ID: 1034896197

View in Genome Browser
Species Human (GRCh38)
Location 7:154877947-154877969
Sequence CTGGGCCGGCTTCCGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 129}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034896197_1034896209 17 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896209 7:154877987-154878009 AGTGGGCCTGGCTTCCTGGGTGG No data
1034896197_1034896201 -6 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896201 7:154877964-154877986 GCCCAGGCTGCGCTCTGGAGTGG 0: 1
1: 0
2: 5
3: 24
4: 321
1034896197_1034896206 5 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896206 7:154877975-154877997 GCTCTGGAGTGGAGTGGGCCTGG 0: 1
1: 0
2: 7
3: 42
4: 356
1034896197_1034896208 14 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896208 7:154877984-154878006 TGGAGTGGGCCTGGCTTCCTGGG No data
1034896197_1034896210 18 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896210 7:154877988-154878010 GTGGGCCTGGCTTCCTGGGTGGG 0: 1
1: 0
2: 4
3: 148
4: 2900
1034896197_1034896204 -1 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896204 7:154877969-154877991 GGCTGCGCTCTGGAGTGGAGTGG No data
1034896197_1034896207 13 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896207 7:154877983-154878005 GTGGAGTGGGCCTGGCTTCCTGG No data
1034896197_1034896212 20 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896212 7:154877990-154878012 GGGCCTGGCTTCCTGGGTGGGGG 0: 1
1: 1
2: 7
3: 76
4: 612
1034896197_1034896211 19 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896211 7:154877989-154878011 TGGGCCTGGCTTCCTGGGTGGGG No data
1034896197_1034896205 0 Left 1034896197 7:154877947-154877969 CCAGGACACGGAAGCCGGCCCAG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 1034896205 7:154877970-154877992 GCTGCGCTCTGGAGTGGAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034896197 Original CRISPR CTGGGCCGGCTTCCGTGTCC TGG (reversed) Intronic
900638805 1:3678600-3678622 CTGGGCAGGTTTCCGGGTCCTGG + Intronic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
904959788 1:34323317-34323339 CTGAGCCGCCTTGGGTGTCCAGG + Intergenic
913453485 1:119008123-119008145 CTGGGTCGGCTTCCGTGGCCTGG + Intergenic
915087401 1:153397851-153397873 CAGGGCCGCCTTCTGTGTCCAGG + Intergenic
919995016 1:202740378-202740400 CCCGGCCGGCTGCCCTGTCCGGG - Intronic
920914541 1:210249513-210249535 CTGGGCAGGCTGAGGTGTCCTGG - Intergenic
921023983 1:211260273-211260295 CTGGGCAGGCATCCGTGGCGGGG + Intronic
1067098629 10:43318827-43318849 CTGGGGCCGCATCCATGTCCTGG + Intergenic
1069659748 10:70115953-70115975 CTGGACTGGCTTCCTTTTCCTGG + Intronic
1073285070 10:102382611-102382633 CTGGGGAGGCATCCGTGTGCCGG + Exonic
1074814629 10:117134798-117134820 CTGGGCCTGCTTCCCTGACCCGG - Intronic
1074974498 10:118569145-118569167 CTGGGCTGGCTTCAGGGTCCAGG - Intergenic
1076869511 10:133186465-133186487 CTGGGACGGGTTCCCTGTGCAGG + Exonic
1077872139 11:6271134-6271156 CTGGGCCGGGATCCGGCTCCCGG + Exonic
1078922300 11:15842002-15842024 CTGGGCAGGCTTCCAGATCCCGG + Intergenic
1080779978 11:35420256-35420278 CGCCGCCTGCTTCCGTGTCCCGG + Intergenic
1082003778 11:47408752-47408774 CTGGGCCGGCTCCCAGGACCCGG + Intronic
1089273289 11:117315936-117315958 CTGGGCCAGCCCCCGGGTCCGGG + Exonic
1089336128 11:117725182-117725204 CTGGGCCGGTCTCCGTGGACGGG + Intronic
1089507204 11:118971886-118971908 CTGGGCCCGCCTCCATGGCCAGG + Exonic
1089678757 11:120107856-120107878 CTTGTCCCCCTTCCGTGTCCCGG - Intergenic
1090282544 11:125468680-125468702 CTGGGCCGGCGTCTGTTTTCTGG - Intronic
1091747122 12:2999599-2999621 CTGGGCCGGCTCCCGAGCCCGGG + Intronic
1092170340 12:6370383-6370405 CTAGCCCCTCTTCCGTGTCCAGG + Intronic
1096197791 12:49659738-49659760 CTTGGCCATCTTCCTTGTCCTGG - Intronic
1096951572 12:55479160-55479182 CCGGGCCAGCTGCCCTGTCCGGG - Intergenic
1104555374 12:129795275-129795297 CTGGGAGGGCTTCCGTGAGCCGG - Intronic
1106017729 13:25885024-25885046 CTGAGCTGGCCTCCATGTCCTGG + Intronic
1118423574 14:65633865-65633887 CTCGGCCAGCTGCCCTGTCCAGG + Intronic
1118502824 14:66379234-66379256 CTGGGCAGGCTTCCCTGGCAGGG - Intergenic
1118709872 14:68510336-68510358 CTGAGCCGGCCTCTGTCTCCAGG + Intronic
1121525450 14:94616167-94616189 CTAGGCTGGCTACTGTGTCCTGG - Intronic
1122343554 14:101044353-101044375 ATGGCCTGGCTTCCATGTCCGGG + Intergenic
1122940094 14:104977350-104977372 CTGGGCCTGGTTCCGGGGCCTGG - Intronic
1122982115 14:105196610-105196632 CTGGGCCGGCCTCCTCGTCTGGG + Intergenic
1129825314 15:78631019-78631041 CTGGGCCTGCTGCCCTGGCCTGG + Intronic
1132567226 16:629059-629081 CTGCTCCAGCTTCCCTGTCCTGG + Exonic
1132576819 16:668157-668179 CGGGGCCGGGTTCCGGGTCGGGG + Exonic
1134245731 16:12538568-12538590 CTGAGCTGGCTTCTGTGTCTGGG + Intronic
1136079727 16:27843965-27843987 CTGGGCTGGCTTCCCTGTTGGGG - Intronic
1136522422 16:30805676-30805698 CCGGGCCGGCGTCCGGGCCCAGG + Intergenic
1141886229 16:86894312-86894334 CAGGGTGGGCTTCCCTGTCCTGG - Intergenic
1142350088 16:89575803-89575825 CTGGGCCGGCCACCATTTCCCGG + Exonic
1142957984 17:3534203-3534225 CTGGGCAGCCCTGCGTGTCCAGG - Intronic
1143015475 17:3889159-3889181 CTGGGCTGGATTCTGTGCCCCGG + Intronic
1147120249 17:38331326-38331348 CCGGGCAGGCTGCCGTGGCCTGG + Exonic
1147885307 17:43680194-43680216 CTGGGCAGGCTTCGGTGCCAAGG + Intergenic
1150268733 17:63848942-63848964 GCGGGCCGGCTCACGTGTCCGGG + Intergenic
1152589355 17:81203795-81203817 CTGGTCCAGCTTTCCTGTCCTGG - Intronic
1152853239 17:82649338-82649360 CTGGGGGGGTTTCTGTGTCCCGG - Intergenic
1152929279 17:83101681-83101703 CCTGGCCGGCCTCCATGTCCTGG - Intergenic
1155519875 18:26657014-26657036 CTGGGCCGGGTTCCGGATCTCGG - Intronic
1159798517 18:72869303-72869325 CTGGCCCGGCCTCCGCTTCCCGG + Intergenic
1160710696 19:549739-549761 CTGTGGCGCCTTACGTGTCCTGG + Exonic
1160724194 19:610446-610468 CAGGGCCGGCCTCCCTCTCCTGG + Intronic
1160791686 19:926318-926340 CAGGGCCGCCTTCCCAGTCCGGG - Intronic
1161420737 19:4174838-4174860 CTGGGACGGCCCCCGTGTGCTGG - Exonic
1161590823 19:5128406-5128428 CTGGGCCGGCTTCCCAAGCCGGG - Intronic
1162643946 19:12035351-12035373 CTGGGCCGGCCGCCGGGACCCGG - Intronic
1162651573 19:12092585-12092607 CTGGGCCGGCAGCCGGGACCCGG + Intronic
1162869918 19:13578508-13578530 CTGGGGCAGCTTCCATGTCAGGG - Intronic
1163263577 19:16205468-16205490 CTGGGCCAGCGTCCCTTTCCTGG + Intronic
1163594109 19:18210967-18210989 CTGGGCCGGCTTCAGGGGACAGG + Exonic
1165115697 19:33527257-33527279 CTGTGCCAGCTGCCATGTCCTGG - Intergenic
1165136415 19:33672739-33672761 CTGGGCCAGCTTCCGAGAGCAGG + Intronic
1165793775 19:38507103-38507125 CTGGCCCCGCCTCTGTGTCCAGG - Intronic
1168162790 19:54523107-54523129 CAGGGCTGGCTTCACTGTCCAGG - Intergenic
1168178028 19:54639071-54639093 CTTGGCCGGGTTCCATGTCTTGG + Intronic
1168316362 19:55486448-55486470 CAGGGCCGGCGGCCGTGTCAAGG - Exonic
924975677 2:172301-172323 CTAGGCCCTCTTCCATGTCCTGG - Intergenic
925173803 2:1768448-1768470 CTGGGCCTGCTTCCCCTTCCAGG + Intergenic
928158211 2:28895227-28895249 CTGGGGCGGCTTCCTTCTGCCGG + Intronic
936600477 2:113890158-113890180 CTGGGCCGCCTTCACCGTCCGGG - Exonic
941934754 2:170973945-170973967 CGGGGCCGGCTTCCCTCCCCGGG + Intergenic
948747418 2:240106741-240106763 CTGGAGGGGCTTCCTTGTCCTGG + Intergenic
948822922 2:240559107-240559129 CTGGGCCAGCCTCTGTCTCCTGG - Intronic
948851888 2:240712336-240712358 CTGGGACCACTTCTGTGTCCAGG - Intergenic
1170562686 20:17570325-17570347 CCGGTCCGGCTGCAGTGTCCGGG + Intronic
1174677579 20:52373248-52373270 CTGGGCAGGCCTCAGTGTCAAGG - Intergenic
1175199936 20:57269894-57269916 CTGGGCAGGCTCCAGTGCCCAGG - Intergenic
1175723580 20:61302207-61302229 CAGGGCCGGTTTCCGTGTGAGGG + Intronic
1175737385 20:61396612-61396634 CTGGCCCGGCTTCCTTGGCCTGG + Intronic
1180220599 21:46355818-46355840 CTGGGCAGGAGTGCGTGTCCTGG + Intronic
1182079077 22:27516410-27516432 CTGGGCTGGCTTACATTTCCAGG - Intergenic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1183404693 22:37624716-37624738 CTGGGCCCGCTCCCGCCTCCAGG - Intronic
1184444423 22:44539132-44539154 CTGGCCTGGCTTCCCTGCCCTGG + Intergenic
1184711350 22:46250983-46251005 CCAGGCCGGCTTCAGAGTCCGGG - Intergenic
1184769055 22:46587450-46587472 CTGTTCCGGCTTCAGTGCCCAGG + Intronic
1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG + Intergenic
1185287889 22:50010650-50010672 CTGGGTGGGCTTCAGAGTCCAGG - Intronic
952174725 3:30849211-30849233 CTGGGCCCCCTTCCATGTCTAGG - Intronic
954214586 3:49117221-49117243 CTGGGCCCGCTTCTGGTTCCGGG + Exonic
960149265 3:114233338-114233360 CTGAGCAGGCTTCACTGTCCTGG - Intergenic
961791901 3:129382289-129382311 CTCAGCCGGCTTCTGAGTCCTGG - Intergenic
966516728 3:180828584-180828606 CGGGGTCGGCATCCATGTCCTGG + Intronic
966908417 3:184544204-184544226 CAGGGCCGGCTTACCTGTCAAGG - Intronic
968108920 3:196026271-196026293 CTAGGCCCTCTTCCATGTCCTGG - Intergenic
968728451 4:2258988-2259010 CCAGGCCACCTTCCGTGTCCAGG + Intronic
968874238 4:3256898-3256920 CTGCACGGGCTTCCGTGGCCTGG - Intronic
969876400 4:10138687-10138709 TTGGGTTGGCTTCCGTGTTCTGG + Intergenic
979367523 4:119843225-119843247 CTGGGCAGGCTTCAGTGGCATGG + Intergenic
980988552 4:139718587-139718609 CTGGGACGGCTTCCCTCTGCTGG - Exonic
982574806 4:157096187-157096209 CTCGGCAGGCTTCCCTGTCTGGG + Intronic
985470675 5:42478-42500 CTAGGCCCTCTTCCATGTCCTGG - Intergenic
985678920 5:1246021-1246043 CTGGGCGCGTGTCCGTGTCCGGG - Exonic
989247729 5:39272992-39273014 CCCGGCCGGCTGCCCTGTCCAGG + Intronic
992616093 5:78547744-78547766 CGGGGCCTGCTTCCTAGTCCTGG - Intronic
997697216 5:135871380-135871402 CTGGGCTGGCTCCAGTGTCACGG + Intronic
1002071324 5:176680356-176680378 CTGGGCCGGCTCCCGGGCGCGGG + Intergenic
1004546504 6:16603374-16603396 CTGGGCCACCTTCCCTTTCCAGG + Intronic
1018669560 6:166167708-166167730 CTGCGACGGCTCCCGGGTCCCGG + Exonic
1019362744 7:613891-613913 CTCCGCAGGCTTCCCTGTCCTGG - Intronic
1019427220 7:983417-983439 CTTGGACAGCTGCCGTGTCCTGG + Intronic
1020162098 7:5780964-5780986 CTGGCCCGGCTCGGGTGTCCGGG - Intronic
1033424823 7:141234543-141234565 CAGGGCTGTCTTCTGTGTCCAGG + Intronic
1034222958 7:149460056-149460078 CGGGGACGGCCTGCGTGTCCCGG - Intronic
1034896197 7:154877947-154877969 CTGGGCCGGCTTCCGTGTCCTGG - Intronic
1035179371 7:157078132-157078154 CCCGGCCGTCTTCAGTGTCCTGG + Intergenic
1038315379 8:26480250-26480272 CTGGGCCTGCTTCATTCTCCTGG - Intronic
1042370403 8:67984920-67984942 CTGGGCTGGCTTCCTTGCCAAGG - Intronic
1045285654 8:100789159-100789181 CTGGGCAGGCTTCCCTGACCAGG - Intergenic
1048427944 8:134339961-134339983 CTGGGCCTGATTCCCTGTGCAGG + Intergenic
1049675537 8:143887316-143887338 CTGGGCCTGCTTCCCTGCCCCGG - Intergenic
1049791778 8:144475583-144475605 CTGGGCCAGCTTCAGTCTGCGGG + Exonic
1053786337 9:41655233-41655255 CTGGGCCGGGGTCCGGGGCCGGG + Intergenic
1059305353 9:113349602-113349624 CGGGGCCGGGGTCCGGGTCCGGG + Exonic
1059473684 9:114526671-114526693 CTGGTCTGGCTTGCATGTCCTGG - Intergenic
1061680955 9:132242169-132242191 CGGGGCCGGCGTCCGAGGCCGGG + Exonic
1061817851 9:133207098-133207120 CTGTGCCGGCTTTCATGTGCCGG - Intronic
1061953708 9:133950629-133950651 CTGAGCCGGCTTCCGAGTGCCGG + Intronic
1062380520 9:136284635-136284657 GTGGGCCGGGATCCCTGTCCAGG - Intronic
1062508443 9:136890771-136890793 CCGGGCTGCCTGCCGTGTCCTGG + Intronic
1062618525 9:137408794-137408816 CTGGCCTGGCTTCCCTGTACAGG - Intronic
1185448991 X:273003-273025 CTGGCCCTTCCTCCGTGTCCTGG - Intergenic
1185449202 X:273841-273863 CTGGCCCTTCCTCCGTGTCCTGG - Intergenic
1186973404 X:14873568-14873590 CAGAGGCGGCTTCCGGGTCCGGG - Intronic
1197714417 X:129696104-129696126 CTGTGCCTGCTTCCGAATCCTGG + Intergenic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic