ID: 1034910239

View in Genome Browser
Species Human (GRCh38)
Location 7:154990901-154990923
Sequence GAAAATAGCTTCTCTAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034910239 Original CRISPR GAAAATAGCTTCTCTAAAAC TGG Intronic
901589688 1:10330499-10330521 AAAAATAGCTATTCAAAAACAGG - Intronic
902431728 1:16368113-16368135 GAAAATAGTTTATCTCAAAGAGG + Intronic
905578123 1:39062403-39062425 GAAAATAGCGTCTTTGAAGCCGG + Intergenic
906348283 1:45035130-45035152 GAGAATACCTTAGCTAAAACAGG - Intronic
906741323 1:48188312-48188334 GAAAATATTTTGTCTAAAAAAGG - Intergenic
909136817 1:71811677-71811699 GAAAACTTCTTCTCTAAAACAGG - Intronic
909203240 1:72720220-72720242 GAAAATAGCTTCAGAAAAAATGG - Intergenic
910705325 1:90123311-90123333 GAAAACAGCTTTCCTTAAACCGG + Intergenic
912216890 1:107624600-107624622 GAAATTTGCTTTTCTAATACTGG + Intronic
912766356 1:112415437-112415459 GGAAATTGGTTATCTAAAACTGG + Intronic
912983568 1:114402928-114402950 GGAAGTAGCTTCTCTAGAGCAGG - Intronic
913068090 1:115275525-115275547 GAAAAAAGCAAATCTAAAACAGG - Intergenic
913234025 1:116765049-116765071 GAAAACAGCTGTTCTAAAGCAGG + Intronic
915798238 1:158760426-158760448 AAACAATGCTTCTCTAAAACTGG + Intergenic
917809335 1:178642319-178642341 GAAATTAGCATGTCTAAACCCGG + Intergenic
919544565 1:198898877-198898899 GAAAATACTTTCTCAGAAACTGG - Intergenic
920208972 1:204314364-204314386 GAAGAAAGCTTTTCTAGAACAGG - Intronic
920680626 1:208069730-208069752 GAAGATAGGGTCTCTAGAACGGG - Intronic
921560215 1:216648607-216648629 AAAAATATCTTCTTTAAACCTGG + Intronic
921607989 1:217177567-217177589 GAAAACAGAATCACTAAAACTGG - Intergenic
921676658 1:217983547-217983569 GAAAATAGATTTTCTTAAAAGGG + Intergenic
921822719 1:219636133-219636155 AAACATTCCTTCTCTAAAACAGG - Intergenic
923584356 1:235253028-235253050 GAAAACATCTTGTATAAAACAGG + Intronic
924332862 1:242957463-242957485 CAAAATGACTTATCTAAAACAGG - Intergenic
924833400 1:247622730-247622752 GAAAATGACTTCTTTAAATCAGG + Intergenic
1062855299 10:777140-777162 GAAAATCACCTTTCTAAAACGGG - Intergenic
1063185934 10:3651574-3651596 AAAAATTGCTTCCCTAAAATAGG + Intergenic
1063260151 10:4378662-4378684 AAAAATAGCCTTTCTAAAATAGG - Intergenic
1064843505 10:19624348-19624370 GAAAATAACTTTTCTATACCTGG - Intronic
1068572158 10:58642109-58642131 GTAAATAGTTACTCTAAAGCTGG + Intronic
1068708714 10:60107830-60107852 GCAAATACCTTCTCTTACACTGG + Intronic
1073954234 10:108849497-108849519 TAAAATAGATTCACTAAGACTGG + Intergenic
1076225801 10:128774219-128774241 GCAAACAGCATCTATAAAACAGG - Intergenic
1076486164 10:130819219-130819241 GAAAATTGCTTCCCCCAAACTGG + Intergenic
1077986334 11:7355016-7355038 GAAAATCCCTTCTCTATTACAGG - Intronic
1081023854 11:37983595-37983617 GAAAATAGATTCTCTACAATGGG - Intergenic
1081333374 11:41832314-41832336 GAAATTAGATTCTCCCAAACTGG + Intergenic
1081588839 11:44407040-44407062 GAACATAGCTTCTCTGAAAAAGG + Intergenic
1082571644 11:54747914-54747936 GAAAATATCTTCTGATAAACTGG - Intergenic
1082845256 11:57719867-57719889 CAAATTGGCTTCTCCAAAACTGG + Intronic
1085134701 11:74075682-74075704 GAAAACTGGTTATCTAAAACAGG - Intronic
1085947647 11:81291164-81291186 GAAAAAACCTTCTCTACATCTGG + Intergenic
1085984744 11:81771993-81772015 GAAGTGAACTTCTCTAAAACAGG + Intergenic
1086159182 11:83702170-83702192 TAACATATCTTCTCTTAAACAGG + Intronic
1086447641 11:86885039-86885061 GAAAACAGCTTCTTGAAGACAGG + Intronic
1086538434 11:87878596-87878618 GGAAATTGCTTTTTTAAAACTGG - Intergenic
1088745607 11:112801594-112801616 GAAGAGAGCTTCTCCATAACTGG - Intergenic
1089805963 11:121089829-121089851 GAACATACCTTTTCTAAAATAGG + Exonic
1090157494 11:124456860-124456882 GAAGACATCTTCTATAAAACTGG - Intergenic
1091731838 12:2886695-2886717 GAATATAGCTACTATACAACAGG + Intronic
1092968017 12:13663814-13663836 GAAATTAGATTCTAGAAAACAGG - Intronic
1093352026 12:18115479-18115501 GCAGATAATTTCTCTAAAACAGG - Intronic
1094218890 12:27972784-27972806 GAAAATATCCTTTCCAAAACAGG - Intergenic
1094291058 12:28850623-28850645 GAAAACAGCTTCTCTGACCCAGG - Intergenic
1095099384 12:38164623-38164645 GAAAATAGCCTCACAAAGACAGG - Intergenic
1097583668 12:61489437-61489459 GATAATTTCTTCTCTGAAACAGG - Intergenic
1100629074 12:96368787-96368809 GAAAGAAGCTACTCTAAGACGGG + Intronic
1101254088 12:102960457-102960479 GAAACTAGTTTGTATAAAACAGG - Exonic
1106602083 13:31196861-31196883 TAAAATAGAATGTCTAAAACAGG - Intergenic
1107561681 13:41562482-41562504 GAAAATAGCTGTTCCAACACTGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1110327239 13:74230762-74230784 GAAGCAAGCTTCTCTAAACCTGG + Intergenic
1111515946 13:89331202-89331224 GAAAATAGCATTTCTGAAACTGG - Intergenic
1111572847 13:90109159-90109181 GAAAAGAGCTACTTTAAAACTGG - Intergenic
1112077070 13:95926801-95926823 GAAAATAGTTTGTTTAAAAAAGG + Intronic
1116548599 14:46205085-46205107 GAAAGTAGTTTCTTTAAAAATGG + Intergenic
1116697546 14:48196525-48196547 GAAAATAGTATATCTAAAACAGG - Intergenic
1118469603 14:66063053-66063075 GAAGAAAGCTTATCTGAAACTGG + Intergenic
1120496369 14:85242079-85242101 GAAAAGATCTTCTTTGAAACTGG + Intergenic
1121031570 14:90662738-90662760 GGAAATAGCTCCTCAGAAACAGG + Intronic
1124239352 15:28017128-28017150 GAAAATAGGATCTCTGAAACCGG + Intronic
1124911515 15:33925917-33925939 GAAAATAGCTTAAATAATACAGG - Intronic
1126357698 15:47813494-47813516 TAAAATAGCTTTTCTACAAAGGG - Intergenic
1126429774 15:48570220-48570242 AAAAATGGCTTCTAAAAAACAGG - Intronic
1126524956 15:49643162-49643184 GAAAATATCTTGTTTCAAACTGG + Intronic
1126994195 15:54421131-54421153 CAAAATAACCTCTCTAAAAGGGG - Intronic
1129081534 15:73045431-73045453 GACAATAGGTTCTCCAAAAGAGG + Intergenic
1129481204 15:75827871-75827893 CAAAATCACTTCTCTACAACAGG - Intergenic
1133876533 16:9740213-9740235 GAAACCAACTTCTCTAAAATTGG - Intergenic
1134029301 16:10978964-10978986 GAAAATAACTTCCCAAGAACAGG + Intronic
1137399169 16:48139436-48139458 GAGAAAAACTTCTCTAAAGCAGG + Intronic
1138048056 16:53746530-53746552 GAAACTACATTCTCTAAAGCTGG - Intronic
1139228973 16:65263633-65263655 GGTAATAGCTGCTCTAGAACTGG - Intergenic
1140485364 16:75289141-75289163 GAAAAAAACTGCCCTAAAACAGG - Intergenic
1140957760 16:79881532-79881554 GAAAGAAGTTTCTCTAACACGGG - Intergenic
1142376866 16:89711084-89711106 GCAAGTCGCTTCTCTGAAACCGG - Intronic
1144284918 17:13764532-13764554 GATAACTACTTCTCTAAAACAGG - Intergenic
1148294451 17:46488765-46488787 AAAATTATCTTCTATAAAACTGG + Intergenic
1148316634 17:46706478-46706500 AAAATTATCTTCTATAAAACTGG + Intronic
1148318731 17:46729751-46729773 GAAAATATTTACTCTTAAACTGG + Intronic
1150562913 17:66310581-66310603 GCAAATACCTTCTCTGAAACAGG - Intronic
1150689852 17:67355805-67355827 CAAAATAGTCTCTCTAAAAATGG + Intronic
1151226223 17:72650262-72650284 GAAAGCAGCTTCTCAAAGACAGG - Intronic
1152158644 17:78652732-78652754 GGAAATAGTTCCTCTAAGACTGG + Intergenic
1153948221 18:10035464-10035486 AACAATTTCTTCTCTAAAACAGG - Intergenic
1155586204 18:27368734-27368756 GAAAATGGTTTCTGTACAACTGG + Intergenic
1155982084 18:32191252-32191274 GAAAATAGATTCTCCACAAATGG - Intronic
1156914438 18:42448397-42448419 GCAAAGAGATTATCTAAAACTGG - Intergenic
1157908881 18:51596457-51596479 GAAAAAAGCTTCTCAACAGCAGG + Intergenic
1158982575 18:62778424-62778446 GGAAATAGCTTCTGTTGAACCGG + Intronic
1159308374 18:66675441-66675463 AAAAATAGATACTCTAAATCTGG - Intergenic
1159482400 18:69006972-69006994 GAAAATATTATCTCTAACACGGG + Intronic
1160445916 18:78926590-78926612 GCATCTAGCTTCACTAAAACCGG + Intergenic
1163354826 19:16803456-16803478 GAAAGTAGCTAGTCAAAAACAGG + Intronic
1163354900 19:16803944-16803966 GAAAGTAGCTGGTCAAAAACAGG + Intronic
1164550740 19:29210330-29210352 AAAAATAGTTTCTCTAAGTCAGG + Intronic
1164742470 19:30586166-30586188 GACAACAACTTCTCTGAAACAGG + Intronic
1167143625 19:47669211-47669233 GAAGGAAGCTTCTCTAACACAGG - Intronic
925198828 2:1949856-1949878 AAAAATACCATCTCTAAAAGAGG - Intronic
929137499 2:38638537-38638559 CAAACTAGCTTCTGAAAAACAGG - Intergenic
929379329 2:41331835-41331857 GAACATAGCTTCTCTAATAATGG - Intergenic
932848533 2:75159440-75159462 GAAACTAGTTTCTGTAAAACTGG + Intronic
932985304 2:76719358-76719380 GAAAATATTTTCTCTACAAAAGG - Intergenic
933284629 2:80372353-80372375 AAAAAAAACTTCTCTAAAAATGG - Intronic
935378497 2:102424510-102424532 GTATACAGCTTCTCAAAAACTGG + Intronic
935475879 2:103523296-103523318 GAAAACAGTGTCTCTAAATCTGG + Intergenic
935881766 2:107572651-107572673 ATAAATATATTCTCTAAAACTGG + Intergenic
936615739 2:114045828-114045850 AAAAATAGCCTCAATAAAACTGG - Intergenic
936660761 2:114541107-114541129 GAAAATAGCTTCTCTGGCAGGGG + Intronic
937105125 2:119304946-119304968 TAAAATGGCTCCTTTAAAACTGG + Intronic
940457443 2:153918525-153918547 GAAAATAGCATCTGTGAGACAGG + Intronic
940825519 2:158407453-158407475 ATACATAGCTTCTCCAAAACTGG + Intronic
941210117 2:162627317-162627339 GAAAATAGCATCTCTGACCCAGG + Intronic
942395955 2:175549858-175549880 GAAAATATCTTCTATGAAACAGG - Intergenic
942771038 2:179520794-179520816 GAAAATAGCATGCATAAAACCGG - Intronic
942930122 2:181481343-181481365 GAAAATAGCATCTTTACATCTGG - Intronic
943826118 2:192394928-192394950 GAAAATATCTTCTCTCAGACTGG + Intergenic
945932287 2:215867017-215867039 GAAAATGGGGTCTCTAAAAGAGG - Intergenic
946767278 2:223052470-223052492 GTAAATAGTATCTTTAAAACTGG - Intronic
1171350507 20:24498942-24498964 GAAAACAGTTTCTCAAAAAATGG - Intronic
1177851216 21:26350942-26350964 GAACCTATCTTCTCTATAACAGG - Intergenic
1178158195 21:29879512-29879534 GAAAATACTTTCTCTTAAAGTGG - Intronic
1178585258 21:33866021-33866043 TAAAATAGCTTCTGTGAAACAGG + Intronic
1179446408 21:41434107-41434129 TAGAATAGCTTCTTTATAACAGG - Intronic
1182572876 22:31251937-31251959 GAAAGAAGCTTCTCTACAACTGG + Intronic
1183341366 22:37283668-37283690 GAAAACAGCCTCTCTAAGGCAGG + Intronic
951278627 3:20720279-20720301 AAAAACAGCTTCTCTCAAAAGGG + Intergenic
952111934 3:30134106-30134128 GAAAAGTGGTTCTCAAAAACAGG + Intergenic
952116951 3:30194118-30194140 GAAAATATCTTTTATGAAACAGG + Intergenic
952752828 3:36839316-36839338 GAAAGCTGCTTTTCTAAAACAGG + Intronic
953952421 3:47201442-47201464 GAAACTAGCTTCAATAAACCAGG - Intergenic
955443602 3:58983276-58983298 GCAAACAGCTTCCATAAAACAGG - Intronic
955945374 3:64188670-64188692 GTAGATAGATTCTCTAAATCAGG + Intronic
956665706 3:71640194-71640216 TAAAAGAGTTTCTCTAAATCTGG - Intergenic
956777057 3:72573784-72573806 TGAAATAGCTTCTCTAGGACCGG - Intergenic
956808905 3:72845569-72845591 CAAAATAATTTTTCTAAAACAGG + Intronic
956878519 3:73487992-73488014 GAAAAGAGCTTATCTAAAATTGG - Intronic
957455241 3:80433482-80433504 TAAAAGAGCTTCTTCAAAACTGG + Intergenic
959023043 3:101209982-101210004 GAAAAAAACATTTCTAAAACTGG + Intergenic
959795579 3:110424165-110424187 GGAAATAGGTTCTTTAAAATGGG + Intergenic
960186646 3:114649328-114649350 GTAAACAGCTTCTCAAGAACTGG - Intronic
960614340 3:119583002-119583024 AAAATTATCTTCTGTAAAACCGG + Intronic
961629888 3:128288835-128288857 AAAAATAACTTCACTGAAACTGG - Intronic
962232830 3:133680896-133680918 AAAAATCTCATCTCTAAAACAGG + Intergenic
962499689 3:135978248-135978270 GAAATTATTTTCTCTAGAACAGG - Intronic
963585573 3:147183444-147183466 TAAAATAGCTTCTCTAATTTAGG - Intergenic
963641394 3:147865013-147865035 TATAATATTTTCTCTAAAACTGG + Intergenic
963882949 3:150548499-150548521 GACAATAGATACTCTAAATCAGG + Intronic
963991715 3:151663981-151664003 GAAAATGTTTTCTCTAGAACTGG - Intergenic
964875148 3:161358680-161358702 AAAAATAACCTCTCTAAAACTGG - Intronic
964898397 3:161626704-161626726 GAAAGGAGATTCTCTAAATCTGG - Intergenic
965356773 3:167684952-167684974 AAAAATATATTCTTTAAAACTGG + Intronic
965924584 3:173961814-173961836 GATAAAAGCTTCTCTAACTCAGG - Intronic
966149078 3:176846735-176846757 TAATTTATCTTCTCTAAAACTGG + Intergenic
966309288 3:178575969-178575991 GAAAATATAACCTCTAAAACTGG - Intronic
968819529 4:2839521-2839543 GCAAATATCTTCTCTAACTCTGG + Exonic
972054783 4:34786249-34786271 GAAAATAACCTGTCAAAAACTGG + Intergenic
972165314 4:36276859-36276881 GAAAATATTTTCTTTAAAAGGGG - Intergenic
974117222 4:57593905-57593927 GCAAATAGCTTTTAAAAAACAGG - Intergenic
975651254 4:76595831-76595853 GAAACTTGCTTATCTAAAACAGG - Intronic
977438411 4:97031164-97031186 GAAAATGGCTTTTATAAAATAGG - Intergenic
978358254 4:107900906-107900928 TAAATTAGCTTCACTAAAATCGG - Intronic
979130339 4:117036776-117036798 GAAAATAAATGCTCTAAAAAAGG + Intergenic
979805200 4:124961834-124961856 ACAAAAAGCTTATCTAAAACTGG - Intergenic
980165243 4:129218431-129218453 CAGAATATCTTCTCTAATACTGG + Intergenic
981053536 4:140335969-140335991 GAAACAATCTTCCCTAAAACAGG - Intronic
981422104 4:144562819-144562841 CAAAATAGCTTTTCCAAAGCAGG - Intergenic
981591345 4:146366116-146366138 AAAATTAGCTTCTACAAAACCGG + Intronic
983293845 4:165840384-165840406 GAAAATAACTTTACTAAATCAGG + Intergenic
983337238 4:166412878-166412900 GAAAATATCTCCTCTGAAATGGG - Intergenic
983991597 4:174126872-174126894 AAAAATAGCTTTTCTAAATCAGG - Intergenic
986889274 5:12281153-12281175 GAAAATATCTTCTCTCATTCTGG - Intergenic
989555886 5:42794073-42794095 GAAAATATCTACTCTGAGACAGG + Intronic
989691338 5:44148306-44148328 AAAAATAGCTTCCCCAAAAGGGG + Intergenic
990074490 5:51826525-51826547 GAAAATAATTTGTCTAAAAGAGG + Intergenic
993680331 5:90870150-90870172 TAAAATAGGTTCTCTGAGACAGG + Intronic
994863935 5:105239305-105239327 GAAAAGATCTTCTCCATAACAGG + Intergenic
995271506 5:110224901-110224923 GAATTTAGCTTCTCTTAATCTGG - Intergenic
996261423 5:121474568-121474590 TAAAATAACTTCTCTAATAGTGG + Intergenic
996315446 5:122155496-122155518 GTAAATATCTTCTCTAAGAAAGG - Intronic
996988222 5:129594542-129594564 GAAAATATCTCCTCTAAATAGGG - Intronic
999339105 5:150753249-150753271 TAAAATAGCTTTTATAAATCTGG - Intronic
1000077995 5:157812432-157812454 TAATATAGTTTCTCTAAAATAGG - Intronic
1000340450 5:160273331-160273353 GAACACAGCTTCTCTAACAGAGG + Intronic
1000667629 5:164018691-164018713 CTACATAACTTCTCTAAAACAGG + Intergenic
1000982936 5:167836032-167836054 GAATATACCTTTTTTAAAACTGG + Intronic
1002157962 5:177297721-177297743 TAAAGTAGCTTCTCTAAAGTAGG + Exonic
1004476405 6:15977291-15977313 GTAAATAGCTTCTCTATACATGG + Intergenic
1006088077 6:31610937-31610959 GCAAATAGCTTCTCTGTAATTGG - Intergenic
1006939045 6:37739406-37739428 GACAAAAGCTTCTCTGTAACAGG + Intergenic
1009031233 6:58060694-58060716 AAAAATGGCTTATTTAAAACAGG + Intergenic
1009207090 6:60815156-60815178 AAAAATGGCTTATTTAAAACAGG + Intergenic
1009926972 6:70131854-70131876 GAAATTTGATTCTGTAAAACAGG + Intronic
1011819672 6:91236564-91236586 GAAAATAGCTTTTGGAAAATGGG - Intergenic
1011977641 6:93325003-93325025 GAACCTACCTTTTCTAAAACTGG + Intronic
1013604253 6:111733198-111733220 GAAAATAAGTTCTCAAAAAGTGG - Intronic
1015126636 6:129762566-129762588 GAAAATGTCTGCTCTAAGACTGG - Intergenic
1015344971 6:132145655-132145677 GAAAAGCGCTACTCTAAAAGGGG - Intergenic
1015967108 6:138705336-138705358 TAGAATAACTTCTCCAAAACTGG - Intergenic
1016022380 6:139249667-139249689 GAAAATTGCTTATCTAGAATGGG + Intronic
1017717123 6:157220781-157220803 GAAAATTGCTTCTGTGAAAAAGG - Intergenic
1017887559 6:158611566-158611588 AGAAATAGCTTCTCTAGAAAAGG - Intronic
1018677976 6:166239366-166239388 TAAGATAACTTCTCTAAAATTGG - Intergenic
1019671011 7:2278333-2278355 GAGAATAGCTGCTCAAAAGCTGG + Intronic
1020686318 7:11299837-11299859 GAACAAAGTTTCTCTAAATCAGG - Intergenic
1020916459 7:14199672-14199694 GAACAAAGCTTCACTATAACTGG + Intronic
1022689592 7:32634970-32634992 GAAAAATGTTTTTCTAAAACAGG - Intergenic
1023279078 7:38551556-38551578 GAAAGTTTCTTCTCTAATACTGG - Intronic
1024157971 7:46645733-46645755 CAAAAAAGCTTCTCAAAAGCTGG - Intergenic
1024169248 7:46767087-46767109 AAAAACAGCTTCTCTGAAAGTGG + Intergenic
1024971219 7:55072557-55072579 GAAAATCACTTCCCTAAAAAAGG - Intronic
1026543485 7:71300938-71300960 ACAAATAGCTTCTGTAAAAGTGG - Intronic
1027909764 7:84235083-84235105 AAAAATAAATTCTTTAAAACAGG + Intronic
1028227806 7:88269300-88269322 AAAAATAGTTTTTATAAAACTGG - Intergenic
1028227892 7:88270521-88270543 AAAAATAGTTTTTATAAAACTGG - Intergenic
1028697990 7:93739239-93739261 GAAAATATCTTCTCATAAACTGG + Intronic
1030178481 7:106679343-106679365 GTAAAAAGCTCCTCTAAAAGAGG - Intergenic
1030525154 7:110643831-110643853 TATAATAGATTCTCTAAATCAGG - Intergenic
1031521912 7:122777475-122777497 GAAAATGACATCTCTTAAACGGG + Intronic
1034188674 7:149197326-149197348 GAAAATAGGTTCACTAAAAAAGG - Intronic
1034910239 7:154990901-154990923 GAAAATAGCTTCTCTAAAACTGG + Intronic
1038075188 8:24065328-24065350 GAAAACAGCTTTTGTGAAACCGG + Intergenic
1038811472 8:30850398-30850420 AAAAATACCTTTCCTAAAACAGG + Intronic
1039662689 8:39484103-39484125 GAAAAGGGCCTTTCTAAAACTGG + Intergenic
1041551926 8:59112631-59112653 GAAAAAAGCATGTCTAAAATTGG + Intronic
1042481549 8:69309119-69309141 GAAAATAGCTGCACTGCAACAGG - Intergenic
1043523537 8:81072343-81072365 TAAAATACATGCTCTAAAACAGG + Intronic
1045042554 8:98240406-98240428 GAAAATAGCCTGTCTGAATCAGG - Intronic
1046034157 8:108821301-108821323 GCAAATAAATTATCTAAAACTGG + Intergenic
1046144807 8:110144830-110144852 GATAATAGCTACTCCAAAAATGG + Intergenic
1046379728 8:113435650-113435672 GAAACTAGCTTCACTGAAAGCGG + Intronic
1046438234 8:114223548-114223570 AAAAATAGCTTCTTTAGAATTGG + Intergenic
1046495182 8:115004786-115004808 GAAAATAGCACCTATGAAACAGG + Intergenic
1046735092 8:117768334-117768356 GAAAAGAGATGATCTAAAACTGG + Intergenic
1046758306 8:117994034-117994056 GCAAATACCATCTCTAAAAGCGG + Intronic
1046926990 8:119802594-119802616 TATAATAACTTCTCTAAACCAGG - Intronic
1047378441 8:124329439-124329461 TTTAATAGCATCTCTAAAACTGG + Intronic
1048655013 8:136526386-136526408 GGAACTAGGTTCTCTAAAAATGG - Intergenic
1051693213 9:19739706-19739728 TAAAAAAGCTTCTATAACACAGG + Intronic
1052474786 9:28944877-28944899 GAAAATATTTTCTGAAAAACAGG - Intergenic
1052664772 9:31481699-31481721 GAAAATAGTTTATCTACAATAGG - Intergenic
1053500490 9:38585298-38585320 GAAAATCTGTTGTCTAAAACTGG - Intergenic
1054754188 9:68940461-68940483 TAAAATAGCTTCTTGCAAACAGG - Intronic
1055741584 9:79395466-79395488 GAAAATATGTTCTCAAAAAAGGG - Intergenic
1057679884 9:97169723-97169745 GAAAATCTGTTGTCTAAAACTGG - Intergenic
1058222129 9:102315178-102315200 GAAATTAGCTTTTCTAGAAATGG - Intergenic
1059498478 9:114730348-114730370 AAAAATAGATTTTCTAAAATTGG + Intergenic
1061774122 9:132949205-132949227 GAAGATAGATTCTCTAAGAAGGG - Intronic
1187034722 X:15526282-15526304 GAAAATATTTTCCCCAAAACTGG + Intronic
1187648194 X:21373565-21373587 CAAAATGACTTCTCTAAAATAGG + Intergenic
1188930612 X:36106101-36106123 ATCAATATCTTCTCTAAAACAGG + Intronic
1193131409 X:77924018-77924040 GAAAATTGCCTGTCTAAAATGGG + Intronic
1193300073 X:79879161-79879183 GAAAATTGCTGCCCTAAAAGGGG + Intergenic
1193676541 X:84460507-84460529 GAAAAATGATTCTCAAAAACTGG + Intronic
1194014254 X:88599611-88599633 GAAAATAGATGGTCTAAAATTGG - Intergenic
1194343879 X:92738509-92738531 TAAAATAGCTTATGTAAAACAGG + Intergenic
1194415677 X:93608684-93608706 AAAAATCACTTCACTAAAACAGG + Intergenic
1195169946 X:102257728-102257750 GAAAATAGCACCTGTAAAATAGG - Intergenic
1195188911 X:102429372-102429394 GAAAATAGCACCTGTAAAATAGG + Intronic
1196882662 X:120212763-120212785 GAAAGTAGCTTTTCTGCAACAGG - Intergenic
1197454299 X:126658822-126658844 GTTAGTAGCTTCTATAAAACAGG + Intergenic
1197574712 X:128197783-128197805 AAAAATAGCTTCTCTAAATGAGG + Intergenic
1198198582 X:134390766-134390788 TAACATAGATTCTTTAAAACAGG - Intronic
1199551189 X:149063304-149063326 GAAAATAAATTCTATAAATCTGG + Intergenic
1200652231 Y:5855165-5855187 TAAAATAGCTTATGTAAAACAGG + Intergenic
1202101225 Y:21310081-21310103 AAAAATAGCTTCCACAAAACCGG - Intergenic
1202391932 Y:24379907-24379929 CAAAATGACTTATCTAAAACAGG + Intergenic
1202478853 Y:25290210-25290232 CAAAATGACTTATCTAAAACAGG - Intergenic