ID: 1034899258

View in Genome Browser
Species Human (GRCh38)
Location 7:154897416-154897438
Sequence CAGCAGGAAAAAAGGGCGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034899258_1034899263 10 Left 1034899258 7:154897416-154897438 CCTTCCGCCCTTTTTTCCTGCTG No data
Right 1034899263 7:154897449-154897471 AATGATAAACTCACAAGTCCTGG No data
1034899258_1034899264 17 Left 1034899258 7:154897416-154897438 CCTTCCGCCCTTTTTTCCTGCTG No data
Right 1034899264 7:154897456-154897478 AACTCACAAGTCCTGGCCTCAGG No data
1034899258_1034899267 25 Left 1034899258 7:154897416-154897438 CCTTCCGCCCTTTTTTCCTGCTG No data
Right 1034899267 7:154897464-154897486 AGTCCTGGCCTCAGGGCCCCGGG No data
1034899258_1034899265 18 Left 1034899258 7:154897416-154897438 CCTTCCGCCCTTTTTTCCTGCTG No data
Right 1034899265 7:154897457-154897479 ACTCACAAGTCCTGGCCTCAGGG No data
1034899258_1034899266 24 Left 1034899258 7:154897416-154897438 CCTTCCGCCCTTTTTTCCTGCTG No data
Right 1034899266 7:154897463-154897485 AAGTCCTGGCCTCAGGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034899258 Original CRISPR CAGCAGGAAAAAAGGGCGGA AGG (reversed) Intergenic
No off target data available for this crispr