ID: 1034910115

View in Genome Browser
Species Human (GRCh38)
Location 7:154989468-154989490
Sequence TGAGCACCAAAATGACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034910115 Original CRISPR TGAGCACCAAAATGACAGCC TGG Intronic
901714976 1:11146016-11146038 TCATCACACAAATGACAGCCTGG + Intronic
902242905 1:15100558-15100580 CGAGCAGCGGAATGACAGCCAGG + Intronic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
903225153 1:21890431-21890453 TGAACACCACACTGACAACCTGG + Exonic
905141464 1:35848529-35848551 TGAGCACCCATATGACTGCTAGG - Intronic
906073781 1:43036499-43036521 TGTGGACCATCATGACAGCCTGG - Intergenic
906821178 1:48931914-48931936 AGAGCACCAGAATGGGAGCCAGG - Intronic
909199186 1:72667598-72667620 TGTGCAACAATATGACATCCAGG - Intergenic
910548447 1:88447857-88447879 TTTTCACCAAAATGACAGACTGG + Intergenic
913288975 1:117254430-117254452 TGAGCACAAGCATGACAGCCTGG - Intergenic
914206744 1:145538006-145538028 TTAGAACCAAAATGACTGACTGG - Intergenic
914228229 1:145739968-145739990 TGAGAATCAAAATGAGAGTCTGG + Exonic
916002985 1:160634419-160634441 TGAGCATAAAAATGCCACCCTGG + Intronic
917536035 1:175875374-175875396 TGAGCACCATATTGACAGAAAGG - Intergenic
918229929 1:182518912-182518934 AGAGTACCAAAATGGCAGCATGG - Intronic
918449671 1:184646471-184646493 TAAGCAGCAAAAAGACAGGCAGG - Intergenic
919617420 1:199825092-199825114 TCAAAACCACAATGACAGCCAGG + Intergenic
919831342 1:201542165-201542187 TGAGCCCTAAACTGAAAGCCAGG - Intergenic
921251942 1:213306531-213306553 TGAGCTCCATTATGACATCCAGG - Intergenic
1064261084 10:13787196-13787218 TTATCACCAAGACGACAGCCTGG + Intronic
1064416414 10:15154083-15154105 TGTGCCCTAAAATGACAGCAGGG + Intronic
1070312138 10:75281643-75281665 TGGGTATCAAAATGAGAGCCTGG - Intergenic
1073862887 10:107767595-107767617 TGAGCAACAAAGTGAGACCCTGG + Intergenic
1073875878 10:107920760-107920782 TGGGCACCAATTTGACAGTCTGG - Intergenic
1077406581 11:2385100-2385122 TTAGCGCCAAGATGGCAGCCTGG + Intronic
1080052917 11:27874984-27875006 GGAGCACCTAGATTACAGCCTGG + Intergenic
1080396354 11:31893779-31893801 TGAGCCCCAGTATGACAGGCTGG + Intronic
1084711920 11:70848919-70848941 TGAGCACCATACAGACAGCTGGG + Intronic
1085802604 11:79604366-79604388 TGACCAGCAGAGTGACAGCCAGG - Intergenic
1087754297 11:102038864-102038886 TGAAAAACAAAATGTCAGCCAGG + Intergenic
1088320503 11:108550365-108550387 TGGGCACCACTATGACAGCTTGG - Intronic
1088353033 11:108911093-108911115 TAAGCATTAAAATGAAAGCCAGG - Intronic
1091982991 12:4881686-4881708 AGAGCTCCGAAATAACAGCCGGG - Intergenic
1092526011 12:9310820-9310842 TGGGCACCACAATGACAATCAGG - Intergenic
1092541277 12:9420987-9421009 TGGGCACCACAATGACAATCAGG + Intergenic
1096139166 12:49227943-49227965 CCAGCTCTAAAATGACAGCCTGG + Intronic
1097650708 12:62293649-62293671 AAAGAACCAAAATTACAGCCGGG - Intronic
1100125867 12:91424109-91424131 AGAGAACCAAAATAACATCCTGG - Intergenic
1103332455 12:120163599-120163621 AGAGCACAGAAATAACAGCCAGG + Intronic
1105264966 13:18807899-18807921 CCAGCACCAAAGAGACAGCCTGG - Intergenic
1105639539 13:22248055-22248077 TCACTACCAAAACGACAGCCTGG - Intergenic
1106875307 13:34065501-34065523 TGCGCCCCAACATGACACCCAGG - Intergenic
1106889606 13:34230217-34230239 CCAGCACCAAAGGGACAGCCTGG + Intergenic
1108435248 13:50396316-50396338 TGAGCACTAAGATGATTGCCAGG - Intronic
1108753408 13:53472275-53472297 TGGGCAGGAAAATGCCAGCCAGG + Intergenic
1109341985 13:61074415-61074437 AGAGACCCAAAATGACAACCTGG + Intergenic
1112440567 13:99421864-99421886 GGAGCACCAAAATGAGATGCAGG - Intergenic
1118563276 14:67110813-67110835 TGTGCCACCAAATGACAGCCTGG + Intronic
1119255494 14:73192415-73192437 TGGGCAACAAAATGAGACCCTGG + Intronic
1122850997 14:104530878-104530900 TAATCAGCAGAATGACAGCCAGG + Intronic
1123019999 14:105393181-105393203 GGAGCAGCAAGATGACAGCAGGG + Intronic
1126070109 15:44858770-44858792 AGAGGACCAAAATGAAACCCAGG - Intergenic
1126205282 15:46038337-46038359 TGATAACTAAAATGGCAGCCAGG - Intergenic
1126578830 15:50223707-50223729 TGAGCAATAAAATGACTGACAGG - Intronic
1132728723 16:1350202-1350224 TCCGCAGCAAAATGACAGCAAGG + Exonic
1133928318 16:10211596-10211618 TCTGCACCAAAGTGCCAGCCTGG - Intergenic
1139319743 16:66104786-66104808 TGGGCACCAGGATCACAGCCAGG + Intergenic
1142294171 16:89209487-89209509 TGAGCCCCAAAATTGCAGCTTGG - Intergenic
1143336276 17:6173936-6173958 GGAGCTCCACAAAGACAGCCTGG + Intergenic
1143838435 17:9711730-9711752 TGAGCACAAAAAGGAAAGCATGG - Intronic
1144023597 17:11258524-11258546 AGAGCACCAAAATGAAAACTTGG - Intronic
1146277466 17:31524618-31524640 TGAGCACCCCAGTGACAGCCTGG - Intronic
1146405842 17:32536830-32536852 TAACCACCAAAATGAAATCCTGG - Intronic
1149227420 17:54490313-54490335 TGAGCAGCTGAATGTCAGCCTGG + Intergenic
1150764201 17:67990338-67990360 TGTGCACCTAAAGGACATCCAGG - Intergenic
1154335806 18:13463464-13463486 TGAGCACAAAAATAACAGAATGG - Intronic
1154336085 18:13466010-13466032 TGAGCACCGAAGGCACAGCCTGG - Intronic
1155158165 18:23175384-23175406 TGAGGTCAAAAATGAAAGCCAGG - Intronic
1155510959 18:26576355-26576377 TGAGCACCCAAATCTCAGCAAGG - Intronic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1161582008 19:5086214-5086236 TGAGCACAAAAATGACAGAAAGG - Intronic
1162548865 19:11347245-11347267 TGAGCACCTAATTGAGTGCCGGG - Intronic
1162915724 19:13873412-13873434 TGAGGCCCAAAATAACCGCCTGG - Intronic
1164147047 19:22518523-22518545 AGAGCACCTCAGTGACAGCCTGG + Intronic
1165288955 19:34867684-34867706 TGAGCACCAGAGTGACACTCTGG + Intergenic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1167114796 19:47483000-47483022 TGAAAACTAAAATGCCAGCCGGG - Intronic
926202020 2:10807970-10807992 TGAGCACTAAAAAGACAGCATGG - Intronic
927357480 2:22189440-22189462 TGAGCACCACCATGACACTCAGG - Intergenic
928375731 2:30771661-30771683 GGAGTACCAAAAGGACAACCTGG + Intronic
930650656 2:53961277-53961299 TGAACACCAAACTGAGAGCATGG - Intronic
931460021 2:62442534-62442556 TGACCACCAAACTGGCAGCTTGG + Intergenic
932388539 2:71361999-71362021 TCAGCAGCAAGATGAAAGCCAGG - Intronic
935652551 2:105394558-105394580 TGAGCAACAGAATGAGACCCTGG + Intronic
936063506 2:109313446-109313468 CAAGCACCCAAATGTCAGCCAGG - Intronic
936616402 2:114052161-114052183 TCAGCACCAAAATGTCAAACTGG + Intergenic
939142770 2:138375869-138375891 TGAGCACAAAAATGGCAATCTGG - Intergenic
940834806 2:158509446-158509468 TGAGCAAGAAAATGAAAGACTGG - Intronic
942323816 2:174758495-174758517 TGAGCACCAACATGACACTCAGG + Intronic
948250337 2:236523087-236523109 GGAGCAGCAAAAGGAGAGCCAGG + Intergenic
948418198 2:237832489-237832511 TGAACATCAAAATCACAGCCTGG - Intronic
1169241008 20:3980928-3980950 TGTGCAACAACATGGCAGCCTGG - Intronic
1171992739 20:31708944-31708966 TGAGTCCCAAAATAACAACCAGG + Intronic
1172232686 20:33347752-33347774 CGACCGCCAACATGACAGCCAGG - Intergenic
1173062699 20:39677522-39677544 TGAGAACCAGAAAGACAGCATGG - Intergenic
1173275198 20:41574303-41574325 GGAGCTCCAAAATGCCAGCATGG + Intronic
1175263273 20:57688015-57688037 TGAGCACCATAAGGTCAGGCCGG + Intronic
1175386958 20:58603383-58603405 TGAGCACCTAAGAGAAAGCCAGG + Intergenic
1175818445 20:61895846-61895868 CGGGGCCCAAAATGACAGCCTGG - Intronic
1175869756 20:62203137-62203159 AGAGCATCAAGATGAAAGCCAGG - Intronic
1177262933 21:18752698-18752720 TGAGCACCAACATGATACCACGG + Intergenic
1180089485 21:45526517-45526539 TGAGCACCGGAAAGACAACCCGG - Intronic
1182103418 22:27672628-27672650 TGAGCACCATTCTGACAGCCAGG + Intergenic
1183073266 22:35411003-35411025 TGAGCAACACAAGGACATCCTGG - Intronic
1184233755 22:43172141-43172163 TGGGCACCAACATGAGAACCAGG - Intronic
1184258708 22:43302201-43302223 TGAGCACCAAAGCCACAGGCTGG - Intronic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
954460996 3:50626889-50626911 TCATCAGCAAAATGAGAGCCTGG + Intronic
954574957 3:51670960-51670982 GGAGCACCACAGTGACAGCCTGG - Intronic
955794363 3:62620325-62620347 TGAGCACCACAATCACAGCAAGG + Intronic
956128215 3:66031125-66031147 TGAGCTGCAAAAAGACAGGCAGG + Intronic
957188156 3:76970198-76970220 AGAGCAGCAAAATGACAACGTGG - Intronic
958427029 3:93990567-93990589 TAAGCACCAACATGACACCACGG - Intronic
958739145 3:98047222-98047244 TGAGTACCAATTTGTCAGCCTGG + Intergenic
958827672 3:99051395-99051417 TGTGCTCTAAGATGACAGCCAGG - Intergenic
961909982 3:130304363-130304385 TCAGCACCAAGAAGACAGTCAGG - Intergenic
967447386 3:189582851-189582873 TGAGCACTAAAATGAGAGTCAGG - Intergenic
968181920 3:196601727-196601749 TGAGCACCACACTGACAGGCCGG + Intergenic
969123888 4:4931694-4931716 TCAGGGCCAAGATGACAGCCAGG + Intergenic
969298269 4:6282068-6282090 AGGGCACCAAACTGACAGGCAGG - Intronic
969465225 4:7352439-7352461 TAAGCTCCAAAATGGCATCCAGG - Intronic
970383030 4:15527246-15527268 TGAACAGCAAAATGAAAGACTGG - Intronic
971042642 4:22771351-22771373 TCAGCAGGAAAATCACAGCCTGG - Intergenic
973259929 4:48152692-48152714 TGAGTAGCTAAATGGCAGCCTGG - Intronic
982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG + Intronic
984072917 4:175138839-175138861 TAAGCTGCAAAATAACAGCCTGG - Intergenic
986379522 5:7169648-7169670 TGAGCACCTAAATGAAAGGAGGG + Intergenic
987312407 5:16693413-16693435 TGAACTCCAAAGGGACAGCCTGG + Intronic
988181948 5:27806961-27806983 TGAGCAACAGAACGACACCCTGG - Intergenic
991394016 5:66184536-66184558 TGAAAACCAAAATGGCAGCTGGG - Intergenic
992195190 5:74332190-74332212 TTAGCACCGAAGTGACAGCCGGG - Intergenic
994654986 5:102581431-102581453 GGAACTCCAGAATGACAGCCAGG - Intergenic
998173559 5:139886447-139886469 TGAGGAGGAAAATGACAGCCAGG + Intronic
998620832 5:143792591-143792613 TGAACACAAGAATGAAAGCCTGG + Intergenic
1002924308 6:1595890-1595912 GGAGCACCAAAAGAACAGCTTGG + Intergenic
1005487092 6:26310959-26310981 TGAGCACTCAAATAACACCCTGG + Intergenic
1006238643 6:32658324-32658346 TGAGGACCTGCATGACAGCCTGG + Intergenic
1007474371 6:42108929-42108951 TGAGCACCCAACTGTCAGGCAGG + Intronic
1007819499 6:44550588-44550610 TGAGCCACAAAAGGGCAGCCTGG - Intergenic
1008969570 6:57351271-57351293 TGAGCATCAACATGACACTCAGG - Intronic
1015310210 6:131758607-131758629 TGATCAGCAAAATGGCAGACTGG + Intergenic
1017705635 6:157120224-157120246 TGAGCACCCAGATGACAGATGGG - Intronic
1018398395 6:163399132-163399154 TGAGTCCCAAAATGAGAGCATGG - Intergenic
1019294434 7:266469-266491 TGAGTCCCAAAAGGACAGCCTGG - Intergenic
1020897153 7:13954688-13954710 TTAGCACCAAAATGACATGCTGG + Intronic
1022908786 7:34880415-34880437 TAAGAACCAAAATGAGAGGCAGG - Intergenic
1029312460 7:99679833-99679855 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029323263 7:99784018-99784040 GGAGCACCAGGCTGACAGCCAGG + Exonic
1029958858 7:104668630-104668652 TGAAGACCAATATGACAGACGGG + Intronic
1033201957 7:139380764-139380786 TGAGGAAAAAAATGACAGCTTGG - Intronic
1033474955 7:141683144-141683166 TAAGCATCAAAATGACAAACAGG + Intronic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1037290565 8:17345429-17345451 TGAGGAGCAGAGTGACAGCCAGG - Intronic
1037583118 8:20257814-20257836 TGAGCACCACCATGACTGGCTGG + Intronic
1037974329 8:23199325-23199347 TGAGCAGCAAATGGAAAGCCAGG - Exonic
1038018185 8:23532284-23532306 TGAGCAGCAAAGTGATACCCAGG + Intronic
1041599173 8:59695379-59695401 TAAACACCAGATTGACAGCCTGG - Intergenic
1041694018 8:60716421-60716443 TGAGCATCTAAAGGACAGCAAGG - Intronic
1044538628 8:93385273-93385295 TGAGCACCAACATGGCAAGCTGG - Intergenic
1046845470 8:118910490-118910512 TGAAACCCAGAATGACAGCCAGG + Intergenic
1047003934 8:120600358-120600380 TGAGGTCCCAAATGACAACCAGG + Intronic
1048689298 8:136941833-136941855 TGAGCTCCCAAATGCCAGGCTGG - Intergenic
1050098918 9:2097985-2098007 TGAGCATCAGGATGAAAGCCTGG - Intronic
1052181796 9:25537859-25537881 TGAAAAACAAGATGACAGCCGGG - Intergenic
1052817761 9:33114686-33114708 TGAGGACCAAAATGAAAGCCTGG + Intronic
1055794691 9:79962986-79963008 TTAGGAACAAAATGCCAGCCTGG + Intergenic
1055835236 9:80432029-80432051 AGACCACAAGAATGACAGCCAGG - Intergenic
1057720339 9:97527323-97527345 TGGGCACCAACAGGGCAGCCTGG + Intronic
1059549324 9:115212859-115212881 TGTGGACCAAATTGACAGGCTGG - Intronic
1059680236 9:116578856-116578878 TGAGCAGCAGAAAAACAGCCTGG + Intronic
1060573077 9:124661377-124661399 TGAGCACCAACAGGCCAGACTGG + Intronic
1061766218 9:132883110-132883132 GGAGCACCTAAATCACAGCAGGG + Intronic
1062402472 9:136378586-136378608 TGAGCACCCAGGTGACAGGCAGG + Exonic
1062667964 9:137687704-137687726 TGAGCCCGGAAATGAGAGCCTGG + Intronic
1185924419 X:4130819-4130841 GGATCAGCAGAATGACAGCCAGG - Intergenic
1186590400 X:10924642-10924664 TCAGAGCCAAAATGGCAGCCAGG + Intergenic
1186868448 X:13745046-13745068 TGAGCACGAAACTGACAGACAGG - Intronic
1188710014 X:33384719-33384741 GGAGCACCAGACTGACAGCCAGG - Intergenic
1189381997 X:40508622-40508644 TGGCCACAACAATGACAGCCAGG - Intergenic
1191029536 X:55953161-55953183 TGAGCTCCAAGATGTCAGGCAGG - Intergenic
1192380764 X:70613910-70613932 TGTGCATCAAAATGTCATCCAGG - Intronic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1194049803 X:89054509-89054531 TCAGCACCAACCTGCCAGCCAGG - Intergenic
1195142070 X:101971449-101971471 TGAGAACCAAAATGAACTCCAGG - Intergenic
1195641782 X:107183405-107183427 TGAGCAACATAATGAGACCCTGG + Intronic
1196070941 X:111521021-111521043 TGGGCACAAAAGTGAGAGCCTGG - Intergenic
1196227962 X:113188764-113188786 TGGGCACCAATATAACAGTCTGG + Intergenic
1198937317 X:141911966-141911988 TGAGCACCATAATGACATATGGG + Intergenic
1199520470 X:148729569-148729591 TCACCACCAGAATGAAAGCCTGG - Intronic
1201179360 Y:11331509-11331531 TGATCAACAAAGTGATAGCCGGG - Intergenic
1201399115 Y:13583632-13583654 TAAGCCTCACAATGACAGCCTGG - Intergenic