ID: 1034907573

View in Genome Browser
Species Human (GRCh38)
Location 7:154964176-154964198
Sequence TACTGCCAAAGGTCTATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 80}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034907562_1034907573 26 Left 1034907562 7:154964127-154964149 CCCTATGCCAGCAGCAGCCCCCT 0: 1
1: 0
2: 2
3: 28
4: 322
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907564_1034907573 19 Left 1034907564 7:154964134-154964156 CCAGCAGCAGCCCCCTAGCCGCG 0: 1
1: 0
2: 0
3: 15
4: 206
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907569_1034907573 1 Left 1034907569 7:154964152-154964174 CCGCGACTACTAAAGATCTTCAG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907565_1034907573 9 Left 1034907565 7:154964144-154964166 CCCCCTAGCCGCGACTACTAAAG 0: 1
1: 0
2: 0
3: 3
4: 14
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907566_1034907573 8 Left 1034907566 7:154964145-154964167 CCCCTAGCCGCGACTACTAAAGA 0: 1
1: 0
2: 0
3: 0
4: 52
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907568_1034907573 6 Left 1034907568 7:154964147-154964169 CCTAGCCGCGACTACTAAAGATC 0: 1
1: 0
2: 0
3: 1
4: 16
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907567_1034907573 7 Left 1034907567 7:154964146-154964168 CCCTAGCCGCGACTACTAAAGAT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907560_1034907573 30 Left 1034907560 7:154964123-154964145 CCCACCCTATGCCAGCAGCAGCC 0: 1
1: 0
2: 1
3: 58
4: 465
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907563_1034907573 25 Left 1034907563 7:154964128-154964150 CCTATGCCAGCAGCAGCCCCCTA 0: 1
1: 0
2: 0
3: 27
4: 265
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80
1034907561_1034907573 29 Left 1034907561 7:154964124-154964146 CCACCCTATGCCAGCAGCAGCCC 0: 1
1: 0
2: 2
3: 60
4: 443
Right 1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034907573 Original CRISPR TACTGCCAAAGGTCTATGGT GGG Intronic
908549229 1:65192714-65192736 TACTTCCAAAATGCTATGGTAGG + Intronic
911549588 1:99263420-99263442 TACTGCCAAAGACCTATTGGAGG + Intergenic
912687619 1:111779536-111779558 TTCTGCCAAGGGTCCAGGGTTGG + Intronic
916004296 1:160645715-160645737 TACTTCCCAAGGTCTAGGGGAGG - Intronic
917992983 1:180402447-180402469 CACTGGCAAAGATCTAGGGTAGG + Intronic
1064061615 10:12142331-12142353 TATTGCCAAATGTCTTGGGTGGG + Intronic
1073740447 10:106400128-106400150 AACTTCCAAAGCTCTGTGGTAGG - Intergenic
1075472311 10:122700586-122700608 TATTGCCAAAACTCTATGGAAGG + Intergenic
1080170588 11:29297315-29297337 TACTGCCAAAGGTAAATGGAAGG + Intergenic
1087305104 11:96479919-96479941 TCCTGCCACATGTCTTTGGTTGG + Intronic
1087940382 11:104089665-104089687 TATTGCCAAGTGTCTATGGTTGG + Intronic
1090917424 11:131177852-131177874 TATTGCTAAAGGGCTATTGTAGG - Intergenic
1095455987 12:42386283-42386305 TACTACCAAATGTCTGTGGAGGG + Intronic
1102774221 12:115504855-115504877 TAGTGCCAAAGGCCTATGCAGGG - Intergenic
1105418823 13:20235135-20235157 TACTCCCAAAAGACAATGGTGGG + Intergenic
1106755652 13:32820762-32820784 CACTGCAAAAGGGCTAGGGTGGG + Intergenic
1111901537 13:94205900-94205922 CACTGCCAAACGTCTCTGATGGG - Intronic
1121114441 14:91333744-91333766 TACTCCCTAGGGTCTAGGGTGGG + Intronic
1125297747 15:38221366-38221388 TACTGTCCAAGGTCTATGGAGGG + Intergenic
1125340582 15:38671700-38671722 TATTTCCGAAGGTCTATGGGTGG + Intergenic
1126873249 15:53011478-53011500 TACAGCCAGAGCTGTATGGTTGG + Intergenic
1127410790 15:58704454-58704476 TATTGCCAAAGTTCATTGGTTGG - Intronic
1130745812 15:86652839-86652861 TACTGTCAAATGTCTCTGGCAGG - Intronic
1131576616 15:93598649-93598671 TAATGGCAAATGTCTCTGGTTGG + Intergenic
1134433991 16:14238082-14238104 CATTGCCAAATGTCTGTGGTGGG - Intronic
1140395346 16:74621579-74621601 TAGTGACAAAGGAATATGGTGGG + Exonic
1146790580 17:35748420-35748442 TACTGCCTCAGGTCTAGGGGAGG + Intronic
1155184991 18:23379803-23379825 TGCTGCCAAAGGGCTAGGGGTGG + Intronic
1160259074 18:77274279-77274301 TACTGGAAAAGTTCTATGTTGGG - Exonic
927022424 2:19030913-19030935 CACTGCAAAAGTTCTCTGGTGGG + Intergenic
929744435 2:44641448-44641470 TACTGCCTTAGGTCTGGGGTTGG - Intronic
930625913 2:53697624-53697646 TACTTCCAAAATTCAATGGTGGG + Intronic
935977107 2:108589046-108589068 TGCTGCCTAGGGTCTTTGGTGGG + Intronic
936502270 2:113075412-113075434 TCCTGCTCAGGGTCTATGGTAGG + Exonic
943822732 2:192347912-192347934 CTCTGCCAATGGTCGATGGTTGG - Intergenic
947047476 2:226004901-226004923 TACTTCCAAAGTACAATGGTGGG + Intergenic
947501519 2:230674642-230674664 TGCTGCCAAAGGTCTAAGGGTGG - Intergenic
1169869689 20:10237459-10237481 GAGTGCCAAGGGTATATGGTGGG + Intronic
1172002512 20:31790746-31790768 TACTTGCCAAGGTCTATGTTAGG + Intronic
1179615959 21:42583684-42583706 TACTGCCCGTGGTCTCTGGTGGG - Intergenic
1183304225 22:37073578-37073600 CACTGCCCAAGGTCTGTGATGGG - Exonic
951263771 3:20543236-20543258 GACTGCCAAATATCTATGGATGG - Intergenic
951604011 3:24411666-24411688 TATTGCCAAATGTCTCTTGTGGG - Intronic
952296508 3:32067328-32067350 CACTGCCAAAGCTCTGTGGAGGG + Intronic
952331947 3:32371817-32371839 TACTTTCAAAGGTCTGGGGTGGG - Intergenic
953969124 3:47333344-47333366 CACTGCCAAAGGTCTAAGCAGGG + Intronic
955337370 3:58097901-58097923 CACTGCAAAAGGTCCAGGGTTGG + Exonic
956813887 3:72890213-72890235 CACTGTCAAAGGGTTATGGTTGG - Intronic
956908596 3:73793477-73793499 TATTACCAAAGCTATATGGTTGG + Intergenic
958779046 3:98519784-98519806 TACTGCAAAGGCTCTATGGCGGG - Intronic
961011794 3:123441225-123441247 AACTTCCAAAGGTCTAGGGTAGG - Intronic
961775686 3:129283151-129283173 TACTGCCAGAAGTCTCTGGATGG + Intronic
963312837 3:143727617-143727639 TCCTGCCAAAGTTTTATGGCTGG + Intronic
963563255 3:146894428-146894450 TATTGAAAAAGGTCTACGGTAGG - Intergenic
965146358 3:164910744-164910766 TACTTCCAAAGTTCTATCTTGGG - Intergenic
971329314 4:25669637-25669659 TCCTGCAAAAGCTCTATGGGAGG - Exonic
971994118 4:33942111-33942133 TACTGTCCAAGGTCTATGCAAGG - Intergenic
972634630 4:40872252-40872274 TTCTGCTAAAAGTCCATGGTGGG - Intronic
981774649 4:148351527-148351549 TGCTGACAAAGGTCAATGGTAGG - Intronic
987726871 5:21714755-21714777 TAATGCCAAGGGTATATGGCTGG - Intergenic
994340478 5:98621680-98621702 TCCTGCCAAAGGTGTATAATCGG - Intergenic
994936287 5:106257118-106257140 CACTGCCTAAGTGCTATGGTGGG + Intergenic
997121827 5:131182007-131182029 GAGTGCCAAAGGTTTATAGTAGG + Intronic
1002301048 5:178257429-178257451 TGGTGCCAAAGGTCCAGGGTAGG + Intronic
1010877824 6:81129992-81130014 TTCTTCTATAGGTCTATGGTTGG - Intergenic
1017712882 6:157185634-157185656 TACAGCCAGAGGTGTCTGGTGGG - Intronic
1018139913 6:160821015-160821037 TACTGATAAGGGTCTATGTTCGG - Intergenic
1022484090 7:30764730-30764752 AACTGCCAAAAGTCTCTGCTTGG + Intronic
1033350783 7:140559995-140560017 TTCTCCCAGAGGTCTATAGTTGG - Intronic
1034907573 7:154964176-154964198 TACTGCCAAAGGTCTATGGTGGG + Intronic
1037003380 8:13747780-13747802 CACGGCCAGAGGTCTATTGTGGG + Intergenic
1041985296 8:63915641-63915663 TACTCATAAAGGTTTATGGTTGG + Intergenic
1046064667 8:109182154-109182176 TACTGCCAAAGCCCCAAGGTGGG - Intergenic
1046336491 8:112795580-112795602 TTTTGCCAGAGGTCTATTGTAGG - Intronic
1046746793 8:117884461-117884483 TACTGCCAAATGTAGAAGGTGGG + Intronic
1050592240 9:7172961-7172983 TAAAGCCTAAAGTCTATGGTAGG - Intergenic
1053541608 9:38979543-38979565 TATGTTCAAAGGTCTATGGTTGG - Intergenic
1053806008 9:41802493-41802515 TATATTCAAAGGTCTATGGTTGG - Intergenic
1054624531 9:67384366-67384388 TATGTTCAAAGGTCTATGGTTGG + Intergenic
1055166918 9:73207976-73207998 TTTTACCAAAGGTCTATGGTAGG - Intergenic
1055291151 9:74783527-74783549 TAGCTCCTAAGGTCTATGGTAGG - Intronic
1056102000 9:83308759-83308781 TAGAGCCAAAGGTTTATGGGTGG - Intronic
1059668352 9:116470849-116470871 TAATGCCAATGCTTTATGGTGGG + Intronic
1186494974 X:10005851-10005873 TATTGCCAAATGTCTCTGGGGGG + Intergenic
1188681315 X:33010918-33010940 TAATTCCATAGGTCTAGGGTGGG - Intronic
1192614930 X:72609662-72609684 TACTGTCAAATGTTTCTGGTGGG + Exonic
1195317785 X:103695602-103695624 TACTGCCAAATTTCTCTGGTTGG - Intergenic
1196157512 X:112447243-112447265 TACTGACAAAGATGTTTGGTAGG + Intergenic
1199219139 X:145297022-145297044 TGCTTCCAAAGGACAATGGTGGG + Intergenic