43582732 GTAGAGATGGGGATTGGTTGGGG + Intronic
1007840722 6:44713945-44713967 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
1008147772 6:47912282-47912304 ACTGGGATGGGGTTTGGTGGGGG - Intronic
1008189040 6:48431784-48431806 CCAGATTTGGTGTCTGGTGGAGG - Intergenic
1008706431 6:54165977-54165999 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1009403366 6:63282441-63282463 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1009746202 6:67819723-67819745 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1010069483 6:71726507-71726529 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1010339589 6:74732613-74732635 GCAGATTTGGTGGCTGGTGGTGG - Intergenic
1010652965 6:78477681-78477703 GGAGATTTGGTGTCTGGTGGGGG + Intergenic
1011073269 6:83409121-83409143 GCAAATTTGGTGTTTGGTGAGGG - Intronic
1011545679 6:88479376-88479398 GCAGTGATGGCGATTGCTGGGGG - Intergenic
1011552876 6:88546154-88546176 GCAGAGAGGCAGTTTGGTGGAGG + Intergenic
1013025097 6:106263486-106263508 GCAGAGCTGGTGTTCTGTGCTGG - Intronic
1013590110 6:111612637-111612659 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1013775121 6:113670819-113670841 GCAGAGTGGGGGTTTGCTGGAGG + Intergenic
1013911482 6:115281014-115281036 GCAGATTTGGTGTCTGGTGGGGG + Intergenic
1014879145 6:126700875-126700897 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1015499261 6:133914962-133914984 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1015565205 6:134563052-134563074 CCAGTGAAGGTCTTTGGTGGAGG + Intergenic
1015634596 6:135263259-135263281 GCAGATTTGTTGTTTGGTGGGGG + Intergenic
1015719717 6:136228500-136228522 GCAGATTTGGTGTCTGGGGGTGG - Intergenic
1016276698 6:142361445-142361467 GCAGAGGTGGTGCTTGGAGAGGG + Intronic
1016363745 6:143294022-143294044 GCAGAAATGATGTTTGTAGGGGG - Intronic
1017419201 6:154256168-154256190 GCAGAGCTGGTGCCTGGTGAGGG + Intronic
1017617145 6:156257723-156257745 GCAGACTTGGTGTCTGGTGAGGG - Intergenic
1017696018 6:157017136-157017158 GCAGAAGTTGTGTTTGGTGTAGG - Intronic
1017854204 6:158334912-158334934 GCAGAGATGGTGTCTGGTGAAGG - Intronic
1017985689 6:159441481-159441503 GCAGGGCTGGTCTTAGGTGGTGG - Intergenic
1018066628 6:160129105-160129127 GAACAGAGGGTGTTGGGTGGAGG - Intronic
1018537369 6:164835802-164835824 GCAGATATTGTGTTTGATGAGGG + Intergenic
1019085498 6:169471855-169471877 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1019234304 6:170596926-170596948 GCTGAGAGTGTGTTTTGTGGTGG - Intergenic
1019372831 7:671964-671986 TTAGAGATGGTGTGTGGTGAAGG - Intronic
1019595025 7:1854470-1854492 GCAGACTTGGTGTTTGGTGATGG + Intronic
1019883641 7:3885031-3885053 GCAGAGATGGGGCGGGGTGGGGG - Intronic
1020534544 7:9379227-9379249 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1020580685 7:9996092-9996114 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1021824028 7:24529942-24529964 GCAAATTTGGTGTTTGGTGAGGG + Intergenic
1021866275 7:24961613-24961635 GCAGATCTGGTGTCTGGTGAGGG - Intronic
1021891780 7:25193645-25193667 GCAAAGAGGGTGTTTGGTTTGGG - Intergenic
1022421706 7:30229701-30229723 GCAGGATTGGTGTCTGGTGGGGG + Intergenic
1022934995 7:35165767-35165789 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1022992551 7:35722756-35722778 GCAGAGCTGGTGTCTGGTGAGGG + Intergenic
1023270000 7:38452089-38452111 ACCGTGATGGTGCTTGGTGGAGG + Intronic
1023356137 7:39369246-39369268 ACAGAGGTGGTGGTTGCTGGAGG - Intronic
1023990642 7:45126353-45126375 GAAGAGACAGTGTATGGTGGCGG + Intergenic
1024180704 7:46891210-46891232 GCAGATATGGTCTCTGGTGAGGG - Intergenic
1024441358 7:49422084-49422106 GCAGGGATGGTGTTTGGTAAGGG - Intergenic
1024483973 7:49895134-49895156 GCAGATTTGGTGTTTGGAGAGGG + Intronic
1024781878 7:52860588-52860610 ACAGCTAAGGTGTTTGGTGGGGG - Intergenic
1024880981 7:54084791-54084813 GCAGACATGGGGTTTAGTAGTGG - Intergenic
1025061368 7:55811404-55811426 GGAGCCATGGTGTTGGGTGGAGG + Intronic
1026122437 7:67549751-67549773 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1026249017 7:68650813-68650835 AAAGAGATGGTATTTGGAGGGGG + Intergenic
1026630303 7:72032241-72032263 GCAGAGATGGGGTTTCATCGTGG + Intronic
1026720990 7:72830348-72830370 GTAGAGATGGTGTTTCATGTTGG - Intergenic
1027307659 7:76918287-76918309 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1027703330 7:81496857-81496879 GCAGATCTGGTGTCTGGTGAGGG - Intergenic
1027834819 7:83227463-83227485 GCAGATTTGGTGTCTGGTGTGGG - Intergenic
1028672538 7:93419848-93419870 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1029029708 7:97454650-97454672 GCAGATTTGGTGTTTGGTGAAGG - Intergenic
1029455727 7:100670823-100670845 GCAGAGATGGGGTTTCATGTTGG - Intergenic
1029505866 7:100963774-100963796 GCGGAGGCGGTGTTGGGTGGGGG + Intronic
1029830945 7:103258532-103258554 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1029949100 7:104563738-104563760 GCAGATCTGGTGTGTGGTGAGGG - Intronic
1030088722 7:105838948-105838970 GCAGAGATGATGCTTCGTGAAGG - Intronic
1030090538 7:105854060-105854082 GCAGAGATGGGCTCTGGGGGTGG - Intronic
1030385933 7:108868366-108868388 GCAGATATGGTGTCTGGGGAGGG + Intergenic
1031642128 7:124178280-124178302 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1031718091 7:125133783-125133805 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1031774188 7:125885733-125885755 GCAGATTTGGTGTCTGGTGTGGG - Intergenic
1031992196 7:128205865-128205887 TAAGAGATGGTGGCTGGTGGAGG + Intergenic
1032741715 7:134746329-134746351 GCAGATTTGGTGTCTGGTGCAGG - Intronic
1033493762 7:141872224-141872246 GCATATGTGGTGTCTGGTGGTGG + Intergenic
1033639304 7:143245810-143245832 GCAGATATGGTGTCTGATGAGGG - Intronic
1033898718 7:146109461-146109483 GCAGATGTGGTGTCTGGTGAGGG - Intergenic
1034174454 7:149090194-149090216 GTTGAAATGGTGTTTGGCGGGGG - Intronic
1034309381 7:150073076-150073098 GAAGCGATGGTGTTAGGAGGTGG + Intergenic
1034797477 7:154027564-154027586 GAAGCGATGGTGTTAGGAGGTGG - Intronic
1034881386 7:154765282-154765304 GGAGAACTGGTATTTGGTGGGGG - Intronic
1034889805 7:154829818-154829840 GCAGAGATGGTGTTTGGTGGTGG - Intronic
1034901598 7:154911099-154911121 GCAGAGAAAGAGTTTAGTGGCGG - Intergenic
1034992237 7:155555202-155555224 GCAATGATGGTGTTTGGCTGAGG + Intergenic
1035077064 7:156186926-156186948 GCAGATGTGGTGTCTGGTGAGGG - Intergenic
1035251870 7:157603149-157603171 GCAGTGATGGTGGCAGGTGGCGG - Intronic
1035388821 7:158491426-158491448 GCAGAGATTGTTTTTGGTTTGGG + Intronic
1035825172 8:2637278-2637300 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1036069691 8:5426981-5427003 GCTTAGATGGTGTATTGTGGTGG + Intergenic
1036110124 8:5889721-5889743 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1036478221 8:9113912-9113934 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1036559737 8:9891283-9891305 GCGGTGATGGTGTTAGGAGGTGG + Intergenic
1036677555 8:10847544-10847566 GCAGAATTGGTGTCTGGTGAGGG - Intergenic
1036705093 8:11040623-11040645 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1037407444 8:18558067-18558089 GCAGAGTTGGTGTCTGGTGAGGG - Intronic
1037530879 8:19772177-19772199 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1039290435 8:36088827-36088849 GCAGAGATTTTGTTGAGTGGTGG + Intergenic
1039329716 8:36523863-36523885 GGGGAGGGGGTGTTTGGTGGTGG - Intergenic
1039349927 8:36752883-36752905 TCAGAGGTGGTGTATGGTGGAGG - Intergenic
1039478692 8:37855777-37855799 GTAGAGATGGTGGTGGGGGGCGG + Intergenic
1039774529 8:40722690-40722712 GCAGGGAGGGTGTTTGTTGGTGG - Intronic
1040433633 8:47368052-47368074 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1041036800 8:53799864-53799886 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1041181795 8:55256935-55256957 GCAGATGTGGTGTCTGGTGAGGG + Intronic
1041461758 8:58119309-58119331 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1041658200 8:60375226-60375248 GCAGATTTGGTATTTGGTGAGGG - Intergenic
1041748039 8:61230836-61230858 GCAGACTTGGTGTCTGGTGAGGG + Intronic
1041895935 8:62924797-62924819 GCAGACTTGGTGTCTGGTGAGGG + Intronic
1041903306 8:63006384-63006406 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1041909329 8:63071800-63071822 GCAGATTTGGTGTTTGGTGAGGG - Intronic
1041929664 8:63272807-63272829 GTAGAGACGGTGGGTGGTGGTGG + Intergenic
1042400534 8:68341139-68341161 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1042407619 8:68423415-68423437 GCTGAGATGGTCTCAGGTGGAGG - Intronic
1042422297 8:68605945-68605967 GCAGAGGTGGTGTGTGTGGGGGG + Intronic
1043056233 8:75443175-75443197 GCAGATTTGGTGTCTGGTGAAGG - Intronic
1043138403 8:76557217-76557239 GTAGAGTTGGTGTCTGGTGAGGG - Intergenic
1044676670 8:94736065-94736087 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1044738574 8:95303173-95303195 GCAGATTTGGTGTCTGGTGGAGG + Intergenic
1044868753 8:96598061-96598083 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1045203372 8:100010543-100010565 GCAGAAATTGTGATTGTTGGGGG - Intronic
1045495695 8:102706508-102706530 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1045546630 8:103134979-103135001 GCAGACTTGGTGTCTGGTGAGGG - Intronic
1045575315 8:103414622-103414644 GAGGAAATGGTGCTTGGTGGAGG - Intronic
1045765273 8:105660302-105660324 GCTGAGATGGAGTTTGGCTGGGG - Intronic
1046308612 8:112403538-112403560 GCAGATGTAGTGTTTGGTGAGGG + Intronic
1046396754 8:113650337-113650359 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1046498921 8:115050057-115050079 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1046604051 8:116351045-116351067 GTGGAGATGGTGGTGGGTGGGGG - Intergenic
1046646078 8:116787116-116787138 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1046724635 8:117661041-117661063 GCTGATTTGGTGTTTGGTGAGGG - Intergenic
1046736585 8:117782623-117782645 GCAGATTTGGTGTTTGGGCGGGG - Intergenic
1047017423 8:120738188-120738210 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1047827773 8:128596114-128596136 GCACATCTGGTGTTTGGAGGAGG + Intergenic
1048428446 8:134344375-134344397 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1048533095 8:135268444-135268466 ACAGAGATGGTCTGTGGAGGTGG + Intergenic
1048835006 8:138510598-138510620 GAAGATGTGGTGTCTGGTGGGGG + Intergenic
1048997590 8:139804106-139804128 GTGGTGGTGGTGTTTGGTGGTGG - Intronic
1048997621 8:139804211-139804233 GTGGTGATGGTGCTTGGTGGTGG - Intronic
1048997630 8:139804243-139804265 GTGGTGGTGGTGTTTGGTGGTGG - Intronic
1048997665 8:139804376-139804398 GTGGTGGTGGTGTTTGGTGGTGG - Intronic
1048997677 8:139804423-139804445 GTGGTGATGGTGCTTGGTGGCGG - Intronic
1048997688 8:139804471-139804493 GTGGTGGTGGTGTTTGGTGGTGG - Intronic
1048997772 8:139804771-139804793 GCGGCGGTGGTGCTTGGTGGTGG - Intronic
1049072915 8:140370861-140370883 GCAGACATCGTGGTTGGTGCTGG - Intronic
1049305668 8:141902609-141902631 GCAGAGGTGGTGGCTGGTTGGGG - Intergenic
1049636170 8:143690745-143690767 GCAGATCTGGTTTCTGGTGGGGG + Intronic
1050149491 9:2605168-2605190 GCAGATTTGGTGTCTGGTGTGGG - Intergenic
1050260689 9:3837977-3837999 GGAGAGATTGTGTGTGGAGGGGG + Intronic
1050367264 9:4884197-4884219 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1050665154 9:7927522-7927544 GCAGATTTGGTGTCTGGTGAAGG + Intergenic
1050665527 9:7932115-7932137 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1050683476 9:8140840-8140862 GATGAGAAGGTGTTTGCTGGAGG + Intergenic
1050802986 9:9638809-9638831 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1051138303 9:13949637-13949659 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1051178975 9:14390780-14390802 GCAGATTTGATGTGTGGTGGGGG - Intronic
1051973805 9:22924137-22924159 GCTCAGGTGCTGTTTGGTGGTGG - Intergenic
1052027425 9:23589049-23589071 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1052376964 9:27728502-27728524 GCAGAGAAGGTGGTGGGTGTGGG + Intergenic
1053102557 9:35383010-35383032 GAAGAGAAGGTGGTTGGGGGTGG + Intronic
1053258487 9:36640316-36640338 GCAGATTTGGTGTTTGATGAGGG + Intronic
1054891209 9:70253791-70253813 GCAGATTTGGTGTGTGGTGAGGG - Intergenic
1054924928 9:70579588-70579610 GGAGAGATGGGGTTTGGAGGAGG + Intronic
1055179875 9:73372738-73372760 GCAAAGATGGTCTCTGTTGGAGG - Intergenic
1055702975 9:78966309-78966331 GCAGAATTGGTGTCTGGTGAAGG - Intergenic
1055731533 9:79283432-79283454 ACAGATTTGGTGTTTGGTGAGGG - Intergenic
1056335549 9:85565013-85565035 GCTGATTTGGTGTTTGGTGAGGG - Intronic
1056423322 9:86451698-86451720 GCAGGTTTGGTGTTTGGTGAAGG + Intergenic
1056579219 9:87878224-87878246 GCAGATTTGGTGTCTGGTGGGGG - Intergenic
1056703023 9:88926287-88926309 GCATAGATAGTGTTTGGTAGGGG - Intergenic
1056761131 9:89415643-89415665 GCAGATTTGGTGTCTGGTGAAGG - Intronic
1056782145 9:89558705-89558727 GCAGGTATGGTGTCTGGTGAGGG + Intergenic
1057495201 9:95555019-95555041 GCAGAGCAGGTGTCTGGTGAGGG - Intergenic
1057705432 9:97392031-97392053 GAAGAGATAGTGTTAGGGGGTGG + Intergenic
1057724808 9:97560987-97561009 GCAGAGAAGCTGTTGGGAGGGGG + Intronic
1058783418 9:108362380-108362402 GCAGATTTGGTGTTTGGAGAGGG - Intergenic
1059207378 9:112479547-112479569 GCAGATTTGGTGTCTGGTGGAGG - Intronic
1059686040 9:116637044-116637066 GCAGGATTGGTGTTTGGTGAGGG - Intronic
1059853310 9:118367527-118367549 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
1059926947 9:119219073-119219095 GCAGATATGGTGTCTGGTGAGGG - Intronic
1060808588 9:126595319-126595341 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1060812549 9:126618201-126618223 TCAGAAGTTGTGTTTGGTGGGGG - Intronic
1061401044 9:130368523-130368545 GAAGTGATGGTGTGTGGTGCAGG + Intronic
1061502092 9:131009693-131009715 CCAGATATGGTGTTGGATGGAGG + Intronic
1061648001 9:132021897-132021919 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1062216135 9:135390789-135390811 CCAGACATGGTGTTGGGTGCAGG + Intergenic
1062232157 9:135487647-135487669 GCAGAGATGCAGTGTGGAGGGGG + Exonic
1062324174 9:136004507-136004529 CCAGACATTCTGTTTGGTGGTGG - Intergenic
1062631968 9:137467120-137467142 GCACAGATGCAGGTTGGTGGTGG - Intronic
1185513584 X:681118-681140 CGAGAGATGGTGTTAGGAGGTGG - Intergenic
1186162567 X:6793096-6793118 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1186297995 X:8169871-8169893 GAAGAGGTGGTGTGTGGTGAGGG - Intergenic
1186912424 X:14182708-14182730 GCAGAGATGGGCTCTGGAGGTGG - Intergenic
1187302421 X:18063986-18064008 GCTGGGGTGGTGTGTGGTGGGGG - Intergenic
1187618961 X:21029503-21029525 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1187951654 X:24476596-24476618 GCAGAGACTGTGTTTGGGGGTGG - Intronic
1187973299 X:24680173-24680195 GCAGATTTAGTGTCTGGTGGGGG - Intergenic
1187993144 X:24897364-24897386 GCTGAGGTGGGGGTTGGTGGGGG - Intronic
1188096466 X:26029239-26029261 GCAGATTTGGTGTCTGGTGAGGG - Intergenic
1188283096 X:28294770-28294792 GCAGATCTGGTGTCTGGTGAGGG + Intergenic
1188691661 X:33136708-33136730 GCAGATTTGGTGTCTGGTGAGGG - Intronic
1189367119 X:40397413-40397435 GCAGGTTTGGTGTTTGGTGAGGG + Intergenic
1189421542 X:40862113-40862135 GCAGAGATGCTCTGGGGTGGCGG - Intergenic
1189880662 X:45488002-45488024 GCAGATTTGGTGTTAGGTGAGGG - Intergenic
1189911021 X:45810652-45810674 GAAGAGATGGTGTGTGGGGTGGG - Intergenic
1190330618 X:49233127-49233149 GCAGAGAGGCTGTTTGGGGCTGG + Intronic
1190561846 X:51694262-51694284 GCAGAGAAAGCGTTTGGAGGGGG + Intergenic
1190708368 X:53048811-53048833 GCAGAGGTGGTGTTGGGGAGGGG - Intergenic
1191054123 X:56224854-56224876 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1191699238 X:64021674-64021696 GCGGATTTGGTGTCTGGTGGGGG - Intergenic
1192374622 X:70547336-70547358 GCAGAGAGGATGATTGGTGGAGG - Intronic
1192919116 X:75686728-75686750 GCAGATTTGGTGTGTGGTGAGGG - Intergenic
1193018814 X:76767688-76767710 GGGGAGATGGAGTTTGGTGAGGG - Intergenic
1193330682 X:80232539-80232561 GAAGAGATGGGGTTGGGGGGTGG + Intergenic
1194494875 X:94602151-94602173 GCAGGGTTGGTGTCTGGTGAAGG + Intergenic
1194840170 X:98730553-98730575 GCAGATAAAGTGTTTGGTGAGGG + Intergenic
1194846194 X:98812207-98812229 GCAGATTTGGTGTCTGGTGAAGG - Intergenic
1194937772 X:99971343-99971365 GCAGAGAAGATGATTGGTGGAGG + Intergenic
1194971491 X:100348938-100348960 GTAGAGATGGTGGGGGGTGGGGG + Intronic
1194992701 X:100562218-100562240 GCAGATATGGTGTCTGGTGAGGG + Intergenic
1195276897 X:103289969-103289991 GCAAACTTGGTGTTTGGTGAGGG - Intergenic
1195464269 X:105162808-105162830 GCAGATTTGGTGTCTGGTGAGGG + Intronic
1195629278 X:107037277-107037299 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1196251090 X:113460755-113460777 GCAAATTCGGTGTTTGGTGGGGG + Intergenic
1196323211 X:114368756-114368778 GCAGATTTGGTGTCTGGTGAGGG + Intergenic
1196470416 X:116017963-116017985 GGAGATTTGGTGTTTGGTGATGG + Intergenic
1196941020 X:120775900-120775922 GCAGGTTTGGTGTTTGGTGAGGG - Intergenic
1197147332 X:123184773-123184795 GCAGAGATGGTGCGGGGCGGGGG + Intronic
1197517159 X:127447280-127447302 GCATAGAGGGTTTTTGGTGTTGG - Intergenic
1197821031 X:130541017-130541039 TGTGAGAAGGTGTTTGGTGGTGG + Intergenic
1197977919 X:132184996-132185018 GCAGGGATGGAGTGTGGGGGTGG - Intergenic
1198429846 X:136554315-136554337 GCAGAGATGGAGGGAGGTGGAGG + Intronic
1198461684 X:136869093-136869115 ACAGAGGTAGTGTTTGGGGGAGG + Intronic
1198674641 X:139119011-139119033 GTAGAGATGGGGTTTTGTGTTGG - Intronic
1200411764 Y:2868289-2868311 GCAGAGATGGTATTGGGAGCAGG + Intronic
1200796881 Y:7348989-7349011 GCAGAGGTGGTGTTGAGAGGAGG - Intergenic
1201227823 Y:11835161-11835183 GTAGAATTGGTGTTTGGTAGGGG - Intergenic
1201556988 Y:15273286-15273308 GCAGACTTGGTGTCTGGTGAGGG + Intergenic
1202377831 Y:24254905-24254927 GCAGGGATGGAGCTTGGAGGAGG + Intergenic
1202492951 Y:25415216-25415238 GCAGGGATGGAGCTTGGAGGAGG - Intergenic