ID: 1034913557

View in Genome Browser
Species Human (GRCh38)
Location 7:155018190-155018212
Sequence CAGAGTTATCACAGTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034913557_1034913560 -10 Left 1034913557 7:155018190-155018212 CCTGCTTCACTGTGATAACTCTG No data
Right 1034913560 7:155018203-155018225 GATAACTCTGCGGTCTCAGGAGG No data
1034913557_1034913563 25 Left 1034913557 7:155018190-155018212 CCTGCTTCACTGTGATAACTCTG No data
Right 1034913563 7:155018238-155018260 CTTGACCATCAGGCAAACAAGGG No data
1034913557_1034913561 15 Left 1034913557 7:155018190-155018212 CCTGCTTCACTGTGATAACTCTG No data
Right 1034913561 7:155018228-155018250 TGTCTGAATGCTTGACCATCAGG No data
1034913557_1034913562 24 Left 1034913557 7:155018190-155018212 CCTGCTTCACTGTGATAACTCTG No data
Right 1034913562 7:155018237-155018259 GCTTGACCATCAGGCAAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034913557 Original CRISPR CAGAGTTATCACAGTGAAGC AGG (reversed) Intergenic
No off target data available for this crispr