ID: 1034890934

View in Genome Browser
Species Human (GRCh38)
Location 7:154838665-154838687
Sequence GGTCTTGCACGTGCGTCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034890934_1034890938 -10 Left 1034890934 7:154838665-154838687 CCTAAGGACGCACGTGCAAGACC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1034890938 7:154838678-154838700 GTGCAAGACCGGATAACGGGAGG No data
1034890934_1034890941 18 Left 1034890934 7:154838665-154838687 CCTAAGGACGCACGTGCAAGACC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1034890941 7:154838706-154838728 TGTGTGCACCTGGAGAACAGAGG No data
1034890934_1034890940 8 Left 1034890934 7:154838665-154838687 CCTAAGGACGCACGTGCAAGACC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1034890940 7:154838696-154838718 GGAGGCTTTGTGTGTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034890934 Original CRISPR GGTCTTGCACGTGCGTCCTT AGG (reversed) Intronic
901612054 1:10506491-10506513 GGTCTTGAACTTGCGACCTCAGG + Intronic
918848828 1:189656666-189656688 GGTCTTGCAAGAGAGTTCTTTGG - Intergenic
1065511343 10:26481242-26481264 GTTCTTGCACTTGAGTCCTGGGG + Intronic
1068424966 10:56847915-56847937 GGAATTGCACCTGCATCCTTCGG - Intergenic
1077240776 11:1509292-1509314 GGTCATGCACGTGCCCCCTGAGG + Intergenic
1081445167 11:43124235-43124257 GTTCTTGCACTTGCTTCCTTAGG - Intergenic
1083468552 11:62866011-62866033 GGTCTTGTAAATGTGTCCTTCGG + Intronic
1083960990 11:66015072-66015094 GGTGTGGCATGTGGGTCCTTGGG - Intergenic
1088583995 11:111343921-111343943 GGTCTTGAACTTGTGTCCTCAGG + Intergenic
1090944617 11:131418962-131418984 GGTCTTGTAAGTGCGTACCTTGG - Intronic
1091656764 12:2351771-2351793 GGTTCTGCAGGTGCTTCCTTGGG + Intronic
1092112992 12:5977238-5977260 GGTCTTGCCAGTGTGTCTTTGGG - Intronic
1093606925 12:21103252-21103274 GATCTTGCACGTCCATACTTAGG + Intronic
1094587258 12:31788881-31788903 GGTTTTGAACTTGGGTCCTTAGG - Intergenic
1100372098 12:93977866-93977888 GGTCTTGCAGGTACGGACTTGGG + Intergenic
1102316165 12:111889479-111889501 TGACTTACACGTGGGTCCTTTGG + Intronic
1122409319 14:101517937-101517959 GGGCTTCCAGGTGTGTCCTTTGG + Intergenic
1128780103 15:70353671-70353693 CTTCTTGCACATGGGTCCTTTGG + Intergenic
1128788570 15:70415974-70415996 AGTGTTGCACGTGCGTGCTCCGG + Intergenic
1131413125 15:92227558-92227580 GGTCTTGTAGCTGCATCCTTTGG - Intergenic
1133074149 16:3266837-3266859 GGTCTGGGACGTGTTTCCTTCGG - Intronic
1133761696 16:8803898-8803920 GGTCTTGAACTTGCGACCTCAGG + Intronic
1142598310 17:1040192-1040214 GGTCCTGCGCGTGCGTCCTGGGG - Intronic
1143205471 17:5137301-5137323 GGTTTTGCTTGTGTGTCCTTCGG - Intronic
1144876511 17:18399994-18400016 GGTTTTGCTTGTGTGTCCTTCGG - Intergenic
1145155715 17:20544426-20544448 GGTTTTGCTTGTGTGTCCTTCGG + Intergenic
1146161224 17:30560296-30560318 GGTCTTGCTTGTGTGTCCTTTGG - Intronic
1146843158 17:36168493-36168515 GGTTTTGCTTGTGTGTCCTTTGG + Intronic
1146855468 17:36256434-36256456 GGTTTTGCTTGTGTGTCCTTTGG + Intronic
1146865153 17:36331941-36331963 GGTTTTGCTTGTGTGTCCTTTGG - Intronic
1146871374 17:36380345-36380367 GGTTTTGCTTGTGTGTCCTTTGG + Intronic
1146878734 17:36431427-36431449 GGTTTTGCTTGTGTGTCCTTTGG + Intronic
1146882679 17:36452573-36452595 GGTTTTGCTTGTGTGTCCTTTGG + Intergenic
1147068012 17:37932535-37932557 GGTTTTGCTTGTGTGTCCTTTGG - Intronic
1147074260 17:37980969-37980991 GGTTTTGCTTGTGTGTCCTTTGG + Intronic
1147079543 17:38012090-38012112 GGTTTTGCTTGTGTGTCCTTTGG - Intronic
1147085782 17:38060507-38060529 GGTTTTGCTCGTGTGTCCTTTGG + Intronic
1147095484 17:38136032-38136054 GGTTTTGCTTGTGTGTCCTTTGG - Intergenic
1147101729 17:38184473-38184495 GGTTTTGCTTGTGTGTCCTTTGG + Intergenic
1149846323 17:60010983-60011005 GGTTTTGCTTGTGTGTCCTTTGG + Intergenic
1150084673 17:62267558-62267580 GGTTTTGCTTGTGTGTCCTTTGG + Intergenic
1153576465 18:6526908-6526930 GGTCTTGAACTTCCGTCCTCAGG + Intronic
1160760725 19:782783-782805 GCTCCTGGACGTGGGTCCTTGGG - Intergenic
1168243696 19:55099415-55099437 GGTCCTGCACTTGCATCCTCCGG - Intronic
927351699 2:22124361-22124383 TCTCTTGCACCTGTGTCCTTGGG - Intergenic
928622555 2:33105647-33105669 GGTCTTGAACTTGCGACCTCAGG + Intronic
940792527 2:158043656-158043678 GGTCTTGTATGTGCTTGCTTAGG + Intronic
1168730966 20:80314-80336 GGTCTAGCACCTGCGACCTAGGG - Intergenic
1173029965 20:39347751-39347773 GGTCGAGCACGTGGGCCCTTAGG - Intergenic
1173227282 20:41169249-41169271 GTGCATGCACGTGCGTGCTTGGG - Intronic
1178979872 21:37254592-37254614 GGTCTTGAACTTGTGACCTTAGG - Intronic
1179187627 21:39097004-39097026 GGCCTTGCACGTGCAGCCTGAGG - Intergenic
1179915661 21:44476579-44476601 TCTCTTGCACCTGCGGCCTTGGG - Intergenic
1185144319 22:49122041-49122063 ATTCTTGCATGTGTGTCCTTAGG - Intergenic
949899009 3:8794398-8794420 TGTCTTGCACCTGCATCTTTGGG - Intronic
963796358 3:149634645-149634667 GGTCTTTCACTTGCTTCTTTGGG - Intronic
968734869 4:2290137-2290159 GATCTTGCACGTGAGTCCCCTGG - Intronic
968963081 4:3755225-3755247 TGTCTTGAACGTGGGTCCTATGG + Intergenic
974917192 4:68193728-68193750 GGTCTCGAACTTGCGACCTTAGG - Intergenic
984173141 4:176385029-176385051 GGTCTTGAACTTCCGACCTTAGG + Intergenic
989460383 5:41690953-41690975 GGTCTTACACTTGAGTCTTTAGG + Intergenic
990375944 5:55171095-55171117 GGTCTTGAACTTGTGACCTTAGG - Intronic
1003907318 6:10713970-10713992 GGTCTTGAACGTCTGACCTTAGG - Intergenic
1006427427 6:33975158-33975180 GGTCTTGAACTTCCGGCCTTAGG + Intergenic
1013814347 6:114079991-114080013 GGTCTTGAACTTCCGACCTTAGG + Intronic
1031094990 7:117406535-117406557 GGTCTTGAACTTGCAACCTTAGG - Intronic
1033055889 7:138053632-138053654 GGTCTTCCTCTAGCGTCCTTAGG + Intronic
1034890934 7:154838665-154838687 GGTCTTGCACGTGCGTCCTTAGG - Intronic
1035487494 7:159237314-159237336 AGTCTTGCTAGTGCTTCCTTGGG - Intergenic
1037779051 8:21855295-21855317 GGTCATGCAGGTGCTTGCTTTGG - Intergenic
1045490487 8:102664822-102664844 GGTCATGCATGTTCTTCCTTGGG + Intergenic
1047312449 8:123704103-123704125 GGTTTCCCACGTGCGTGCTTAGG - Intronic
1051663345 9:19445624-19445646 GGTCTTGCAGGAGCATGCTTGGG + Intronic
1053039570 9:34858383-34858405 GGTCTGGCACCTGGGTCCATAGG + Intergenic
1057696087 9:97323894-97323916 GCTCTTGGACGTGCGTGCTGGGG + Exonic
1060310895 9:122460811-122460833 GGTCTTTCACGTCCTTGCTTAGG + Intergenic
1194384165 X:93233146-93233168 GGTCATGTACGTGCCTTCTTAGG - Intergenic
1194601684 X:95929003-95929025 GGTCTTTCACGTGCTTTGTTAGG - Intergenic