ID: 1034900919

View in Genome Browser
Species Human (GRCh38)
Location 7:154907291-154907313
Sequence GCTGCCCGCCAGTCCCACGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034900919_1034900922 0 Left 1034900919 7:154907291-154907313 CCTGCGTGGGACTGGCGGGCAGC No data
Right 1034900922 7:154907314-154907336 TCCACCCGCGGCCCCAGCACGGG No data
1034900919_1034900921 -1 Left 1034900919 7:154907291-154907313 CCTGCGTGGGACTGGCGGGCAGC No data
Right 1034900921 7:154907313-154907335 CTCCACCCGCGGCCCCAGCACGG No data
1034900919_1034900930 23 Left 1034900919 7:154907291-154907313 CCTGCGTGGGACTGGCGGGCAGC No data
Right 1034900930 7:154907337-154907359 ATCCACTAGGCGAAGCCAGCTGG 0: 57
1: 507
2: 1114
3: 470
4: 180
1034900919_1034900926 10 Left 1034900919 7:154907291-154907313 CCTGCGTGGGACTGGCGGGCAGC No data
Right 1034900926 7:154907324-154907346 GCCCCAGCACGGGATCCACTAGG No data
1034900919_1034900931 24 Left 1034900919 7:154907291-154907313 CCTGCGTGGGACTGGCGGGCAGC No data
Right 1034900931 7:154907338-154907360 TCCACTAGGCGAAGCCAGCTGGG 0: 54
1: 499
2: 1097
3: 459
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034900919 Original CRISPR GCTGCCCGCCAGTCCCACGC AGG (reversed) Intergenic
No off target data available for this crispr