ID: 1034889806

View in Genome Browser
Species Human (GRCh38)
Location 7:154829821-154829843
Sequence GGAGCAGAGATGGTGTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889806_1034889810 -7 Left 1034889806 7:154829821-154829843 CCACCAAACACCATCTCTGCTCC 0: 1
1: 0
2: 2
3: 31
4: 338
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data
1034889806_1034889811 -6 Left 1034889806 7:154829821-154829843 CCACCAAACACCATCTCTGCTCC 0: 1
1: 0
2: 2
3: 31
4: 338
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889806 Original CRISPR GGAGCAGAGATGGTGTTTGG TGG (reversed) Intronic
901411641 1:9088334-9088356 GGAGGAGGGAGGGGGTTTGGTGG - Intronic
903000111 1:20259188-20259210 GGAGAAGAGATGGAGGTTGGGGG + Intergenic
903650057 1:24916740-24916762 AGAGCAGAGATGGAGTCGGGGGG - Intronic
903903355 1:26665175-26665197 TGAGGAGAGATGGAGTTTAGAGG + Intergenic
904013468 1:27403572-27403594 GGAGCAGAGTTGGTGACTGCGGG - Intergenic
904092848 1:27957188-27957210 GGAGCAGTGAGGCCGTTTGGAGG + Intronic
904183896 1:28687597-28687619 TGAGGAGAGAGGGTGTTTGAGGG + Intronic
904648922 1:31989553-31989575 TGAGGAGAGATGGTGTATGGTGG + Intergenic
905808954 1:40898213-40898235 GGGGCTGAGCTGGTGTTTCGTGG - Intergenic
907330057 1:53664901-53664923 AGAGCACAGATGGTGTGTGAGGG + Intronic
908740424 1:67321868-67321890 GGAGCAGAGATCTTCGTTGGTGG + Exonic
909442298 1:75711053-75711075 GAAGCAGAGATGTTGGTTGTGGG - Intergenic
911554137 1:99322250-99322272 GAAGCAGAGATGGTTACTGGAGG + Intergenic
912766347 1:112415358-112415380 GGAAAAGAGATAATGTTTGGTGG - Intronic
912871656 1:113311974-113311996 GGTGCAGAGACGCTGTATGGAGG - Intergenic
915399423 1:155611556-155611578 TGAGTAGTGATGGTGTCTGGAGG + Exonic
915416536 1:155747136-155747158 TGAGTAGTGATGGTGTCTGGAGG + Intergenic
915622185 1:157092594-157092616 AGAGGAGAGATGGACTTTGGAGG + Exonic
915684323 1:157616398-157616420 GAAGCTGAGATGGTGTGTGATGG + Intergenic
918343915 1:183590145-183590167 GAAGCAGAGAAGGTGAGTGGAGG - Exonic
920527495 1:206678096-206678118 GGTGTAGAGGTGGTCTTTGGAGG + Intronic
920566395 1:206976920-206976942 GGAGCAGAGATGGTGGAGAGAGG + Intergenic
920692621 1:208158620-208158642 GGATTAGAGATGGAGTTGGGGGG - Intronic
921124235 1:212162689-212162711 AGACCAGAGATGGGGGTTGGTGG - Intergenic
922555863 1:226531442-226531464 AGAACAGATAGGGTGTTTGGAGG + Intergenic
923417335 1:233776195-233776217 GGAGGAGAGATGGAGGGTGGAGG + Intergenic
923523515 1:234755118-234755140 TGAGGTGAGATTGTGTTTGGTGG - Intergenic
924678270 1:246203319-246203341 GGAGCAGAGATTGTGTCTGATGG - Intronic
1063166631 10:3469426-3469448 GGAGTAGAGATGGTGTGTGGGGG + Intergenic
1065129163 10:22602907-22602929 GGAGCAGTGTTTGTGTTTGCTGG - Intronic
1065492115 10:26292546-26292568 GGATATGAGATGGTGTTTGATGG + Exonic
1065937691 10:30535376-30535398 GGAGCAGAGTTGGGCTTTGGGGG - Intergenic
1067192494 10:44083056-44083078 GGAGCAGAGCAGGTGTTCTGAGG + Intergenic
1067525324 10:47035145-47035167 GGAGCAGACATGCTCTGTGGTGG - Intergenic
1069839016 10:71327732-71327754 GGAAGGAAGATGGTGTTTGGTGG - Intronic
1071468408 10:85961490-85961512 GGAGGACAGACGGTGGTTGGTGG - Intronic
1072210955 10:93246680-93246702 GGGGCAGAGGTGGGGGTTGGGGG + Intergenic
1074057527 10:109936270-109936292 GGGGCAGAGGTGGTGTGTAGAGG - Intergenic
1074205312 10:111277898-111277920 GGCACAGAGATGGTGTCTAGTGG - Intergenic
1074292360 10:112147738-112147760 GGAGAAGAGATGGGCTTTGTAGG + Intergenic
1075270977 10:121050554-121050576 GGACCAGACGTGGTGCTTGGAGG - Intergenic
1076521297 10:131082895-131082917 GGAGCTGAGATGGGGCTTAGGGG - Intergenic
1076612268 10:131733748-131733770 GGAGCAGAAAAGGTGGCTGGGGG + Intergenic
1078904391 11:15670868-15670890 GGAGCAGAGAGGGTGGGTGGGGG + Intergenic
1079103825 11:17558136-17558158 GGGGCAGCGATGGGGTTGGGTGG - Intronic
1079788116 11:24701248-24701270 GCAGCAGGGATGGTGATTGGCGG - Intronic
1080750449 11:35145717-35145739 GAAGCAGACATGGGGGTTGGAGG - Intronic
1080824998 11:35840552-35840574 CAAGCAGCCATGGTGTTTGGAGG + Intergenic
1083734592 11:64672164-64672186 GGAGCAGAGAGGCTGGCTGGAGG + Intronic
1084805429 11:71575688-71575710 GGATCAGAGACAGGGTTTGGGGG - Intergenic
1084918978 11:72453819-72453841 AGAGAAGAGGTGGTGTTTTGTGG + Intergenic
1084935548 11:72584734-72584756 GGAGCAGAGATGGAGTCGAGAGG + Intronic
1085313023 11:75527077-75527099 GGCGCAGAGAAGGTGTTGGAGGG + Intergenic
1085456601 11:76669024-76669046 GGAGCAGAGCTGGTGAGTGGTGG - Intronic
1088126380 11:106429498-106429520 GGAGCAGAGACTGTTTATGGTGG - Intergenic
1089094240 11:115905450-115905472 GGAGCAGACATGATGACTGGGGG - Intergenic
1089830921 11:121327516-121327538 GGAGCACAAATGGAGTTAGGAGG - Intergenic
1090356701 11:126145492-126145514 GGTGCAGAGCTGGTGTAGGGAGG - Intergenic
1091362534 11:134988926-134988948 GGGTCTGAGATTGTGTTTGGCGG - Intergenic
1092694940 12:11161112-11161134 GGAGCAGAAAAGGTGCATGGAGG - Intronic
1093961885 12:25282768-25282790 TGAGCTGATATGGTGTTTTGAGG - Intergenic
1096803552 12:54126973-54126995 GGAGCGGAGTTGGGGTTTCGAGG + Intergenic
1098876682 12:75872932-75872954 GGAGCAGATCTGGTGGTTGGAGG - Intergenic
1099691085 12:85952527-85952549 GGAGCAGAGGTGGAGGTTGGGGG + Intergenic
1100068190 12:90677329-90677351 GGAGGAGAGAGGGAGTTTTGTGG - Intergenic
1100984676 12:100192636-100192658 GCAGCAGATTTGGTGTCTGGTGG - Intergenic
1101483706 12:105129534-105129556 AGATCATAGCTGGTGTTTGGTGG + Intronic
1101806105 12:108065335-108065357 GAAGCAGAGGTGGTGTGGGGAGG + Intergenic
1102016411 12:109650884-109650906 GGAGGAGGGATGGGGATTGGGGG - Intergenic
1102187134 12:110957660-110957682 GGAGCAGAGATGGTGGATGAAGG - Intergenic
1102189191 12:110973281-110973303 GGAGCAGAGAGGGTGGCGGGTGG + Intergenic
1102992838 12:117327296-117327318 GAGGCAGAGGTGGTGCTTGGGGG + Intronic
1103721325 12:122977047-122977069 GAGGCAGAGATGGTGGCTGGAGG - Intronic
1103773015 12:123343281-123343303 AGAACAGAGATGATATTTGGGGG + Intronic
1104104772 12:125649080-125649102 GTAAGAGAGATGGTGTTAGGTGG - Intronic
1104134379 12:125923448-125923470 GGAGAAGAGATGATGGATGGAGG + Intergenic
1105883772 13:24625091-24625113 GGAAGAGAGCTTGTGTTTGGTGG + Intergenic
1106748628 13:32733011-32733033 ACAGGAAAGATGGTGTTTGGAGG - Intronic
1107608635 13:42089635-42089657 GAAGCAGAGATGGTGGTGTGAGG - Intronic
1107611155 13:42114355-42114377 GTAGCTGAGATGGCTTTTGGGGG - Intronic
1108048124 13:46402543-46402565 GGAGAGGAGGTGGTGGTTGGTGG + Intronic
1108544458 13:51478520-51478542 GGAACAGAGAGGGTGTCAGGGGG + Intergenic
1108581030 13:51828371-51828393 AGATCAGAGCTGGCGTTTGGTGG - Intergenic
1110583794 13:77163474-77163496 GGAGTAAAGATGGATTTTGGGGG + Intronic
1110648636 13:77918311-77918333 GGAGGGGAGATGGTGCGTGGCGG + Exonic
1111791752 13:92865512-92865534 GGAGGGGAGATGGTGGTTGGAGG + Intronic
1112405107 13:99112603-99112625 TAAGCAGAGGTGGCGTTTGGTGG - Intergenic
1112748673 13:102556610-102556632 GGAGCAGTGATTTTGTTTGCAGG - Intergenic
1113493058 13:110707001-110707023 GGTGCAGACATGGTGTGTGCTGG - Intronic
1114558018 14:23572822-23572844 GGAGCAGGGAAGGTGGTAGGGGG - Intronic
1115423664 14:33228049-33228071 TGAGCTGAGATTGTGTTGGGAGG + Intronic
1115629906 14:35234457-35234479 GCAGCAGAGATGGTTTTAAGAGG - Intronic
1118806442 14:69241250-69241272 GGAGCAAAGATATTGTTTGAAGG + Exonic
1119323811 14:73746777-73746799 GCAGCAGGGAGGGTGTGTGGTGG - Intronic
1120872566 14:89351199-89351221 GGAGCAGAGATGGACTTTTGGGG - Intronic
1121007001 14:90496713-90496735 GGGGCAGTGATGGGGTTGGGAGG - Intergenic
1121171155 14:91855457-91855479 GAAGCAGAGTTGGAGTTTTGAGG - Intronic
1121963255 14:98280870-98280892 GAAGAGGAGATGGTGGTTGGGGG - Intergenic
1122335008 14:100968112-100968134 GGACCAGTGATGGTGACTGGTGG + Intergenic
1122905441 14:104799667-104799689 GAAGTAGAGAGTGTGTTTGGCGG - Intergenic
1123109106 14:105857115-105857137 TGAGCTGAGATGGTCTTAGGTGG - Intergenic
1123155926 14:106225729-106225751 GGAGCAGAGAATGTTTTTGGGGG - Intergenic
1124135444 15:27031679-27031701 GGAGCAGAGATAGGGTTGAGAGG - Intronic
1125450492 15:39801916-39801938 GGAATAGAGATGGTGTTCTGTGG + Exonic
1128283814 15:66419174-66419196 GGAAAAGTGATGGAGTTTGGAGG - Intronic
1129297716 15:74609028-74609050 GGAGAGCAGATGGTGTTGGGGGG - Intronic
1129321100 15:74775474-74775496 GGAGGAGAGGTGGTGCCTGGGGG - Intergenic
1129667387 15:77587244-77587266 GGAGCAGGGTTGGTGTGTGGAGG - Intergenic
1129702072 15:77773920-77773942 TGAGGAGAGATGTTGTTTGTGGG - Intronic
1130092602 15:80833554-80833576 GTATCAGAGATGCAGTTTGGAGG + Intronic
1130760880 15:86818502-86818524 GGACCACAGTTGGGGTTTGGGGG - Intronic
1131150120 15:90042525-90042547 GGAGCAGAGAGGCTGAGTGGAGG - Intronic
1131624538 15:94103656-94103678 ACAGGAGAAATGGTGTTTGGTGG + Intergenic
1132110330 15:99098113-99098135 GGAGCACAGCAGGTGTTTGTTGG - Intergenic
1132271333 15:100528677-100528699 GGAGAGGAGATGGAGATTGGGGG - Intronic
1132712108 16:1273542-1273564 GGAGCAGAGAAGGTGGGTGCTGG + Intergenic
1133114683 16:3570587-3570609 GGAGCAGAGGTGGTAATTGGCGG + Intronic
1133292399 16:4731165-4731187 GGGGCAGAGAGGGAATTTGGGGG + Intronic
1133967441 16:10541699-10541721 GGAGCACCGATGGTGTTCCGTGG + Intronic
1134512159 16:14857115-14857137 GGAGCAGACATGGTAGGTGGTGG + Intronic
1134699794 16:16255621-16255643 GGAGCAGACATGGTAGGTGGTGG + Intronic
1134972031 16:18539044-18539066 GGAGCAGACATGGTAGGTGGTGG - Intronic
1135721217 16:24820225-24820247 GGAGCAGTGATGTTTTTAGGTGG - Exonic
1136714207 16:32263987-32264009 GCAGGAGAGATGCTGTATGGAGG + Intergenic
1136753691 16:32665431-32665453 GCAGGAGAGATGCTGTATGGAGG - Intergenic
1136814422 16:33204934-33204956 GCAGGAGAGATGCTGTATGGAGG + Intronic
1136820898 16:33315014-33315036 GCAGGAGAGATGCTGTATGGAGG + Intergenic
1136827461 16:33371553-33371575 GCAGGAGAGATGCTGTATGGAGG + Intergenic
1136832527 16:33470324-33470346 GCAGGAGAGATGCTGTATGGAGG + Intergenic
1137694237 16:50450528-50450550 GGAGGAGAGATGATGGCTGGAGG - Intergenic
1138351424 16:56348040-56348062 GCAGCAGTGATGGGGTTGGGAGG - Exonic
1138990251 16:62382248-62382270 GAGGCAGAGATGGGGTTGGGAGG - Intergenic
1139187811 16:64827794-64827816 GGAACACAAATGGTGTTTGTAGG - Intergenic
1139891904 16:70258508-70258530 GGGGCAGTGGTGGTGGTTGGTGG - Intronic
1140461965 16:75147143-75147165 GGAGCACAGATGATTTTTTGGGG + Intergenic
1141112627 16:81282638-81282660 TGAGCAGGGATGGGGGTTGGGGG - Intronic
1142092363 16:88221381-88221403 GGAGCAGAGAGGAAGTGTGGCGG - Intergenic
1202992998 16_KI270728v1_random:27908-27930 GCAGGAGAGATGCTGTATGGAGG + Intergenic
1203055846 16_KI270728v1_random:925782-925804 GCAGGAGAGATGCTGTATGGAGG - Intergenic
1144847826 17:18229264-18229286 GGGGCGGAGATGGTGTTAAGGGG - Intronic
1145239623 17:21232845-21232867 ACAGCAGAGATGGAGTCTGGGGG + Intergenic
1146057246 17:29587672-29587694 GGAGTAGAAATGGTTTTTGGGGG - Intronic
1149414836 17:56448463-56448485 TGAGCAGACAGGGTGGTTGGTGG + Intronic
1149682047 17:58513856-58513878 GGAGAAGAGAGGCTGTCTGGGGG + Intronic
1149683296 17:58520346-58520368 TGAGCAGAGCTGGTGCTGGGAGG + Exonic
1149849923 17:60028246-60028268 GGGGCAGGGCTGGGGTTTGGGGG + Intergenic
1149860245 17:60118278-60118300 GGGGCAGGGCTGGGGTTTGGGGG - Intergenic
1150302159 17:64055730-64055752 GGAGCAGAGCGAGTGGTTGGAGG + Exonic
1150482364 17:65520301-65520323 GTAACTGAGATGGTTTTTGGAGG + Intergenic
1151361794 17:73593419-73593441 GGAACAGAGATGGGGTGTGGGGG + Intronic
1151655492 17:75493978-75494000 GGAGCAGGGAGGGCGTCTGGAGG + Intronic
1152179140 17:78806993-78807015 GGAGGAGACATGGTGCTTGCAGG + Exonic
1152605625 17:81288263-81288285 GGAGAGGAAATGGTGTTTAGGGG - Intronic
1154489296 18:14907414-14907436 GGGTCTGAGATTGTGTTTGGTGG + Intergenic
1157470473 18:47984319-47984341 GGGGCAGAGATGCTCTGTGGGGG + Intergenic
1157960928 18:52152477-52152499 GGAGGAGAGAGGGTGTTGTGGGG + Intergenic
1157986417 18:52443435-52443457 GGAGAAATGATGGTGTTTGTGGG + Intronic
1158157445 18:54441955-54441977 GCACCAGAGATGGTGGCTGGGGG + Intergenic
1158290892 18:55941165-55941187 GAAGAAGAGATGGGTTTTGGGGG - Intergenic
1161108849 19:2457338-2457360 GTAGTAGAGATGGTGTGGGGGGG - Intergenic
1161337466 19:3722111-3722133 CCAGAAGAGATGGTCTTTGGAGG - Intronic
1161724561 19:5921033-5921055 GGTGCAGGGAGGGGGTTTGGGGG + Intronic
1162787861 19:13046808-13046830 AGAAGAGGGATGGTGTTTGGGGG + Intronic
1163054235 19:14706350-14706372 GGAGGGAAGATGGAGTTTGGAGG - Intronic
1165994205 19:39833197-39833219 GGAGAAGAGGTGGTTTTTTGGGG - Intronic
1166178289 19:41089940-41089962 GGAGCAGAGAGGGAGTGGGGTGG - Intronic
1166373329 19:42314122-42314144 GGATCAGGGAAGGAGTTTGGAGG + Intronic
1166709109 19:44925775-44925797 AGAGCAGATAGAGTGTTTGGGGG + Intergenic
1167388415 19:49178384-49178406 ACTGCAGTGATGGTGTTTGGGGG + Intronic
1167761696 19:51453952-51453974 GGAGGAGAGATGGTGAATCGGGG + Intronic
925241154 2:2330681-2330703 GGTGCATGTATGGTGTTTGGAGG - Intronic
926124347 2:10262748-10262770 GGAGAGGAGATGGGCTTTGGTGG + Intergenic
928100709 2:28436066-28436088 GGAGCAGAGTTGGTTTTAGGAGG + Intergenic
928301508 2:30129561-30129583 GAAGTAGAGATGGAGTGTGGTGG + Intergenic
929141528 2:38670712-38670734 GAGTCAGAGATGGTATTTGGGGG - Intronic
930447110 2:51487849-51487871 CCAGCAGAGTTGGTGTCTGGTGG - Intergenic
932232153 2:70091658-70091680 GGACTAGAGATGGAGTTTTGGGG + Intergenic
932431580 2:71678560-71678582 GGTGCAGAGTTTTTGTTTGGGGG + Intronic
933165878 2:79074093-79074115 GGAAAAGAGATGGAGTTTGCAGG + Intergenic
934512641 2:94958773-94958795 GGGGTATAGATGGTGTGTGGTGG + Intergenic
934647945 2:96070122-96070144 GCAGCAGAGGTGGTGAGTGGGGG + Intergenic
934841316 2:97625943-97625965 GCAGCAGAGGTGGTGAGTGGCGG + Intergenic
936509494 2:113133617-113133639 GGAGTGGAGATGGAGCTTGGAGG - Exonic
937434270 2:121867344-121867366 GGGGCAGAGCTGGGGTTGGGGGG + Intergenic
939213139 2:139204096-139204118 GGAGCTGAGATTATGTTTGAAGG + Intergenic
941620227 2:167769303-167769325 GAAGCATGGAAGGTGTTTGGAGG - Intergenic
942327009 2:174784461-174784483 GGAGAAGAGAGGGAGTTTGCAGG + Intergenic
942683151 2:178500523-178500545 GTAGCTGAGATGCTGTTAGGTGG + Intronic
945805163 2:214481237-214481259 GCAGCAGAAATGATGTTGGGAGG + Intronic
946143322 2:217710284-217710306 GGAGTAGAGATGGTGTTTCATGG - Intronic
946227296 2:218270734-218270756 GGTGCAGAGATGCTCTTTAGAGG + Intronic
946369804 2:219274053-219274075 TGAGAAGAGGTGGTGTCTGGAGG - Intronic
946571601 2:221029784-221029806 GTGGCAGGCATGGTGTTTGGAGG + Intergenic
947770488 2:232666469-232666491 GGAGCTGAGAGGGTGTTTCGTGG + Intronic
948064945 2:235070632-235070654 GGAGCAGAGAATGAGTCTGGTGG + Intergenic
948373412 2:237505039-237505061 GGAGCAGAGGTGGGGTTGTGGGG - Intronic
1169499111 20:6142049-6142071 GGAGCACGGATTGTGTTTGAAGG - Intergenic
1169930172 20:10824046-10824068 GGAGAGGATATGGGGTTTGGTGG + Intergenic
1171942781 20:31347910-31347932 GGTGCAGAGAGTGTGCTTGGGGG + Intergenic
1171986717 20:31665902-31665924 GGAGCAGAGAAGGGGGTGGGAGG + Exonic
1172218250 20:33251880-33251902 GGACCACAGATGATGTCTGGGGG - Intergenic
1175192116 20:57218385-57218407 GCTGCACAGCTGGTGTTTGGTGG + Intronic
1175220351 20:57412990-57413012 GGAGCAGAGATAGGGTCTTGGGG + Intergenic
1175419565 20:58822855-58822877 GGAGCAGAGCTGGTGGTTCAGGG - Intergenic
1175574684 20:60052143-60052165 GAAGCAGAGAGGGAGTTTGCTGG + Intergenic
1175596528 20:60239151-60239173 GGAGCAGAGAGGATGTGGGGAGG - Intergenic
1175646197 20:60674007-60674029 AGAGATGAGATGGTGTTTGTTGG + Intergenic
1176255113 20:64147679-64147701 GGAGCAGAGAGGCTGATTAGAGG + Intergenic
1176872553 21:14095477-14095499 GGAGCAGAGAAGGCAGTTGGTGG + Intergenic
1178723291 21:35029103-35029125 GGAGCAGAGATGGTGGAGAGAGG - Intronic
1179122459 21:38560454-38560476 GGAGCAGAGCTTGCCTTTGGAGG - Intronic
1179389831 21:40977709-40977731 GGAGCAGAGTTGGTAGATGGAGG - Intergenic
1180055396 21:45356408-45356430 TGAGCAGAGATGTGGTTTGTGGG - Intergenic
1180628108 22:17207937-17207959 GGGGCACAGCTGGTGTCTGGTGG - Intronic
1180847179 22:18990181-18990203 GGAGTGGAGTTGGTGTTTTGTGG - Intergenic
1181460543 22:23083551-23083573 GAAGCAGAGCTGGTGCTTGGGGG + Intronic
1181725255 22:24806642-24806664 GGCGCAGCGAGGGAGTTTGGGGG + Intronic
1182819677 22:33204586-33204608 GGAGAAGTGAAAGTGTTTGGAGG - Intronic
1183001906 22:34867227-34867249 GGAGCAGAGATTGTGATTAAGGG - Intergenic
1183257128 22:36769794-36769816 GGAGCAGAGCTGAAGTTGGGAGG - Intronic
1184683314 22:46084754-46084776 AGAGGTGAGCTGGTGTTTGGAGG + Intronic
1184733314 22:46382889-46382911 GGAGGAGAGTTAGTGTTTCGTGG + Intronic
950868291 3:16207203-16207225 GGAACAGAGATGGAATTTGATGG + Intronic
952883504 3:37999276-37999298 GGGGCGGAGATGGTGTTGGGGGG + Intronic
953198211 3:40753882-40753904 GGAGAGGAGGTGGTGTGTGGTGG - Intergenic
953606771 3:44417618-44417640 GGAGCAGATAAGGTGGCTGGGGG + Intergenic
953964649 3:47294546-47294568 GGAGCACACTTGGTGTTTTGGGG + Intronic
954145463 3:48632198-48632220 GGAGCAGAAGTGGTGGTGGGGGG + Intronic
955299202 3:57761149-57761171 TCAGCAGAGAGGGTGTTTAGTGG + Intronic
958590299 3:96149604-96149626 TCAGCAGAAATGGTGTTAGGAGG - Intergenic
959021336 3:101190753-101190775 GCAGCTGAGATGAGGTTTGGAGG + Intergenic
959733522 3:109631243-109631265 GGGGAAGAGATGTTGGTTGGTGG - Intergenic
960231629 3:115234853-115234875 TGAGAAGAGATGGTGGTAGGAGG + Intergenic
962005058 3:131340537-131340559 GGATGAGAGATTGAGTTTGGAGG + Intronic
962266229 3:133946182-133946204 GAAGGAGAGAAGGGGTTTGGGGG - Intronic
965524570 3:169702274-169702296 GGAACATAGATGGTGGCTGGTGG - Intergenic
966175969 3:177138235-177138257 TGAACAGAGATGCTGATTGGTGG + Intronic
966435428 3:179878424-179878446 GGAGGAGAGATGATGTTTGAAGG - Intronic
967263452 3:187668999-187669021 GGAAGAGAGATGGGGTGTGGGGG + Exonic
967353320 3:188539379-188539401 TGATCACAGAAGGTGTTTGGTGG + Intronic
968067209 3:195765218-195765240 TGAGCAGAGAGGGTGGTGGGTGG + Intronic
968727472 4:2254929-2254951 GAAGTAGAGATGCTGGTTGGCGG - Intronic
969634318 4:8357720-8357742 GGAGCAGGGACCGTGTGTGGGGG + Intergenic
969845834 4:9919484-9919506 CGGGCAGGGAGGGTGTTTGGGGG - Intronic
970311117 4:14783501-14783523 GGAGCAGAGATGTGGTTAGAAGG + Intergenic
970386345 4:15560836-15560858 GGAGGTGAGATGGGGTTTGTTGG - Intronic
971163394 4:24157407-24157429 GGAGTTGAGAAGATGTTTGGAGG - Intergenic
972077500 4:35105470-35105492 GGACCAGAGCAGGTGTTTGAGGG - Intergenic
972396798 4:38664574-38664596 GGTGCAGCGCTGGTGTTGGGGGG + Intronic
974177844 4:58346463-58346485 GGAGTTGGGATGATGTTTGGAGG + Intergenic
974250551 4:59378121-59378143 AGAAAAGAGATGGAGTTTGGGGG + Intergenic
974817410 4:67022848-67022870 AGAGAAGAGAGTGTGTTTGGAGG - Intergenic
975115441 4:70675868-70675890 GGAGTGGAGATGGTTTTTGATGG - Intronic
976028287 4:80718990-80719012 GGAACATGGATGGAGTTTGGGGG + Intronic
978446633 4:108786723-108786745 GAATCAGAGATGGTGGTTTGGGG + Intergenic
978708840 4:111752106-111752128 GGAGCAGAGAAGGTGGATTGTGG + Intergenic
980477955 4:133344713-133344735 AGAACAGAGATGGTGGTTTGGGG - Intergenic
981832437 4:149017826-149017848 TGTGCAGAGAAGGTGTTTTGGGG - Intergenic
985070816 4:186165087-186165109 GACGCAGAGCTGGTGTGTGGGGG - Intronic
985495338 5:201118-201140 GGAGGAGCCAGGGTGTTTGGGGG - Exonic
985704011 5:1390356-1390378 GGAGCAGACATGGTTTCAGGTGG + Intergenic
986709780 5:10480401-10480423 GGAACAGAGATGGGGTTTTCAGG - Intergenic
987741648 5:21916600-21916622 GGAGGAGAAAGGGTGTTTGGTGG - Intronic
988615459 5:32770682-32770704 GTAGCAGTGGTGCTGTTTGGTGG + Intronic
991975608 5:72181238-72181260 GTAACAGTGATGGTGGTTGGTGG + Intronic
994056663 5:95424161-95424183 GGATCAGTGAGTGTGTTTGGTGG - Intronic
996169069 5:120266141-120266163 GGAGCAGAGTGGGTGGTAGGAGG + Intergenic
996819396 5:127609297-127609319 GGAGGAGATGGGGTGTTTGGTGG + Intergenic
997666840 5:135636356-135636378 GGGGCAGAGAATGTGCTTGGAGG + Intergenic
998710557 5:144820216-144820238 GGTGCAGAGATGGTCTTCTGAGG + Intergenic
998860116 5:146434753-146434775 GAAGCAGGGACTGTGTTTGGAGG - Intergenic
998893649 5:146773888-146773910 GGAGAAGAGATGGTCTGTGAAGG - Intronic
998897781 5:146818388-146818410 GGAGCAGAGATTGTGTTGAAGGG - Intronic
999610138 5:153360523-153360545 GGAGCAGACATGGTGTGCCGTGG + Intergenic
999693788 5:154170683-154170705 GGAGCAGGGAAGGTGGCTGGAGG + Intronic
1002723982 5:181282655-181282677 GGAGCAGAGGGGTGGTTTGGGGG + Intergenic
1003507385 6:6751210-6751232 GGAGTTGAGAAGGTGTTTGTAGG + Intergenic
1004494841 6:16153971-16153993 GGAGAAGAGAGGGTGCTGGGAGG - Intergenic
1005514482 6:26540730-26540752 TAAGGAGAGATCGTGTTTGGGGG - Intronic
1006329565 6:33380582-33380604 CGAGCAGAGAAGGTAGTTGGAGG - Intergenic
1006576413 6:35049627-35049649 GCAGCAGAAAGGGTGTTAGGAGG + Intronic
1007272374 6:40648186-40648208 GGAGCTGAGATGTTGTTGGGAGG + Intergenic
1007442323 6:41873145-41873167 GGAGCAGAGCTGGGATTAGGTGG + Intronic
1007513639 6:42394226-42394248 GGGGGAGAGTTGGAGTTTGGGGG - Intronic
1007817246 6:44533331-44533353 GGAGCAGAGATGTTTATTAGAGG + Intergenic
1009429371 6:63549223-63549245 GTAGCAGAGCAGCTGTTTGGTGG + Intronic
1011543819 6:88463207-88463229 GGAGCACAGATGGTTCTGGGGGG + Intergenic
1011545845 6:88480622-88480644 GGTGGAGAGATGGGGTGTGGAGG - Intergenic
1011787620 6:90864514-90864536 GGTGCAGAGAAGGTGGATGGGGG + Intergenic
1012506073 6:99947846-99947868 GGGGGAGAGTGGGTGTTTGGGGG - Exonic
1013371259 6:109472898-109472920 GCAGCAGAGGTGGTGTCAGGTGG - Intronic
1016363748 6:143294025-143294047 GGTGCAGAAATGATGTTTGTAGG - Intronic
1016995101 6:149956072-149956094 GGAGCAGGGACGATGCTTGGTGG + Intergenic
1018066629 6:160129108-160129130 GGAGAACAGAGGGTGTTGGGTGG - Intronic
1018765896 6:166932444-166932466 GGAGCAGAGCTGGGGGCTGGGGG - Intronic
1019876015 7:3811603-3811625 GCAGCAGAGAGGGGCTTTGGTGG - Intronic
1020085215 7:5306739-5306761 GGAGTAGGGGTGGTGTCTGGGGG - Exonic
1022192586 7:28031395-28031417 GGAGAAGAGAAAGTGTTTGTGGG + Intronic
1024332587 7:48170977-48170999 GAAGCAGTGTTGGTGTCTGGGGG - Intergenic
1024702375 7:51918301-51918323 GGGTCATAGTTGGTGTTTGGTGG - Intergenic
1024702394 7:51918383-51918405 GGCCCATAGTTGGTGTTTGGTGG - Intergenic
1025209102 7:57010536-57010558 GGAGTAGGGGTGGTGTCTGGGGG + Intergenic
1025662847 7:63566322-63566344 GGAGTAGGGGTGGTGTCTGGGGG - Intergenic
1032377102 7:131431256-131431278 GGATCAAATATGGTATTTGGGGG - Intronic
1033510941 7:142059635-142059657 GGAGCAGGTATGGGCTTTGGTGG + Intronic
1034041661 7:147884011-147884033 GAAGCAAAGATGCTCTTTGGAGG + Intronic
1034042481 7:147894057-147894079 GGAGCAGAGAAGGAATTTGGAGG - Intronic
1034163745 7:149010647-149010669 GGAGCAGAGAGGGCGGCTGGGGG - Intronic
1034707508 7:153158666-153158688 GGGACAGAGATGGGGGTTGGGGG + Intergenic
1034889806 7:154829821-154829843 GGAGCAGAGATGGTGTTTGGTGG - Intronic
1035108957 7:156464437-156464459 GGAGCAGAGGTGCTGAGTGGCGG - Intergenic
1035332362 7:158104712-158104734 GGAGCTGGGATGGAGTTTGATGG - Intronic
1035332372 7:158104766-158104788 GGAGCTGGGATGGAGTTTGATGG - Intronic
1035332383 7:158104820-158104842 GGAGCTGGGATGGAGTTTGATGG - Intronic
1035332393 7:158104874-158104896 GGAGCTGGGATGGAGTTTGATGG - Intronic
1035332404 7:158104928-158104950 GGAGCTGGGATGGAGTTTGATGG - Intronic
1035332414 7:158104987-158105009 GGAGCTGGGATGGAGTTTGATGG - Intronic
1035332418 7:158105008-158105030 GGAGCTGGGATGGAGTTTGATGG - Intronic
1035332484 7:158105402-158105424 GGAGCTGGGATGGAGTTTGACGG - Intronic
1035662971 8:1361111-1361133 CGAGCTGAGATGGTCCTTGGTGG + Intergenic
1035918991 8:3656443-3656465 AGTGAAAAGATGGTGTTTGGTGG + Intronic
1037316459 8:17604019-17604041 GGAGGAGAGATGATGATGGGAGG + Intronic
1038348799 8:26757513-26757535 GGAGCAGAGGTGGGGGGTGGGGG - Intronic
1039000130 8:32970800-32970822 AGAGCAGAGAAGGTATTTGGGGG - Intergenic
1039135213 8:34314944-34314966 GGAGAAGAGATTTTGTGTGGGGG - Intergenic
1039774530 8:40722693-40722715 TGAGCAGGGAGGGTGTTTGTTGG - Intronic
1040958445 8:53004964-53004986 GGAGCTGAGAAGGTGCTGGGTGG - Intergenic
1043015898 8:74940379-74940401 GGTCCAGAGATGCTGTCTGGGGG + Intergenic
1043199824 8:77352879-77352901 AGGCCAGAGATGGAGTTTGGGGG + Intergenic
1043648055 8:82548048-82548070 GAAGCAGAGATGGTGGGAGGAGG + Intergenic
1045752361 8:105499810-105499832 GGGGCAGAGGTGGAGGTTGGGGG + Intronic
1045971034 8:108080642-108080664 AATGCAGAGATGCTGTTTGGTGG - Intronic
1046070933 8:109252328-109252350 GGCATAGAGATGGTGTTTTGAGG + Intronic
1048821522 8:138384823-138384845 GTAGCAGAGATGCAGTGTGGGGG - Intronic
1049349203 8:142154995-142155017 GGAGCAGAGGGGGTGCTTGTGGG - Intergenic
1049480932 8:142822269-142822291 GGGGCACAGATGGTGTCTGTGGG - Intergenic
1049653628 8:143788301-143788323 GGAGCAGGGGTGATGCTTGGAGG - Intergenic
1049715193 8:144086525-144086547 GCAGTAAAGATGGTGTTAGGTGG - Intergenic
1051131330 9:13864397-13864419 GAGGCAGGGTTGGTGTTTGGTGG + Intergenic
1051241485 9:15061782-15061804 GGTGCGGGGAAGGTGTTTGGAGG - Intergenic
1051511167 9:17879296-17879318 GCAGCAGAGGTGGAGTCTGGTGG + Intergenic
1052730975 9:32285386-32285408 GGAGTACAGGTGGTATTTGGTGG + Intergenic
1053178740 9:35949408-35949430 GGAGCAGAAAGGGTGTGAGGAGG - Intergenic
1053489122 9:38486823-38486845 GGAGAAGGGATAGGGTTTGGGGG + Intergenic
1053886129 9:42646087-42646109 GGAGCAGAGGGGTGGTTTGGGGG + Intergenic
1054225151 9:62453536-62453558 GGAGCAGAGGGGTGGTTTGGGGG + Intergenic
1054376176 9:64451335-64451357 GGAGAAGAGTTGGGGGTTGGAGG + Intergenic
1054924927 9:70579585-70579607 AGGGGAGAGATGGGGTTTGGAGG + Intronic
1057520215 9:95753932-95753954 GGGGAAGGGATTGTGTTTGGGGG + Intergenic
1057724805 9:97560984-97561006 GGAGCAGAGAAGCTGTTGGGAGG + Intronic
1060203366 9:121666423-121666445 GGAGGAGAGGTGTTGCTTGGAGG - Intronic
1060920638 9:127418108-127418130 GGAGCTGGGATGGTGTAAGGGGG - Intergenic
1061246480 9:129403473-129403495 GGTGCAGAGGAGGTGTTTGGGGG + Intergenic
1062262263 9:135668807-135668829 AGAGCAGAGATGGTGATTGGAGG - Intergenic
1062526472 9:136979886-136979908 GAAGCAGAGGTGAGGTTTGGGGG + Intronic
1062720817 9:138043137-138043159 GGAGCACAGCTGGGGTGTGGTGG + Intronic
1185643411 X:1600574-1600596 GGAGCTGGGAAGGTGTTTGGAGG - Intronic
1187951655 X:24476599-24476621 GCGGCAGAGACTGTGTTTGGGGG - Intronic
1189195926 X:39152379-39152401 GGGGCAGAGAGGGGATTTGGGGG - Intergenic
1190561843 X:51694259-51694281 GAAGCAGAGAAAGCGTTTGGAGG + Intergenic
1190713169 X:53083643-53083665 GGACCAGAGATGGTGAAAGGAGG + Intronic
1192436645 X:71147482-71147504 GCAACAGAGTTGGTCTTTGGGGG - Intronic
1193330681 X:80232536-80232558 GGTGAAGAGATGGGGTTGGGGGG + Intergenic
1195448218 X:104977539-104977561 AGAGCAGAGATGGAAATTGGTGG - Intronic
1198461683 X:136869090-136869112 GCAACAGAGGTAGTGTTTGGGGG + Intronic
1198531308 X:137551285-137551307 GGAGCAGAGAGGGTGGTTGTTGG - Intergenic
1198964890 X:142217039-142217061 GGAGTGGAGATGATGTATGGGGG + Intergenic
1199601540 X:149544146-149544168 CGAGCATAGATGGTGGCTGGTGG + Intronic
1199648837 X:149935338-149935360 CGAGCATAGATGGTGGCTGGTGG - Intronic
1199760610 X:150901594-150901616 GGAGTATAGATGATGTGTGGGGG - Intergenic
1200093721 X:153647653-153647675 GGAGCAGAAAGGGGGTATGGAGG + Intronic
1202107244 Y:21384299-21384321 GGACCAGAAATGATATTTGGAGG + Intronic