ID: 1034889807

View in Genome Browser
Species Human (GRCh38)
Location 7:154829824-154829846
Sequence TGAGGAGCAGAGATGGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889807_1034889811 -9 Left 1034889807 7:154829824-154829846 CCAAACACCATCTCTGCTCCTCA 0: 1
1: 0
2: 2
3: 28
4: 388
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889807_1034889810 -10 Left 1034889807 7:154829824-154829846 CCAAACACCATCTCTGCTCCTCA 0: 1
1: 0
2: 2
3: 28
4: 388
Right 1034889810 7:154829837-154829859 CTGCTCCTCATGTGGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889807 Original CRISPR TGAGGAGCAGAGATGGTGTT TGG (reversed) Intronic
901315318 1:8303465-8303487 AAGGGAACAGAGATGGTGTTGGG + Intergenic
903135155 1:21304446-21304468 TGAGGAGGAGATAAGGGGTTGGG - Intronic
904880126 1:33690138-33690160 TGGGGAGCACAGAGGGCGTTGGG - Intronic
905180344 1:36161447-36161469 TGAGTAGCAAAGCTGGGGTTTGG - Intronic
906198528 1:43944982-43945004 TGGGCAGGGGAGATGGTGTTGGG - Intergenic
906262010 1:44400129-44400151 TGAGGAGAAGAGAGGCTGGTGGG + Intergenic
906472577 1:46143574-46143596 TGAAGAGCAGGGGTGGTGGTGGG - Intronic
906628711 1:47346823-47346845 TGAGGAGGAGAGATGGGGAGGGG - Intronic
907289061 1:53401270-53401292 TGAGGAGCTGTGAGGGTGTAGGG + Intergenic
907924284 1:58941500-58941522 TTAGGAGCAGAGGTGGGATTTGG + Intergenic
909144062 1:71906355-71906377 TTAGGGGAACAGATGGTGTTTGG - Intronic
911977802 1:104523717-104523739 AGAGGAGTAAAGATGGTATTAGG + Intergenic
912815570 1:112825554-112825576 TGAGGAGCAGAGATCGTAGGTGG + Intergenic
913564237 1:120055983-120056005 AGAGGAGTAGAAAGGGTGTTGGG - Intronic
913633890 1:120737581-120737603 AGAGGAGTAGAAAGGGTGTTGGG + Intergenic
913995274 1:143647048-143647070 GCTGGAGCAGAGGTGGTGTTGGG - Intergenic
914284824 1:146215332-146215354 AGAGGAGTAGAAAGGGTGTTGGG - Intronic
914360886 1:146934994-146935016 GCTGGAGCAGAGGTGGTGTTGGG + Intergenic
914491700 1:148155643-148155665 GCTGGAGCAGAGGTGGTGTTGGG - Intergenic
914545855 1:148666071-148666093 AGAGGAGTAGAAAGGGTGTTGGG - Intronic
914620708 1:149404595-149404617 AGAGGAGTAGAAAGGGTGTTGGG + Intergenic
915028551 1:152856025-152856047 TGAGGATCAGAGATGGACTTGGG - Intergenic
915684291 1:157616062-157616084 TGAGGAATAGAGGTGGTGGTGGG + Intergenic
915943343 1:160132928-160132950 TGAGGAGGGGAGAGGGTGGTAGG + Intronic
917959904 1:180133807-180133829 GGAGGAGGAGAGAAGGTATTTGG - Intergenic
918107257 1:181425644-181425666 TGAGGCGCAGAGAAGGAGGTGGG + Intronic
919788211 1:201273745-201273767 TGAGGCTCAGAGAGGGTGTGTGG - Intergenic
919885160 1:201928343-201928365 GGAGGAGCAGAGCTGGGATTAGG - Intronic
919962043 1:202480987-202481009 TGGGGGGCAGTGATGGTTTTGGG + Intronic
920546978 1:206826401-206826423 TGAGGAGCTGGGATGGTAGTAGG + Intronic
920567631 1:206988082-206988104 TGAGGATGAGAGAGGGTGGTGGG + Intergenic
920963011 1:210680889-210680911 TGAGGGGCAAAGATGGTATAAGG - Exonic
921502309 1:215920285-215920307 TGAGGATCAAAGATGCTCTTTGG - Intronic
921586774 1:216956273-216956295 GGAGAAGGATAGATGGTGTTGGG - Intronic
923051590 1:230394413-230394435 TGGGGAGCAGAGGTGGGGTGTGG - Intronic
923298184 1:232615426-232615448 TGAGGAGCTGGGATGGGGTCGGG - Intergenic
923881750 1:238111147-238111169 TGGTGAGAAGAGGTGGTGTTTGG + Intergenic
924314961 1:242786148-242786170 TGAGTAGGAGAGAGGGTGTAGGG - Intergenic
924476210 1:244384040-244384062 TGGGGAGAACAGATGGTGTTTGG - Intronic
924699109 1:246432400-246432422 GGAGGTGGAGAGGTGGTGTTTGG + Intronic
924931066 1:248732927-248732949 GGAGGAACAGAGTTGGGGTTTGG - Intronic
1062806199 10:421416-421438 CAAGTGGCAGAGATGGTGTTTGG + Intronic
1065149574 10:22808867-22808889 TGGGGAGAACAGGTGGTGTTTGG + Intergenic
1065937694 10:30535379-30535401 TGTGGAGCAGAGTTGGGCTTTGG - Intergenic
1066482595 10:35811667-35811689 TCAGGACCAGGGATGGTGCTAGG - Intergenic
1067057806 10:43062443-43062465 TGAAGAGGAGAGAGGGTTTTAGG + Intergenic
1067285146 10:44902364-44902386 TAAGGAGCAGAGATTGGGTTTGG - Intergenic
1068708930 10:60110341-60110363 TGATGAGCAGAGTTGGTTCTAGG - Intronic
1068741938 10:60483163-60483185 TAAGTGGCAGAGCTGGTGTTTGG + Intronic
1068812547 10:61272336-61272358 TGATGAGCATAAATGGTATTTGG - Intergenic
1069831784 10:71286209-71286231 TGAGTGGCAGAGCTGGGGTTTGG + Intronic
1070190831 10:74110579-74110601 TGAGCAGCAGAGATGGGTCTTGG + Intronic
1070324480 10:75378949-75378971 TGAGGAACAGACAGGGTGGTAGG - Intergenic
1070554783 10:77519109-77519131 TGTGGAGCAGACGTGGTGTGTGG - Intronic
1070732024 10:78836086-78836108 TGAGAAGCAGAGAATGGGTTTGG + Intergenic
1070939496 10:80330898-80330920 AGAGGAGTAGAGAGGCTGTTAGG - Intergenic
1071372272 10:84963935-84963957 TGTGTGGCAGGGATGGTGTTAGG + Intergenic
1071617837 10:87093246-87093268 TGAGAAGCACAGAGGATGTTGGG - Intronic
1071726045 10:88199132-88199154 TGAGGAGAAGAGAAGTGGTTAGG + Intergenic
1071786457 10:88905833-88905855 TAAGCCTCAGAGATGGTGTTGGG - Intronic
1073622810 10:105066485-105066507 CCAGGAGCAGAGCTGGTGTGGGG + Intronic
1073794524 10:106973388-106973410 TCTGGAGCAGACAGGGTGTTGGG - Intronic
1073923296 10:108483424-108483446 TTTGGGGAAGAGATGGTGTTTGG + Intergenic
1074490832 10:113938250-113938272 GGAGGAGCGGAGATGGTGAGTGG - Intergenic
1075029302 10:119011237-119011259 TGTGGAGAGGAGATGCTGTTTGG - Intergenic
1075382469 10:122030588-122030610 TGAGGAGGGGAGATGGAGTCAGG - Intronic
1075658285 10:124175840-124175862 GGAGGGGCAGAGGTGGGGTTGGG - Intergenic
1076103937 10:127805132-127805154 TGATGTGCAGAGATAGTCTTAGG + Intergenic
1076482896 10:130796484-130796506 TAAGGAGCAGAGTTGGGGTGGGG - Intergenic
1077044766 11:539890-539912 TGAGCAGCAGGCATTGTGTTGGG + Intronic
1077145568 11:1042768-1042790 TGAGGACCAGAGCTGGGGGTGGG + Intergenic
1079141495 11:17813215-17813237 TGAGGACCAGAGATGATGAATGG + Intronic
1079428631 11:20366832-20366854 TGAGGGCAAGAGATGGCGTTTGG - Intronic
1079788117 11:24701251-24701273 TGGGCAGCAGGGATGGTGATTGG - Intronic
1080560929 11:33461857-33461879 TGAGGATTAGAGCTGGTTTTAGG + Intergenic
1080712049 11:34758096-34758118 TAAGGAGTAGAGATGATTTTAGG - Intergenic
1081392690 11:42547553-42547575 TCAGCAGCAGAAATGGTGATTGG + Intergenic
1081444974 11:43122444-43122466 TGAGGAGGAGGGATGCTGTCAGG + Intergenic
1082220426 11:49628838-49628860 TGAAGAGAAGAAATGGTATTTGG - Intergenic
1083201656 11:61124497-61124519 TGAAGACCAGGGATGGTGTTGGG - Intronic
1083269212 11:61562842-61562864 TGAGGAGATGAGAAGGAGTTGGG - Intronic
1083752155 11:64766712-64766734 TGAAGAGGAGAGCTGATGTTTGG - Intronic
1084791974 11:71480865-71480887 TGAGGAGGAGATAAGGTGTGTGG + Exonic
1085576567 11:77610185-77610207 TGAAGACTAGAGATGGTATTTGG - Exonic
1086629245 11:88996313-88996335 TGAAGAGAAGAAATGGTATTTGG + Intronic
1087122718 11:94591460-94591482 TGGAGAGCAAGGATGGTGTTTGG + Intronic
1088115479 11:106307176-106307198 TGAGGATCAGAGATTGTCTGTGG - Intergenic
1088266528 11:107992915-107992937 TGGGGAGGGGAGATGGTTTTGGG - Intergenic
1089400920 11:118164209-118164231 TGAGGAGCTGTGCTGATGTTGGG - Exonic
1089913112 11:122123775-122123797 TGAGGAGCAGAATTTGTCTTTGG + Intergenic
1090422229 11:126583353-126583375 TGAGGAGAAGACCTGCTGTTTGG - Intronic
1091153531 11:133351952-133351974 TGAAGAGTTGAGATGGTCTTTGG - Intronic
1092628273 12:10351565-10351587 TGAGGAGAACATGTGGTGTTTGG + Intergenic
1093033982 12:14315867-14315889 TGAGGAGCAGAATTGGGATTTGG - Intergenic
1093515985 12:19987435-19987457 TGAGGAACAGGGACAGTGTTTGG - Intergenic
1094133694 12:27101917-27101939 TGAGCAGTAGAGATGGTGATTGG - Intergenic
1094183837 12:27620036-27620058 TGAGCAGTAGAGATGGTGATGGG - Intronic
1095734428 12:45541167-45541189 AGAGGAGGGGAGATGCTGTTTGG - Intergenic
1098562278 12:71888186-71888208 TGAGAATCAGAGATGGGGATGGG + Intronic
1098637523 12:72802350-72802372 TGAGGAGCAGAGCTGGTCTTTGG + Intergenic
1098940099 12:76524475-76524497 TGAAGATCAGTGATGGTGTATGG - Intronic
1099248528 12:80222926-80222948 TTGGGGGAAGAGATGGTGTTTGG + Intronic
1099532184 12:83797228-83797250 AGAGGTGCAGAGTTGGTCTTTGG + Intergenic
1099871627 12:88356621-88356643 TGTGGGGGAGAGATGGTTTTGGG - Intergenic
1102648349 12:114418495-114418517 TGAGGATCAGAGAAGGAGGTGGG - Intergenic
1102655518 12:114479704-114479726 TGAGAAGCACAGAAGCTGTTGGG + Intergenic
1103724922 12:122992710-122992732 TGAGGAGCAGTGGTGGGGGTGGG + Intronic
1104104773 12:125649083-125649105 TGAGTAAGAGAGATGGTGTTAGG - Intronic
1104485973 12:129151411-129151433 TGAGGTGCAGAGAGGGGGCTGGG + Intronic
1104741612 12:131179715-131179737 TGAGGAGAACATGTGGTGTTTGG - Intergenic
1105524866 13:21167815-21167837 TTAGGGGAACAGATGGTGTTTGG - Intronic
1105617815 13:22036233-22036255 TGAGGAGGAGATATGGGATTAGG - Intergenic
1106989898 13:35406331-35406353 TGGGGGGAAAAGATGGTGTTTGG + Intronic
1107761391 13:43683244-43683266 TGAGGAACTGGTATGGTGTTGGG - Intronic
1108544455 13:51478517-51478539 TGTGGAACAGAGAGGGTGTCAGG + Intergenic
1108551797 13:51553569-51553591 TCAGGAGCAGAAATGGGGGTGGG + Intergenic
1109247713 13:59976775-59976797 TGAGAAGCTGAGATGTTGATAGG - Intronic
1112074112 13:95889909-95889931 AGAAGTGCAGAGATGATGTTAGG + Intronic
1114558021 14:23572825-23572847 TAAGGAGCAGGGAAGGTGGTAGG - Intronic
1114731207 14:24994503-24994525 GGAGGAGCAGAGATGGTTAGGGG - Intronic
1115945808 14:38658940-38658962 TGAAGCGCAGAGATGGTGAAGGG - Intergenic
1117614550 14:57520102-57520124 TTAGGGGAACAGATGGTGTTTGG + Intergenic
1118908908 14:70045239-70045261 TTGGGAGGAGTGATGGTGTTGGG - Exonic
1119433893 14:74585670-74585692 TGAGCAGGAGAGTAGGTGTTGGG - Intronic
1121052501 14:90828666-90828688 TGTGGAACAAAGCTGGTGTTCGG - Intergenic
1121431288 14:93890193-93890215 TGCAGAGCAGAGATGCTGCTGGG - Intergenic
1121525669 14:94617305-94617327 AGAGAAGCTGAGATGGTCTTTGG + Intronic
1122674805 14:103403041-103403063 TGAGGGGCAGGGATGGGGTGGGG - Intronic
1122859126 14:104574433-104574455 TGGGAAGCAGAGCTGGTGTCTGG - Intronic
1124400699 15:29345359-29345381 CGGGGAGCAGAGATGGGGCTGGG + Intronic
1125674922 15:41496600-41496622 GGAGGAAAAGAGAGGGTGTTTGG + Intronic
1127037652 15:54936331-54936353 TTAGGGGCAAAAATGGTGTTTGG - Intergenic
1127615240 15:60678212-60678234 TGTGGAGCAGAGATGCTGACTGG - Intronic
1128331313 15:66757463-66757485 AGAGGCCCAGAGATGGTGTGGGG + Intronic
1128451335 15:67807459-67807481 TGAGGAGCAGGGGTGGGGCTGGG - Intergenic
1128671711 15:69578608-69578630 GGAGGAGCAGATATGGTGTAGGG + Intergenic
1131046919 15:89322320-89322342 TGGCGAGCAGAGTGGGTGTTGGG - Intronic
1132951181 16:2563264-2563286 CGAGGAGAGGAGATGGTGATGGG + Intronic
1132963169 16:2636906-2636928 CGAGGAGAGGAGATGGTGATGGG - Intergenic
1133114682 16:3570584-3570606 GGAGGAGCAGAGGTGGTAATTGG + Intronic
1134419190 16:14070768-14070790 TGAGGTGCAGAAATGGGTTTTGG + Intergenic
1137629323 16:49931121-49931143 AGAGGAGCACAGATGTTGCTGGG - Intergenic
1138093461 16:54194599-54194621 TGGGGAGCAGAGACGGAGCTGGG - Intergenic
1138108133 16:54301841-54301863 TGAGAAGCAGAGCTGGGATTTGG - Intergenic
1138351425 16:56348043-56348065 TGGGCAGCAGTGATGGGGTTGGG - Exonic
1138959461 16:62011311-62011333 TGAGGAACTGAGCTGGTGGTAGG + Intronic
1139430003 16:66906035-66906057 TGAGGATCAGAGAGGGGGTGTGG - Intergenic
1141615952 16:85209521-85209543 TGTGGGGCAGCGATGGTGATGGG - Intergenic
1143438363 17:6948161-6948183 TGCTGAGCAGAGGTGGTGGTAGG - Intronic
1143871226 17:9958606-9958628 TGAGGAGCAGAGGTGGAGTGTGG + Intronic
1144129516 17:12232520-12232542 GGAGGAGCAGAGAAGTTGGTTGG + Intergenic
1144136173 17:12297219-12297241 AGAGGAGCACAGAAGGGGTTCGG - Intergenic
1144376153 17:14644154-14644176 TCTGGAGCACAGGTGGTGTTTGG - Intergenic
1144376293 17:14645409-14645431 TTTGGAGCACAGGTGGTGTTTGG - Intergenic
1145249272 17:21288441-21288463 TGAGGAGCAGAGGTGGTGCAGGG + Intronic
1145942268 17:28748814-28748836 TGAGGAAGACAGAGGGTGTTAGG - Intronic
1146393334 17:32442899-32442921 TGAGGAGGGGGGATGGTTTTGGG - Intergenic
1146936210 17:36814085-36814107 TGAGGAGCGGAGTGGGCGTTGGG + Intergenic
1147145602 17:38482705-38482727 AGAGGGGCTGAGATGGTGTGTGG + Intronic
1150432432 17:65129162-65129184 TAAGGAGCTGAGAGGGTGATAGG - Intergenic
1151346757 17:73507161-73507183 ATAGGAGCAGAGGTGGTGTTGGG - Intronic
1151879796 17:76888084-76888106 AAAGGAGCAGAGCTGGGGTTGGG - Intronic
1152409709 17:80117264-80117286 TGAGGAGCGGAGAGGCTGATGGG - Intergenic
1152469406 17:80482537-80482559 TGAGGGGCAGACCAGGTGTTGGG + Intergenic
1155409740 18:25530554-25530576 TGAGGGACAGAAATGGTCTTTGG - Intergenic
1157450716 18:47785619-47785641 TGAGGAGTGGAGCTGGAGTTGGG - Intergenic
1158052976 18:53246013-53246035 TGAGTAGCAGACATGGTGTTAGG - Intronic
1158431767 18:57394843-57394865 TGAGGAGAACATGTGGTGTTTGG + Intergenic
1158611745 18:58946731-58946753 TGAGAAGCAGACAAGGTTTTCGG - Intronic
1159559673 18:69980222-69980244 AGAAGAGAAGAGGTGGTGTTTGG - Intergenic
1160815253 19:1032474-1032496 AGCGGAGCAGGGATGGTGCTGGG + Intronic
1161061256 19:2216256-2216278 GCAGGAGGAGAGATGGTGTCAGG - Intronic
1161498400 19:4599469-4599491 TGAGGCTCAGAGAAGCTGTTAGG - Intergenic
1161791389 19:6362109-6362131 CGAGGAGCAGAGAAGGGGTGAGG - Intronic
1163577630 19:18119973-18119995 TGTGGAGCAGAGCTGTTGCTGGG + Intronic
1163698226 19:18774648-18774670 TGAGGAGAGGAGATGGGGATGGG + Intronic
1163906876 19:20155744-20155766 AGAAAAGCAGAGAAGGTGTTGGG - Intergenic
1164588193 19:29490753-29490775 TGAGGAACAGAGACAGTGTCAGG - Intergenic
1165690093 19:37856236-37856258 ATAGGAGCAGAGATGGTACTTGG + Intergenic
1165853885 19:38868808-38868830 GGAGGAGCAGAGTGGGTATTAGG - Intronic
1165890000 19:39106118-39106140 TGAGGAGCAGAGAGGATGCCAGG - Intronic
1166836009 19:45668410-45668432 AGATGAGCAGAGATGGTGGTGGG - Intronic
1166901411 19:46066940-46066962 AGAGGAGCTGAGATGGTTTTAGG - Intronic
1167548509 19:50143704-50143726 TGAGGATCAGGGATGGGGTCTGG - Intergenic
925343613 2:3154034-3154056 TGAGGAGCAGGGCTGGAGGTGGG - Intergenic
927924821 2:27004180-27004202 TGAGAGGCAGAGCTGGAGTTGGG + Intronic
928100708 2:28436063-28436085 TCTGGAGCAGAGTTGGTTTTAGG + Intergenic
928627625 2:33157038-33157060 TGAAGAGCAGAGGTTTTGTTTGG + Intronic
928871020 2:35979676-35979698 TGAGGATGAGAGATGGAGCTAGG - Intergenic
929363265 2:41120704-41120726 TGTGGAGCAGAGAAGAAGTTAGG + Intergenic
930628710 2:53728097-53728119 TGAAGAGCATATCTGGTGTTTGG + Intronic
931156187 2:59633321-59633343 TGAGGAGAAGACATGAAGTTGGG - Intergenic
932263667 2:70347722-70347744 TGAGGACCAGGGGTGGGGTTGGG + Intergenic
932631828 2:73351341-73351363 GGAGGAGGAGAGATTGTGGTTGG - Intergenic
933429435 2:82156776-82156798 TGGGGAGCAGGGATGGGGTGGGG - Intergenic
934790793 2:97058432-97058454 TGAGGAACAGATATGGCCTTGGG + Intergenic
934818635 2:97352732-97352754 TGAGGGGCAGAGATGGCCATGGG + Intergenic
934855644 2:97727824-97727846 TGAGGAAGAGAGATGGGGGTGGG - Intronic
935583706 2:104782449-104782471 TGGGGAGCAGCAATGGTGATGGG + Intergenic
936547327 2:113403955-113403977 TGAGGGGCAGAGATGGGAATGGG + Intergenic
936925415 2:117731476-117731498 GCAGGTGCAGAGATGCTGTTTGG - Intergenic
937434267 2:121867341-121867363 TAAGGGGCAGAGCTGGGGTTGGG + Intergenic
938368660 2:130755610-130755632 GGAGGAGCAGAAATGCTGTGGGG - Intronic
939478482 2:142717103-142717125 TGTGGAGCGGAGATGGTGATTGG - Intergenic
940438852 2:153689812-153689834 TGAGGAGCGGGAATGGTGGTGGG + Intergenic
941456360 2:165715040-165715062 AGAAAAGCAGAGAAGGTGTTGGG + Intergenic
941491368 2:166145961-166145983 TGAGGAGCAGAGATGGGATGGGG + Intergenic
942035083 2:172002965-172002987 TAAGGAGCAGAAATGGTGAGAGG - Intronic
942877614 2:180820351-180820373 TGAGGAACAGAGAAGGTGGATGG + Intergenic
944242903 2:197502488-197502510 TGAGGAGCTGTCATGGAGTTAGG + Intronic
945071073 2:205989511-205989533 TGAGGAGCAGAGAAGCTAATGGG - Intergenic
946373287 2:219293747-219293769 AGAGGAGCAGAGCTGGGGGTGGG - Intronic
946695887 2:222358963-222358985 TGAGGAGGAGATATGGTGCTGGG + Intergenic
947444929 2:230156385-230156407 TGAGGAGGGGAGATGGGGTGGGG - Intergenic
948264420 2:236626687-236626709 TGAGAAGCAGAGCTGATGTCTGG + Intergenic
1169969419 20:11253189-11253211 AGAGAAGCAGAGATGGTAGTGGG + Intergenic
1170616627 20:17957981-17958003 TGACGGGCAGAAATGGAGTTAGG - Intronic
1171205566 20:23277173-23277195 TGAAGAACAGATATTGTGTTAGG - Intergenic
1172587901 20:36097678-36097700 TGGAGGACAGAGATGGTGTTTGG + Intronic
1173031209 20:39362173-39362195 TGAGGAGCTGAGAAGGGCTTTGG - Intergenic
1173307912 20:41868364-41868386 TGAAGATCAGAGATGGTCATAGG - Intergenic
1173578449 20:44129073-44129095 TGAGGAGTAAGGGTGGTGTTGGG + Intronic
1173846209 20:46190330-46190352 TCAGCAGCAGAGCTGGGGTTGGG + Intronic
1174124891 20:48297144-48297166 CGAGGTGCAGAGATGGAGATGGG - Intergenic
1174273609 20:49387311-49387333 TGAGGAGCACAGGAAGTGTTAGG + Intronic
1175449037 20:59046812-59046834 TGAGGAGACGAGAAGGTGTTAGG - Intergenic
1175485131 20:59340344-59340366 TGATGAGCAGGGAGGGTGTCAGG + Intergenic
1175598863 20:60256599-60256621 TGGTGAGCAGAGATGGGGTCTGG + Intergenic
1175855481 20:62118716-62118738 TGAGGCCCAGGGAGGGTGTTCGG - Intergenic
1178852885 21:36227888-36227910 TGAGGGGCAGAAATGGTTCTGGG + Intronic
1179362921 21:40729250-40729272 TGAGGAACAGAGCTGGGATTTGG + Intronic
1180222219 21:46366185-46366207 TGAGGAGCAGAGATTACCTTGGG + Intronic
1182732098 22:32503886-32503908 TGGGGCGCAGAGATGAGGTTGGG - Intergenic
1182774999 22:32824389-32824411 TGAGCAGCTGAGATGCTTTTAGG + Intronic
1183257129 22:36769797-36769819 TCAGGAGCAGAGCTGAAGTTGGG - Intronic
1183767971 22:39896926-39896948 TGAGAAGGAGAAATGGTGTCCGG - Intergenic
1184081314 22:42222523-42222545 GGAGAAGCAGAAATTGTGTTGGG - Intronic
1184264018 22:43337186-43337208 TGAGCAGCAGAGCTGGGCTTGGG + Intronic
1185109717 22:48894188-48894210 TGAGGCTCAGAGATGGTGTGAGG - Intergenic
949404805 3:3702961-3702983 GGAGGGGCAGAGATGCAGTTTGG + Intronic
950077770 3:10199416-10199438 TGAGAAGCAGAGATGTTGTGAGG + Intronic
952282625 3:31938334-31938356 AGAGGAACAGAGAAGGTGATAGG - Intronic
952627551 3:35425141-35425163 TGAGCTGCATAGATTGTGTTTGG - Intergenic
952883501 3:37999273-37999295 GGCGGGGCGGAGATGGTGTTGGG + Intronic
952893488 3:38060542-38060564 TTGGGAGCTGAGAAGGTGTTTGG + Intronic
953146979 3:40286883-40286905 TAAAGAGAAGAGATGGTGATTGG - Intergenic
953642242 3:44719729-44719751 CAAGGAGCTGAGATAGTGTTAGG - Intronic
953674656 3:44991445-44991467 TGAGGAGCAGACAATGTGTGAGG + Intronic
953956579 3:47236271-47236293 TGAGGGCCAGAGATGGAGATGGG - Intronic
953980396 3:47410493-47410515 GGAGGAGCAGGGGTGGGGTTTGG - Exonic
954701618 3:52453593-52453615 TGAGGGGCAGAAATGGGGGTTGG + Intronic
955387287 3:58489975-58489997 TGAAGAGCAGTGATGGTAATGGG - Intergenic
955794872 3:62624991-62625013 TGATGAGCAGAGAGGGTGTGTGG + Intronic
956224719 3:66944438-66944460 TGAGGGGAACAGGTGGTGTTTGG - Intergenic
958661357 3:97071749-97071771 TGAGGGGAACAGGTGGTGTTTGG + Intronic
958721827 3:97853034-97853056 TTAGTAGCACAGGTGGTGTTTGG + Intronic
958946823 3:100371756-100371778 GGAGGAGGAGGGATGGTTTTGGG + Intronic
959080074 3:101791063-101791085 AGAGGAGCAGAGAGGGTACTGGG - Intronic
959557637 3:107740233-107740255 TTATGAGAAGAGATGGTTTTGGG - Intronic
959644117 3:108678341-108678363 TGGGGAGTGGAGATGGTTTTGGG - Intronic
961486765 3:127222268-127222290 TGGGGGGCTGAGGTGGTGTTAGG + Intergenic
961711787 3:128833733-128833755 AGAAAAGCAGAGAAGGTGTTGGG + Intergenic
962969411 3:140385093-140385115 TGAGCAGCAGGGTTGGTGGTAGG + Intronic
963393410 3:144699444-144699466 TGAGGAGTAAAGGTGGAGTTAGG - Intergenic
964076203 3:152695217-152695239 TTTGGAGAACAGATGGTGTTTGG - Intergenic
964277329 3:155022306-155022328 TGAGGGGCAGATATGGATTTGGG - Intergenic
964343097 3:155729346-155729368 AAAGGAGGAGAGATGATGTTTGG - Intronic
966169596 3:177063845-177063867 AGAGGGGCAGTGATGGTGCTTGG + Intronic
966324406 3:178738233-178738255 TGAAGAGCAGACTTGGTGTGGGG - Intronic
966532592 3:180997407-180997429 TGAGGGACAGAGATGGGATTTGG - Intergenic
968137198 3:196228018-196228040 TGAGGAGCAGAGCTAGGGCTGGG - Intronic
970504053 4:16708817-16708839 TGAGGAGAAAAGCAGGTGTTGGG - Intronic
972143657 4:35994365-35994387 TGGGCAGGAGAGATGGTGATGGG + Intronic
972520277 4:39848086-39848108 TGAGGTGGAGAGATGGTTTCAGG - Intronic
972981018 4:44701459-44701481 TGAGGAGCTAAGCTGCTGTTAGG - Intronic
973586498 4:52397629-52397651 TGAGGTACAGGGATGGTTTTGGG - Intergenic
973685134 4:53362163-53362185 TGAGGAGCAGGAATGATGTGAGG + Intronic
974282974 4:59823452-59823474 TGAGGAGCTGGTATGGTATTTGG + Intergenic
974769244 4:66389421-66389443 TGAGGAGCCGAGATGGCACTGGG - Intergenic
974894782 4:67926495-67926517 GGAGTAGCAGTGATGGTGGTGGG + Intronic
974896296 4:67943488-67943510 GGAGGAGTAGAGAAGGTATTTGG + Intronic
975293630 4:72706806-72706828 GGAGGAGCAGAGCTGATGTCCGG + Intergenic
976505272 4:85838823-85838845 TGAAGAACAGAGCAGGTGTTTGG - Intronic
978632736 4:110766011-110766033 TGATGATCAAACATGGTGTTGGG - Intergenic
978639239 4:110849564-110849586 TGAGGAAGAGAGATGCTGGTAGG + Intergenic
980545969 4:134261550-134261572 TGAGTATCAGAGATGTTGTGGGG + Intergenic
984826804 4:183932200-183932222 GGAGGAGCAGCTATGGGGTTGGG + Intronic
986309773 5:6543465-6543487 TGAGTAGGTGAGATGGTGTGGGG - Intergenic
989124420 5:38037760-38037782 TTAGGAGCAGATGTGGTGTATGG + Intergenic
989394529 5:40939967-40939989 TGAGGAACAGAGATGTTTTGAGG + Intronic
990575172 5:57116999-57117021 AGAGGAGCAGGGATGGGGTAGGG + Intergenic
992220021 5:74562588-74562610 TTTGGAGAATAGATGGTGTTTGG - Intergenic
994042294 5:95272944-95272966 TGAGGAACAGTAATGGGGTTTGG - Intronic
994368481 5:98943555-98943577 TGAGGATCCGAGATGGTATAGGG + Intergenic
995188826 5:109299070-109299092 TGATGTGCAGAGGTGGTGCTGGG - Intergenic
996156713 5:120111560-120111582 TGAGGAGGAGAAAGGCTGTTAGG + Intergenic
997275776 5:132587306-132587328 TGAGGACAGGACATGGTGTTTGG + Intronic
997639430 5:135438978-135439000 TGAGGTTCACAGATGATGTTGGG - Intergenic
998251523 5:140556971-140556993 TGAGCAGCAGAGAAGGGGCTCGG + Intronic
999539631 5:152557367-152557389 TGAGTAGCAGAGATGCAGTCAGG - Intergenic
1000038226 5:157465137-157465159 TGAGGTGCAGAGATGAAGTCAGG + Intronic
1000039396 5:157473922-157473944 TGAGGAGCAAAGTTGGGATTTGG + Exonic
1000145583 5:158450115-158450137 TGAGGAGCTGAGAGGGCCTTGGG + Intergenic
1000272033 5:159695222-159695244 TTTGGAGAACAGATGGTGTTTGG - Intergenic
1001430239 5:171655133-171655155 TGAGGAGGATAGATAGAGTTGGG + Intergenic
1001667100 5:173442408-173442430 TCAGGAGCAGAGCTGGAGTCTGG + Intergenic
1002386496 5:178871043-178871065 TGAAGAGAAGAGATGTTGGTAGG - Intronic
1002669550 5:180855563-180855585 TGAGGACCTGAGACGGTGTGTGG - Intronic
1002680058 5:180954686-180954708 TGAGTGGCAGAGATGCTGGTAGG + Intergenic
1003857341 6:10289969-10289991 TGAGGGGCAGTGATGTGGTTTGG - Intergenic
1004494842 6:16153974-16153996 GGAGGAGAAGAGAGGGTGCTGGG - Intergenic
1004687027 6:17956529-17956551 TAAGCAGCAAAGGTGGTGTTAGG + Intronic
1006029977 6:31171334-31171356 TGAGGAGCTGAGAGGGTGACTGG - Intronic
1006224238 6:32522510-32522532 GAAGGAGCAGAGATTGTCTTTGG - Intronic
1006230831 6:32584706-32584728 AGAGGAGCAGAGAGTGTCTTTGG - Intronic
1006640682 6:35488151-35488173 GGAGCAGCAGAGAAGGTGCTTGG + Intronic
1007272373 6:40648183-40648205 TTGGGAGCTGAGATGTTGTTGGG + Intergenic
1007431324 6:41779179-41779201 TAAGGAGAAGAGATGGTGATAGG - Intronic
1007630720 6:43271874-43271896 TGAGCAGCTGAGATGGGGGTGGG - Intronic
1008050962 6:46899790-46899812 TGAGGAGCAGTGATGGCAATGGG + Intronic
1008718775 6:54323010-54323032 TTAGGAGCACAGAGGTTGTTGGG + Intronic
1010951534 6:82042482-82042504 AGAGGAGCAGAGTGAGTGTTAGG - Intergenic
1011250067 6:85361875-85361897 AGAGGACCAGAGATGGTGTGTGG + Intergenic
1011365391 6:86576087-86576109 TTTGAAGAAGAGATGGTGTTTGG + Intergenic
1012879216 6:104765170-104765192 TGATGAGCAGAGCAGTTGTTAGG + Intronic
1013656943 6:112255726-112255748 TGGAAAGCAGAGATGGGGTTTGG + Intergenic
1013733457 6:113198647-113198669 TGAAGATCAGAGATGAAGTTAGG - Intergenic
1013930772 6:115529776-115529798 TGAGGGGAACAGATGGAGTTTGG + Intergenic
1014468802 6:121789105-121789127 TCAGATGCTGAGATGGTGTTTGG + Intergenic
1016514662 6:144880758-144880780 TCAGGATGAGAGATGGGGTTTGG - Intergenic
1016660069 6:146567950-146567972 AAAGAAGCAGAGCTGGTGTTGGG - Intergenic
1017412922 6:154188036-154188058 TAAGTAGCAGATATAGTGTTTGG + Intronic
1017766636 6:157612277-157612299 TGAGGAGCAGAGTGGATGGTGGG - Intronic
1018066630 6:160129111-160129133 TGGGGAGAACAGAGGGTGTTGGG - Intronic
1018328313 6:162698698-162698720 AGAGAAGCAGAGATGCTGGTTGG - Intronic
1019195142 6:170276907-170276929 AGAGCAGCAGAGACTGTGTTTGG - Intergenic
1019484832 7:1284739-1284761 TGAGGAGCAGCGATGGAGTGTGG - Intergenic
1019529358 7:1495844-1495866 TGGGGAGGGGAGGTGGTGTTTGG - Intronic
1020908793 7:14101931-14101953 AAAGGAGCAGAGAAGGTGCTGGG - Intergenic
1022041580 7:26586886-26586908 TTAGGAGCAGAGGTGGGGCTGGG - Intergenic
1022302882 7:29118162-29118184 TGGGTAGCAGAGATGGGTTTAGG - Intronic
1022887933 7:34665514-34665536 AGAGGAGTAGAGAAGGTGATTGG - Intronic
1023130515 7:36998112-36998134 TGAAGAGAAGAGATGGGGGTGGG + Intronic
1023144782 7:37139675-37139697 TGAAGAGCAGTGGTGGTATTTGG - Intronic
1023305245 7:38819099-38819121 TGAGGAGCAGAGGAGATGTTTGG - Intronic
1023777306 7:43620114-43620136 TGTGGAGCAGAGAGGGCATTTGG + Intronic
1024480077 7:49853458-49853480 TGGAGGGCAGAGATGGGGTTTGG - Intronic
1028462643 7:91113218-91113240 TGAGGAGCAGAGTTGGCAATTGG + Intronic
1028582008 7:92418241-92418263 TGAGAAGCAGACATGGAGTTGGG - Intergenic
1028716441 7:93976701-93976723 TTCGGAGAATAGATGGTGTTTGG + Intronic
1028728861 7:94121893-94121915 GAAGGAGCAGAGGTGTTGTTTGG - Intergenic
1029027883 7:97436964-97436986 TGAAGATCAGGGATGGTGTGTGG - Intergenic
1029260775 7:99301436-99301458 TGAGGAACAGACCTGGTCTTGGG - Intergenic
1030259048 7:107543682-107543704 TGCGGGGCAGACCTGGTGTTTGG - Intronic
1031974955 7:128087757-128087779 TGGGGAGGAGAGAGAGTGTTAGG + Intronic
1033628922 7:143138619-143138641 AGAGGAGCACAGATGGGGCTTGG + Intronic
1033772444 7:144567296-144567318 TGAGAAACAGTTATGGTGTTAGG - Intronic
1034666273 7:152820933-152820955 TGAGGAGAAGTGTGGGTGTTGGG - Intronic
1034835868 7:154351337-154351359 AGAAGAGAAGAGATGGTGGTGGG - Intronic
1034889807 7:154829824-154829846 TGAGGAGCAGAGATGGTGTTTGG - Intronic
1037316458 8:17604016-17604038 TTAGGAGGAGAGATGATGATGGG + Intronic
1037416152 8:18652011-18652033 TGAAGAGGAAAGATGCTGTTTGG + Intronic
1037987212 8:23297605-23297627 AGAGGAGGAGAAATGGGGTTCGG + Exonic
1038848717 8:31253949-31253971 TGAGGCACAGAGCTGGTGCTTGG + Intergenic
1039313940 8:36351276-36351298 TGAGAAGCTGAGATGGTGTGAGG - Intergenic
1039381123 8:37086374-37086396 TGACGACCAGAGAAGGTGCTAGG - Intergenic
1042949348 8:74184996-74185018 TCAAGAGCACAGATGGGGTTTGG - Intergenic
1043006923 8:74831381-74831403 TGTGGAGCAGACATGATGCTAGG - Intronic
1043141970 8:76602020-76602042 TAAGGAGGAGAGATGGAGTGGGG + Intergenic
1043551530 8:81378652-81378674 TTAGGAGCAGAGATGTTGGCAGG - Intergenic
1043648054 8:82548045-82548067 TCAGAAGCAGAGATGGTGGGAGG + Intergenic
1043949003 8:86286924-86286946 TGAGAAACAGAGTTGATGTTGGG + Intronic
1044863076 8:96542226-96542248 GGAGGAGCAGAGCTGGATTTAGG - Intronic
1045322805 8:101094851-101094873 TGAGGGTCAGAGCTGGTGCTCGG - Intergenic
1045697173 8:104822681-104822703 TGAAGATCAGAGAGGGTATTGGG + Intronic
1045935891 8:107678234-107678256 TGGGGAGCAGAGATTATGATAGG + Intergenic
1049006056 8:139856353-139856375 TGGGGAGCAGAGATGGCTTCAGG - Intronic
1049329284 8:142041478-142041500 GCAGGAGCAGTGATGGTTTTTGG + Intergenic
1049663960 8:143834894-143834916 TGAGGAGCAGGGAGGATGTGGGG + Exonic
1050858928 9:10398674-10398696 TGAGGAGCAGAGAAAGTAATCGG + Intronic
1051741915 9:20260676-20260698 TGTGGAGAACAGGTGGTGTTTGG + Intergenic
1052112042 9:24597925-24597947 TGCAGAGCAGAGATAGAGTTAGG + Intergenic
1052376962 9:27728496-27728518 AGAAGAGCAGAGAAGGTGGTGGG + Intergenic
1052551383 9:29954552-29954574 TGGGGAAAAGACATGGTGTTGGG - Intergenic
1052560653 9:30079123-30079145 TGAGGATCAGAGAAAGTGCTTGG + Intergenic
1052827987 9:33191048-33191070 TGGTTAGCAGAGATGGAGTTCGG + Intergenic
1053054721 9:34987811-34987833 TGAGGCACAGAGATGGGGTGAGG - Intergenic
1053066946 9:35075610-35075632 TGGGTAGCAGAGATGATGTGCGG + Exonic
1053178741 9:35949411-35949433 TTAGGAGCAGAAAGGGTGTGAGG - Intergenic
1055364505 9:75528150-75528172 GAAGGAGCAGAGAGGGTGGTAGG + Intergenic
1055787270 9:79884257-79884279 GGAGGAGCAGAGAGGGTGGTAGG + Intergenic
1056942425 9:90966934-90966956 TGTGGGGCAGAGATGGCATTGGG + Intergenic
1057696097 9:97323927-97323949 TGGGGAGCTGAGGTGGGGTTGGG + Intronic
1059527486 9:115006071-115006093 TGAGGAGCAGAGATGTTGAAAGG - Intergenic
1059529447 9:115022450-115022472 GGAGGAGCAGAGCTGGAGCTGGG + Intronic
1060278755 9:122201734-122201756 TGAGGAGCAGAAATGGAATCAGG + Intergenic
1060846663 9:126842742-126842764 TGAGGAGCTGAGATCCTGTCAGG - Intergenic
1060907673 9:127322250-127322272 TGGGAAGCAGAGTTGGTGTGGGG - Intronic
1062216133 9:135390783-135390805 TGTGCACCAGACATGGTGTTGGG + Intergenic
1062227660 9:135462482-135462504 TGAGGAGCAGAGAAGGGGACTGG - Intergenic
1185722629 X:2394564-2394586 TGAGGATAAGAGTTGGAGTTGGG + Intronic
1187015469 X:15323368-15323390 TTAGGAGCAGAGATAGAATTGGG - Intronic
1187455015 X:19433494-19433516 TGAGAACCAGGGATGCTGTTGGG - Intronic
1189911979 X:45819185-45819207 TGAGTAGAAGAGATGATGGTAGG - Intergenic
1190383482 X:49862162-49862184 TGAGGGGCAGAGATGAAATTTGG + Intergenic
1190708372 X:53048817-53048839 GCAGCAGCAGAGGTGGTGTTGGG - Intergenic
1190753168 X:53379938-53379960 AGAGGAACAGAGGTGATGTTAGG - Exonic
1192775471 X:74240209-74240231 GGAGCATCAGAGAAGGTGTTTGG - Intergenic
1193077537 X:77371016-77371038 TGAGGACCATAGATGTTGCTAGG - Intergenic
1193365303 X:80624388-80624410 TTAGGAACTGAGATGGTTTTAGG + Intergenic
1194405494 X:93491698-93491720 TAAGGAGCAGAGATGGGATAAGG - Intergenic
1197708415 X:129649983-129650005 TGTGGAGATGAGATGGTGCTGGG + Intronic
1198463587 X:136885152-136885174 TGAGGAGGAGGGATGGGATTCGG - Intergenic
1198991869 X:142523864-142523886 TGAGGAGAAGAGATGTGGTCAGG + Intergenic
1199048799 X:143210610-143210632 TGGGGAGAATAGGTGGTGTTTGG + Intergenic
1199154632 X:144532994-144533016 AGTCGAGCTGAGATGGTGTTAGG - Intergenic
1200147196 X:153932440-153932462 AGAAGAGCAGAGATGGGGTGAGG + Intronic
1200300289 X:154967489-154967511 TGAGGAACAGGGAAGGTTTTAGG + Intronic
1201697809 Y:16845902-16845924 TGGGGAAAACAGATGGTGTTTGG + Intergenic