ID: 1034901495

View in Genome Browser
Species Human (GRCh38)
Location 7:154910480-154910502
Sequence GTGCACCATCCCTGCAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034901491_1034901495 -3 Left 1034901491 7:154910460-154910482 CCAGACTCCATCTCCAGCCTGTG No data
Right 1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG No data
1034901492_1034901495 -10 Left 1034901492 7:154910467-154910489 CCATCTCCAGCCTGTGCACCATC No data
Right 1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG No data
1034901489_1034901495 13 Left 1034901489 7:154910444-154910466 CCCTTCTCAACACAGGCCAGACT No data
Right 1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG No data
1034901488_1034901495 14 Left 1034901488 7:154910443-154910465 CCCCTTCTCAACACAGGCCAGAC No data
Right 1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG No data
1034901490_1034901495 12 Left 1034901490 7:154910445-154910467 CCTTCTCAACACAGGCCAGACTC No data
Right 1034901495 7:154910480-154910502 GTGCACCATCCCTGCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034901495 Original CRISPR GTGCACCATCCCTGCAGCCC AGG Intergenic
No off target data available for this crispr