ID: 1034895880

View in Genome Browser
Species Human (GRCh38)
Location 7:154876041-154876063
Sequence GCACGAAGTGAGGCGGCGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034895873_1034895880 10 Left 1034895873 7:154876008-154876030 CCGTGGCAGCGGCTTCCAAGGGA 0: 1
1: 0
2: 0
3: 12
4: 154
Right 1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 218
1034895874_1034895880 -5 Left 1034895874 7:154876023-154876045 CCAAGGGACCAAGCTCCTGCACG 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG 0: 1
1: 0
2: 1
3: 9
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034895880 Original CRISPR GCACGAAGTGAGGCGGCGGC TGG Exonic
900113895 1:1020580-1020602 GCGAGGAGGGAGGCGGCGGCGGG - Intronic
900137547 1:1124799-1124821 GCAGCAAGTGAGGGGGAGGCTGG - Intergenic
901972079 1:12915996-12916018 TGACAAAGTGAGGTGGCGGCTGG - Intronic
902013100 1:13285766-13285788 TGACAAAGTGAGGTGGCGGCTGG + Intergenic
903075969 1:20766691-20766713 GCACGTTGGGAGGCGGAGGCAGG + Intronic
903596901 1:24502372-24502394 GCCCGAGGAGAGGCGGCCGCAGG - Intronic
904340564 1:29831464-29831486 GCACCAAGAGAGGGGGCAGCAGG - Intergenic
904520056 1:31088079-31088101 GCACTATGGGAGGCGGAGGCAGG + Intergenic
905044534 1:34985351-34985373 GGAGGAAATGAGCCGGCGGCAGG - Exonic
912320252 1:108706332-108706354 GCAGGAAGTGAGGCAGCTTCAGG - Intergenic
912450443 1:109764760-109764782 GCAGGAGGGGAGGCGGGGGCGGG + Intronic
917325321 1:173825713-173825735 GCACTATGGGAGGCGGAGGCGGG - Intronic
919809403 1:201399341-201399363 GCGCCAGGTGAGGCGGCGGCCGG - Exonic
919811916 1:201414224-201414246 GCATGGAGTGGGGAGGCGGCCGG - Intronic
920922701 1:210311454-210311476 CGAGGAAGTGAGGCAGCGGCCGG - Intergenic
921839128 1:219809751-219809773 GCAGGAAATGCGGTGGCGGCTGG - Intronic
923274685 1:232385985-232386007 GCACGATGGGAGGCTGAGGCAGG - Intergenic
924282407 1:242451704-242451726 GCACGATGGGAGGCTGAGGCAGG - Intronic
1065557476 10:26931323-26931345 GCACGAAGTCCAGGGGCGGCGGG + Intergenic
1069391988 10:67946004-67946026 GCACTTAGTGAGGCGGAGGTAGG + Intronic
1069850010 10:71398178-71398200 GGTCGCAGTGGGGCGGCGGCTGG - Intronic
1070903178 10:80048713-80048735 GCACGGAGAGAGGCAGCAGCAGG - Intergenic
1071363726 10:84877822-84877844 GCACTTTGTGAGGCGGAGGCTGG - Intergenic
1072757376 10:98030227-98030249 GCTGGGGGTGAGGCGGCGGCCGG - Intronic
1072788982 10:98303760-98303782 GCAGGAGGTGAGGTGGGGGCTGG + Intergenic
1073476627 10:103757854-103757876 GCAGGAAGTGAGGCTGTGCCTGG + Intronic
1075752203 10:124782248-124782270 GCACAAAGGGAGGCTGAGGCGGG + Intronic
1076551098 10:131278684-131278706 GCAGGAAGTGACTCCGCGGCAGG - Intronic
1076943261 10:133624475-133624497 GCACGTTGGGAGGCGGAGGCTGG + Intronic
1078003641 11:7516624-7516646 GCACCAAGTGAGGACGAGGCAGG + Intronic
1079130804 11:17745837-17745859 GCACGAAGTGGGGAAGGGGCCGG - Intronic
1079361853 11:19776801-19776823 GCGCATAGTGAGGCGCCGGCTGG + Intronic
1081159013 11:39731263-39731285 GTAAGAATTGAGGCGGCTGCAGG - Intergenic
1082023349 11:47553009-47553031 GCAGCAACTGAGGCAGCGGCAGG - Intronic
1084225422 11:67712036-67712058 GTGCGAAGCGAGGCGGCCGCGGG - Intergenic
1084357584 11:68650297-68650319 GCAAGAAGAGAGGTGCCGGCAGG - Intergenic
1084758263 11:71252409-71252431 GAGCCAGGTGAGGCGGCGGCCGG - Intronic
1084929452 11:72542939-72542961 GCACTTTGTGAGGCGGAGGCTGG + Intergenic
1087426452 11:97993129-97993151 GCACTATGGGAGGCTGCGGCAGG + Intergenic
1089493412 11:118897087-118897109 GCAGGCAGAGAGGAGGCGGCAGG + Exonic
1091568137 12:1662582-1662604 GCGGGAAGTGAGGGGGAGGCGGG - Intergenic
1091571556 12:1691185-1691207 ACACGCGGTGAGGCGGCGACGGG + Exonic
1092523272 12:9294332-9294354 GCCCGCAGTGAGGAGGCGCCGGG + Intergenic
1092899003 12:13041000-13041022 GGAGGAAGGGAGGCGGCCGCTGG + Intergenic
1095789007 12:46143830-46143852 GCACGTTGGGAGGCGGAGGCAGG + Intergenic
1100299024 12:93290319-93290341 GCACCAAGTGAGGATGGGGCAGG + Intergenic
1100616495 12:96235304-96235326 TCACCAAGTGAGGCGCCAGCTGG - Intronic
1105279247 13:18953682-18953704 GCTCTAAGTGAAGGGGCGGCGGG + Intergenic
1107073546 13:36297621-36297643 GCAAGAAGTGAGTCGGCGGGCGG - Exonic
1107570662 13:41654643-41654665 GCAAGAAGTGAGGAGCTGGCAGG - Intronic
1112806342 13:103167448-103167470 GCACGTTGGGAGGCGGAGGCGGG - Intergenic
1113364407 13:109662759-109662781 GCACGGAGTGAGGCGGTCCCAGG + Intergenic
1113820706 13:113210082-113210104 CTACCAGGTGAGGCGGCGGCCGG + Exonic
1114729547 14:24977108-24977130 GCACGTAGGGAGGCCGAGGCGGG - Intronic
1118455826 14:65945162-65945184 GCAACAAGAGAGGAGGCGGCTGG + Intergenic
1121337385 14:93085640-93085662 GGAGGAAGTGAGGCGAGGGCAGG + Intronic
1121560749 14:94873633-94873655 CCACGCAGTGAGGCTGGGGCAGG + Intergenic
1122567780 14:102673859-102673881 GCACTTGGCGAGGCGGCGGCGGG - Intronic
1123684280 15:22786521-22786543 GCAGGAAGAGGGGCGGGGGCGGG - Intronic
1124322683 15:28726730-28726752 GCACCCAGGGAGGCGGAGGCGGG - Intronic
1124354185 15:28983205-28983227 GCACCCAGGGAGACGGCGGCTGG - Intronic
1124523514 15:30426864-30426886 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124523592 15:30427308-30427330 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124535075 15:30538907-30538929 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124535153 15:30539350-30539372 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124763500 15:32468247-32468269 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124763575 15:32468694-32468716 GCACCCAGGGAGGCGGAGGCGGG - Intergenic
1124775051 15:32580357-32580379 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1124775128 15:32580802-32580824 GCACCCAGGGAGGCGGAGGCGGG + Intergenic
1126197742 15:45950736-45950758 GCAGGAGGTGAGGCGGGGGAGGG - Intergenic
1126823750 15:52529266-52529288 GCAGGGCGCGAGGCGGCGGCGGG - Intergenic
1128768693 15:70266315-70266337 CCAGGATGTGAGGCGGGGGCAGG + Intergenic
1128887585 15:71302844-71302866 GGGCTAAATGAGGCGGCGGCAGG - Intronic
1129024866 15:72561733-72561755 GCACTAAGGGAGGCCGAGGCGGG + Intronic
1133097635 16:3458175-3458197 CCACGAGGTGAGGTGGCGGGGGG + Intronic
1133279505 16:4657207-4657229 GCAAGCAGTGAGGCTGCGGCAGG - Intronic
1134044898 16:11093845-11093867 GCAAGAATGGAGGCGGCAGCTGG + Intronic
1134100196 16:11446672-11446694 GCAGGGAGTGAGGAGGCAGCTGG + Intronic
1138600932 16:58053589-58053611 GCACTAAGGGAGGCTGAGGCGGG + Intergenic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141192141 16:81832648-81832670 GCACTAAGGGAGGCTGAGGCAGG - Intronic
1141622586 16:85244601-85244623 GCACGATGGGAGGCTGAGGCAGG + Intergenic
1141683428 16:85556838-85556860 GCAGGAAGGGGGGCGGCGGGGGG - Intergenic
1142206266 16:88784677-88784699 GCTGGAAGGGCGGCGGCGGCTGG - Intronic
1142282800 16:89157214-89157236 GCACGGAGTGAGGCAGTGGGCGG + Intergenic
1142773008 17:2113320-2113342 GCACGCTGTGAGGCCGAGGCGGG - Intronic
1143078846 17:4366623-4366645 GCGCGCAGTGAGGCAGTGGCGGG - Intronic
1143106948 17:4534757-4534779 GCACGGAGCCAGGCGGTGGCAGG + Intronic
1145962915 17:28897723-28897745 GCCGGAAGTGTGGCGGCGGAGGG + Intergenic
1146399519 17:32492202-32492224 GGAGGAAGTGTGGGGGCGGCAGG - Intergenic
1146646821 17:34581589-34581611 GCAGGAAGCGAGGCGACGGGCGG - Intronic
1147251880 17:39157541-39157563 GCACTTAGGGAGGCGGAGGCGGG + Intronic
1149771586 17:59326416-59326438 GCACTTAGGGAGGCGGAGGCAGG - Intergenic
1150363458 17:64559657-64559679 GCACTTAGGGAGGCGGAGGCTGG + Intronic
1151670750 17:75570504-75570526 GCCTGAGGTGAGGCTGCGGCCGG + Intronic
1153728611 18:7983153-7983175 GCAGGAAGTGAGCCAGAGGCGGG + Intronic
1157231493 18:45920608-45920630 ACAGGAAGTGAGGAGGAGGCGGG + Intronic
1159458650 18:68694392-68694414 GCTCCATGTGAGGCTGCGGCTGG - Intronic
1160167672 18:76528678-76528700 GCACACAGTGAGGCGGCCACTGG + Intergenic
1160453400 18:78979951-78979973 CCGCGATGTGAGGCGGCGCCGGG + Intergenic
1160809622 19:1007784-1007806 GCGCGGGGTGAGGCGGGGGCGGG + Intronic
1160873128 19:1285972-1285994 CCGAGAAGTCAGGCGGCGGCGGG - Intergenic
1160903505 19:1440910-1440932 GCAGGAAGTGAAGCAGCAGCAGG + Exonic
1161576756 19:5058637-5058659 ACACGACGTGAGGCAGGGGCTGG - Intronic
1163442259 19:17328146-17328168 GTACGAGGTGAGGAGGGGGCGGG - Exonic
1164519122 19:28964217-28964239 GCACTATGAGAGGCCGCGGCAGG - Intergenic
1164639307 19:29812499-29812521 GCGCGGGGTGAGGCGGCGGCGGG - Intronic
1165417048 19:35701228-35701250 GCACTATGTGAGGCCGAGGCAGG + Intergenic
1165941740 19:39417901-39417923 GCAGGAAGTGCAGCGGCGGCTGG + Exonic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1166462335 19:42999546-42999568 GCAAGAATTGAGGCTGCAGCAGG + Intronic
1167073420 19:47233929-47233951 GCACTGAGGGAGGCGGAGGCAGG - Intergenic
1167116441 19:47491786-47491808 GCACTAAGTGAGGCAGGAGCTGG + Intronic
1168098352 19:54128179-54128201 GGAAGAAGCGAGGCGGCCGCAGG + Exonic
1168100399 19:54138259-54138281 CCACGCGGGGAGGCGGCGGCGGG - Intronic
1168239826 19:55083498-55083520 GCACGAGCGGAGGCGCCGGCAGG + Exonic
1168498479 19:56874054-56874076 CCACAAGGTGAGGCGGCAGCTGG - Intergenic
927811833 2:26184775-26184797 GCAGGAAGTGCAGCGGCGCCGGG - Exonic
929966853 2:46542875-46542897 GCAGGAGGGGAGGGGGCGGCGGG - Exonic
931362031 2:61585899-61585921 GCACTTTGGGAGGCGGCGGCAGG + Intergenic
934684224 2:96308657-96308679 GCACTTAGGGAGGCCGCGGCGGG + Intergenic
934870362 2:97859679-97859701 GAACCCAGTGAGGCGGCGGACGG + Intronic
935757657 2:106289066-106289088 GCGCGCAGTGTGGCGGCAGCAGG - Intergenic
938427556 2:131203641-131203663 GCACGATGGGAGGCCGAGGCGGG - Intronic
939492057 2:142888209-142888231 GCACTTAGGGAGGCGGAGGCTGG + Intronic
947726234 2:232402635-232402657 GCAGGAAGTCAGGCGGGTGCAGG + Intergenic
1172921111 20:38483133-38483155 GCACCATGGGAGGCGGAGGCGGG - Intronic
1173791944 20:45833779-45833801 GCAGGAGGCGGGGCGGCGGCAGG + Intergenic
1173891028 20:46510477-46510499 GCACTTAGTGAGGCCGAGGCAGG + Intronic
1175834237 20:61983036-61983058 GCTCTGAGTGAGGCGGAGGCGGG + Intronic
1176109951 20:63406632-63406654 CCAGGAAGTGAGGCGGCGCTGGG - Exonic
1176188179 20:63793013-63793035 GCAGGAAGTGAAGGGGAGGCTGG - Intronic
1178556640 21:33597114-33597136 GCACTATGGGAGGCCGCGGCGGG - Intronic
1179016037 21:37595038-37595060 CCACGATGTGGGGCGGGGGCTGG + Intergenic
1179463714 21:41556588-41556610 ACACCAAGTGGGGAGGCGGCTGG - Intergenic
1179667992 21:42925629-42925651 GCCCCAAGTGAGGAGGGGGCAGG + Intergenic
1182623506 22:31630444-31630466 GCCTGCAGTGAGGCGGCTGCAGG - Intronic
1182623514 22:31630479-31630501 ACGGGAAGTGAGGCGGCCGCGGG - Intronic
1185319276 22:50193087-50193109 GCACGAGGTGAGGTGGAGGCTGG + Exonic
949277487 3:2302182-2302204 GCACTAAGGGAGGCTGAGGCGGG + Intronic
952262425 3:31753429-31753451 GCACTTTGTGAGGCTGCGGCGGG - Intronic
953925298 3:46979642-46979664 GCAGGAAGCTGGGCGGCGGCCGG + Intronic
955917235 3:63918817-63918839 GCACGAGGTGATGCTGAGGCAGG - Intronic
961483286 3:127197389-127197411 GCACTCAAAGAGGCGGCGGCGGG - Exonic
962322981 3:134406734-134406756 GCAGGAAGGGAGGGGGCGCCGGG + Intergenic
962575858 3:136754079-136754101 GCACGTTGTGAGGCAGAGGCGGG + Intergenic
965161744 3:165141817-165141839 GCACTTTGGGAGGCGGCGGCGGG - Intergenic
967329582 3:188277148-188277170 GCACGTTGTGAGGTGGAGGCGGG - Intronic
968577982 4:1376798-1376820 GCAGGAGCTGAGGCGGCGGCAGG - Intronic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
968845809 4:3041046-3041068 CCAGGAAGAGAGGGGGCGGCCGG + Intergenic
973277471 4:48325386-48325408 GCACGATGGGAGGCCGAGGCAGG - Intergenic
973566602 4:52194950-52194972 GCACCTAGTGAGGCTGAGGCAGG - Intergenic
977259029 4:94775843-94775865 GCACGCTGGGAGGCGGAGGCGGG + Intronic
981967903 4:150629146-150629168 GCACGTAGTGAGGCTGAGGCAGG - Intronic
982157288 4:152535458-152535480 CCCCGATGTGAAGCGGCGGCTGG - Exonic
982924548 4:161319587-161319609 GCAGGAAGTGAGAGAGCGGCAGG + Intergenic
983246963 4:165298694-165298716 GCACTTAGGGAGGCGGAGGCAGG + Intronic
984113100 4:175644346-175644368 GCAAGAAGTGAGGTTGCTGCAGG + Intronic
985446617 4:190024933-190024955 GCACGTTGGGAGGCGGAGGCTGG + Exonic
985647856 5:1093541-1093563 GGACGAGGAGAGCCGGCGGCGGG - Exonic
986162083 5:5239372-5239394 GCAGGAAGCGAGGCAGCGGAAGG - Intronic
986707542 5:10464026-10464048 ACAGGAAGGGAGGCGGAGGCTGG - Intronic
993667048 5:90712032-90712054 GCACTATGTGAGGCCGAGGCGGG - Intronic
994451519 5:99950408-99950430 GCAGGGACTGAGGCAGCGGCAGG - Intergenic
996206330 5:120741845-120741867 GCACGTTGGGAGGCTGCGGCAGG - Intergenic
999291908 5:150431263-150431285 GCAGGAGGTGAGGCAGTGGCTGG + Intergenic
1004546275 6:16601602-16601624 GCACTTAGTGAGGCCGAGGCGGG + Intronic
1004925349 6:20410866-20410888 GCACGTTGTGAGGCCGAGGCGGG - Intronic
1005302375 6:24483430-24483452 GCACGTTGGGAGGCTGCGGCGGG + Intronic
1005732188 6:28708983-28709005 GCACGATGGGAGGCCGAGGCGGG + Intergenic
1007414526 6:41684002-41684024 GCACAAAGTGAGGGGTCGGAGGG + Exonic
1007504919 6:42328253-42328275 GCACTCTGTGAGGCGGAGGCGGG - Intronic
1007629130 6:43263104-43263126 GGGCGAAGAGCGGCGGCGGCTGG + Exonic
1007727313 6:43924308-43924330 GCAGGAAGTGGGGTGGGGGCAGG - Intergenic
1009421314 6:63467936-63467958 GCACTTAGTGAGGCTGAGGCGGG - Intergenic
1010980181 6:82363263-82363285 CCAAGAAGTGAGGGGGCGGGGGG + Intronic
1012887255 6:104859846-104859868 GCGCGAGCAGAGGCGGCGGCGGG - Exonic
1014724951 6:124962561-124962583 GCACGGTGAGCGGCGGCGGCGGG + Exonic
1018025958 6:159806016-159806038 TGACGAAGTGACGCGGTGGCTGG + Exonic
1018190950 6:161308560-161308582 GCACGATGGGAGGCGGAGACAGG + Intergenic
1018519640 6:164633087-164633109 GCACTTTGTGAGGCCGCGGCGGG - Intergenic
1018550284 6:164989860-164989882 GCACATAGGGAGGCGGAGGCAGG - Intergenic
1019468379 7:1203192-1203214 GCACTTAGGGAGGCGGAGGCAGG - Intergenic
1020162280 7:5781656-5781678 GCGCGAGGTGACGCCGCGGCAGG - Exonic
1023773572 7:43582950-43582972 CCACGGAGTGAGGCCGGGGCGGG + Intronic
1023947793 7:44817384-44817406 GCACTTAGTGAGGCTGAGGCAGG + Intronic
1024856940 7:53793844-53793866 GCACTATGTGAGGCTGCAGCAGG + Intergenic
1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG + Exonic
1026627480 7:72008900-72008922 GCACGTTGGGAGGCGGAGGCGGG - Intronic
1027506285 7:79020518-79020540 GCACTTTGTGAGGCGGAGGCGGG + Intronic
1029068141 7:97872538-97872560 GGACTAAGTGGGGCGGCGGAAGG + Exonic
1029307053 7:99628003-99628025 GCACTCAGTGAGGCAGAGGCAGG + Intronic
1031629808 7:124032903-124032925 CCAGGAAGCGAGGCGGCAGCCGG - Exonic
1032908203 7:136397601-136397623 GCACGTTGGGAGGCCGCGGCAGG + Intergenic
1034448589 7:151125837-151125859 GCTGGGAGGGAGGCGGCGGCGGG + Intronic
1034891928 7:154847821-154847843 GGCTGAAGTGAGGGGGCGGCAGG - Intronic
1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG + Exonic
1036166342 8:6437648-6437670 GCACCAGGTGAGGCAGCGGGAGG - Intronic
1037275523 8:17174049-17174071 GCACAAATTGAGGTGCCGGCAGG - Intronic
1039921480 8:41896832-41896854 GCTCGTACTGCGGCGGCGGCGGG + Intergenic
1042190046 8:66177315-66177337 GCTCGGACTGCGGCGGCGGCTGG + Exonic
1042680259 8:71375873-71375895 GCACGATGGGAGGCAGAGGCAGG - Intergenic
1043434001 8:80220826-80220848 GCACTATGTGAGGCTGAGGCAGG - Intronic
1045461515 8:102429703-102429725 GCACGATGGGAGGCCGAGGCAGG - Intergenic
1045615573 8:103906490-103906512 GCACTTAGTGAGGCTGAGGCAGG - Intronic
1048314764 8:133353861-133353883 GCAGGAAGTGAGTGGGCGTCAGG - Intergenic
1049109666 8:140635308-140635330 GCTCGAGGAGCGGCGGCGGCGGG - Intronic
1049121423 8:140741890-140741912 GCACTTTGTGAGGCGGAGGCAGG + Intronic
1049451504 8:142664510-142664532 GCAGGAAGTGGGGCAGCTGCGGG - Exonic
1049682867 8:143927475-143927497 GCAGGACGCCAGGCGGCGGCAGG - Exonic
1049711127 8:144063853-144063875 GAACGAAGAGCTGCGGCGGCTGG - Intergenic
1055514168 9:77020164-77020186 GTACCATGTGCGGCGGCGGCGGG - Exonic
1056170502 9:83980363-83980385 GCCCGAAGGGAGGCGCTGGCGGG - Intronic
1058311957 9:103514960-103514982 GCACGAAGACAGGCACCGGCAGG - Intergenic
1059141499 9:111857228-111857250 GCACTTTGGGAGGCGGCGGCGGG + Intergenic
1060106567 9:120876766-120876788 GTCCGAAGTCAGGCTGCGGCAGG - Intronic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1061580282 9:131531767-131531789 GCACGGAGCGGGGGGGCGGCAGG - Intergenic
1062312946 9:135949091-135949113 GCACAAAGTGAGGAGTCAGCAGG + Intronic
1062659367 9:137620637-137620659 GCACTTAGGGAGGCGGAGGCAGG - Intronic
1203772757 EBV:57932-57954 GGACAGAGGGAGGCGGCGGCCGG + Intergenic
1185892334 X:3832807-3832829 GCACTTTGGGAGGCGGCGGCGGG - Intronic
1185897442 X:3871226-3871248 GCACTTTGGGAGGCGGCGGCGGG - Intergenic
1185902561 X:3909658-3909680 GCACTTTGGGAGGCGGCGGCGGG - Intergenic
1189318774 X:40074586-40074608 CGACGTAGTGAGGTGGCGGCAGG + Exonic
1193601157 X:83509413-83509435 GGAGGAAGCGAGGAGGCGGCCGG + Exonic
1195668200 X:107449349-107449371 TCAAGAAGTGAGGCAGCGCCAGG + Intergenic
1201345545 Y:12980514-12980536 GCACTTAGGGAGGCGGAGGCAGG - Intergenic