ID: 1034889811

View in Genome Browser
Species Human (GRCh38)
Location 7:154829838-154829860
Sequence TGCTCCTCATGTGGAATCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034889805_1034889811 -3 Left 1034889805 7:154829818-154829840 CCACCACCAAACACCATCTCTGC 0: 1
1: 0
2: 3
3: 93
4: 801
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889800_1034889811 11 Left 1034889800 7:154829804-154829826 CCTCCCACCCTTCACCACCACCA 0: 1
1: 1
2: 32
3: 260
4: 1777
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889804_1034889811 3 Left 1034889804 7:154829812-154829834 CCTTCACCACCACCAAACACCAT 0: 1
1: 0
2: 15
3: 136
4: 889
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889806_1034889811 -6 Left 1034889806 7:154829821-154829843 CCACCAAACACCATCTCTGCTCC 0: 1
1: 0
2: 2
3: 31
4: 338
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889803_1034889811 4 Left 1034889803 7:154829811-154829833 CCCTTCACCACCACCAAACACCA 0: 1
1: 0
2: 7
3: 68
4: 465
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889796_1034889811 30 Left 1034889796 7:154829785-154829807 CCTCCATCCTGCTCAAAGCCCTC 0: 1
1: 0
2: 6
3: 63
4: 702
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889798_1034889811 23 Left 1034889798 7:154829792-154829814 CCTGCTCAAAGCCCTCCCACCCT 0: 1
1: 0
2: 3
3: 32
4: 346
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889802_1034889811 7 Left 1034889802 7:154829808-154829830 CCACCCTTCACCACCACCAAACA 0: 1
1: 0
2: 13
3: 81
4: 711
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889807_1034889811 -9 Left 1034889807 7:154829824-154829846 CCAAACACCATCTCTGCTCCTCA 0: 1
1: 0
2: 2
3: 28
4: 388
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889799_1034889811 12 Left 1034889799 7:154829803-154829825 CCCTCCCACCCTTCACCACCACC 0: 1
1: 1
2: 21
3: 207
4: 1724
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889801_1034889811 8 Left 1034889801 7:154829807-154829829 CCCACCCTTCACCACCACCAAAC 0: 1
1: 0
2: 4
3: 53
4: 567
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data
1034889797_1034889811 27 Left 1034889797 7:154829788-154829810 CCATCCTGCTCAAAGCCCTCCCA 0: 1
1: 0
2: 3
3: 55
4: 551
Right 1034889811 7:154829838-154829860 TGCTCCTCATGTGGAATCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034889811 Original CRISPR TGCTCCTCATGTGGAATCTA GGG Intronic
No off target data available for this crispr