ID: 1034907350

View in Genome Browser
Species Human (GRCh38)
Location 7:154962026-154962048
Sequence CACCAAAGGCGGCCCCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034907350_1034907355 24 Left 1034907350 7:154962026-154962048 CCCAACAGGGGCCGCCTTTGGTG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1034907355 7:154962073-154962095 TTTTAAATAGTGTCAAAGACTGG 0: 1
1: 0
2: 2
3: 31
4: 358
1034907350_1034907354 0 Left 1034907350 7:154962026-154962048 CCCAACAGGGGCCGCCTTTGGTG 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1034907354 7:154962049-154962071 CAAGACATCTGATTTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034907350 Original CRISPR CACCAAAGGCGGCCCCTGTT GGG (reversed) Intronic
900303474 1:1989747-1989769 CACCACACCCGGCCCGTGTTAGG + Intronic
901461583 1:9395029-9395051 GACCACGGGCGGCCCCTGTGAGG + Intergenic
907245123 1:53103503-53103525 CACCAGAGGAGGCCCCTCCTCGG - Exonic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
918180797 1:182084936-182084958 CACCAAAAGAGGCGCGTGTTTGG + Intergenic
919801850 1:201359103-201359125 CACCCCAGGCAGCTCCTGTTTGG - Exonic
921212984 1:212915863-212915885 CACCAAAGGCTGCTCCTTTGTGG + Intergenic
921999277 1:221458351-221458373 AGCCAAAAGCGGCCCCTGTGAGG - Intergenic
922007950 1:221551181-221551203 CAGCAAAGGCTACCCCTTTTGGG - Intergenic
1065522262 10:26584403-26584425 CACCAAAGCCAGCCCCAGTCAGG + Intergenic
1065527835 10:26640708-26640730 CACCAAAGCCAGCCCCAGTCAGG + Intergenic
1065528529 10:26646151-26646173 CACCAAAGTCAGCCCCAGTCAGG + Intergenic
1065528741 10:26647961-26647983 CACCAAAGCCAGCCCCAGTCAGG + Intergenic
1065558483 10:26939586-26939608 CACCAAAGCCAGCCCCAGTCAGG - Intergenic
1065558709 10:26941416-26941438 CACCAAAGCCAGCCCCAGTCAGG - Intergenic
1069816204 10:71196174-71196196 CACCAAAAGGGGGCCCTGTATGG - Intergenic
1075960883 10:126567006-126567028 CACCAAAGGTGGCCCTGGGTGGG + Intronic
1082203378 11:49401680-49401702 CACAATAGGTGGCCCCAGTTAGG + Intergenic
1086651657 11:89298416-89298438 CACAATAGGTGGCCCCAGTTAGG - Intergenic
1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG + Intronic
1099032100 12:77539401-77539423 CACCAAAGGCTGGCCATGTGAGG - Intergenic
1102857078 12:116303477-116303499 CGCCACACCCGGCCCCTGTTAGG + Intergenic
1103870902 12:124090904-124090926 CACCTAAGGCTGCCCTTGTCAGG + Intronic
1104422248 12:128645689-128645711 GCCCAAAGGGGGCCCCTGCTGGG - Intronic
1110609753 13:77475445-77475467 CTCCACATGCGGCCCCTGTGCGG - Intergenic
1113759745 13:112839018-112839040 CATCATGGGAGGCCCCTGTTGGG - Intronic
1119155433 14:72405782-72405804 CACCAAAGAAGGCCCCTGCCAGG - Intronic
1120772888 14:88400543-88400565 CACCACATGTGGCCTCTGTTGGG - Intronic
1120841588 14:89090127-89090149 CACCAAAGGCTGGGGCTGTTGGG + Intergenic
1122696420 14:103555209-103555231 TTGCAAAGGCTGCCCCTGTTTGG + Intergenic
1127709741 15:61584714-61584736 CACCAAAGGCGGCCCTGGCATGG - Intergenic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1132912758 16:2323876-2323898 CCCCAAAAGGGGCCCCTGTGTGG - Intronic
1135115312 16:19718530-19718552 CCCCAAACGCGGCCCCCGTCCGG - Intronic
1136014002 16:27383402-27383424 CACCAAAGGTGTCCCCTGGAGGG - Intergenic
1140471719 16:75219040-75219062 CACCAAAGGCGGCCCCCACAAGG - Exonic
1141986243 16:87582337-87582359 CACCGCAGGCGGCTCCTCTTGGG + Intergenic
1143784322 17:9245380-9245402 CACCACAGTCGGGCCCTGTGAGG + Intergenic
1144945519 17:18967723-18967745 CCCCAAAGTCAGCCCCTGGTAGG - Intronic
1150221462 17:63497824-63497846 CACCGCAGGCAGCCCCTGTCTGG + Intronic
1152638339 17:81439339-81439361 CACCGATGCCGGCCCCTGTGGGG - Intronic
1152901856 17:82946959-82946981 CCTCAAAGGCGCCCCCTGTGAGG + Exonic
1162426923 19:10602575-10602597 CAGCAGAGGCGGCCCCTGACCGG - Intronic
1166955057 19:46458300-46458322 CACCAAAGCCAGCCACTGATGGG - Intergenic
927715599 2:25350144-25350166 CACCAGTGGCAGCCCCTTTTGGG - Intergenic
932443130 2:71750773-71750795 CAACAAATTCAGCCCCTGTTTGG + Intergenic
935434131 2:103010065-103010087 CACCAAACGCGGGGCCTCTTGGG - Intergenic
939875935 2:147577852-147577874 CACCAATGGTGGCCCATGTTTGG + Intergenic
941795745 2:169596650-169596672 CTCCAAAGGCAGACACTGTTGGG - Intronic
944261364 2:197681311-197681333 CACCAAAGCTGGCACCTCTTTGG - Intergenic
1175877496 20:62237245-62237267 CAGCAAAGCCAGCCCCCGTTGGG - Intronic
1176301746 21:5101964-5101986 CAACAAAAGCGGCCCCTGTCTGG + Intergenic
1178346498 21:31833079-31833101 CACCAAAGTGTGCACCTGTTGGG + Intergenic
1179855286 21:44159937-44159959 CAACAAAAGCGGCCCCTGTCTGG - Intergenic
1179898949 21:44379014-44379036 CACCAACGGCACCCCCTGTGTGG + Exonic
1180895620 22:19329967-19329989 CACCAAGGGCTGCAGCTGTTTGG - Intergenic
1181756499 22:25028446-25028468 CACCAAAAGCGGCCCCGCTCTGG + Exonic
1184090697 22:42291601-42291623 CAGCAAAGGCAGCCCCTGCATGG + Intronic
956080137 3:65549068-65549090 CAGCCAAGGCGGCCCCTGCTCGG + Intronic
961601991 3:128069482-128069504 CACCAAAGGCCGCGGCTGTGGGG - Exonic
963663863 3:148157621-148157643 TACCAAAGGCAGTCACTGTTAGG - Intergenic
975991784 4:80266049-80266071 CACCAAAGGCTTCCCAAGTTGGG + Intergenic
980708701 4:136535227-136535249 CACCAAAGGGCACCCTTGTTTGG + Intergenic
983534118 4:168839319-168839341 CACCAGATGGTGCCCCTGTTGGG + Intronic
992200523 5:74379386-74379408 CATCAAATGCGGACCCAGTTAGG + Intergenic
1001057067 5:168458423-168458445 CACAAAAGGCGTCCTCTGCTGGG + Intronic
1001244905 5:170098741-170098763 CTCCAAAGGCGGGGCCTGCTGGG + Intergenic
1002670442 5:180861720-180861742 CACCAGAAGCGCCCCCGGTTAGG + Intergenic
1003411449 6:5866524-5866546 CACCTAAGGCGGCCCTTCTAGGG - Intergenic
1006587277 6:35124080-35124102 CACCACAGCCAGCCCCTTTTCGG + Intronic
1008399662 6:51049986-51050008 CACCACAAGTGGCCCCTGCTGGG + Intergenic
1013664968 6:112338492-112338514 CACCCAAGGCTGGCCCAGTTAGG + Intergenic
1019358042 7:591189-591211 CCCCAAAGACTGCCCCTTTTGGG + Intronic
1026674923 7:72420371-72420393 CAGCAAAATCTGCCCCTGTTTGG - Intronic
1026853061 7:73736845-73736867 CACCCAAGGCCTCCCCTGGTAGG + Intronic
1033378047 7:140783298-140783320 CACCAAATGAGGCCCCTTTTTGG - Intronic
1034907350 7:154962026-154962048 CACCAAAGGCGGCCCCTGTTGGG - Intronic
1046676768 8:117117459-117117481 CACCAAAGGCTTCCACTGTTGGG + Intronic
1049778630 8:144417564-144417586 CACCCTCGGTGGCCCCTGTTGGG + Intergenic
1051674765 9:19547725-19547747 CACCACATGAGGCCCCTTTTGGG + Intronic
1055449435 9:76417620-76417642 CACCAAAGGAGTTTCCTGTTGGG - Intergenic
1059324914 9:113498154-113498176 CACCAAATGCTGCCCCTTTAGGG - Intronic
1199710462 X:150465623-150465645 CACCAAAGGCCGGGCCTGTGAGG + Intronic