ID: 1034918836

View in Genome Browser
Species Human (GRCh38)
Location 7:155062283-155062305
Sequence CAGGAGAAGGGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034918825_1034918836 -3 Left 1034918825 7:155062263-155062285 CCTGGGTTCTTTCCTGAAGCCAG No data
Right 1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG No data
1034918821_1034918836 19 Left 1034918821 7:155062241-155062263 CCAGGTAATGCTACAACTTAACC No data
Right 1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG No data
1034918820_1034918836 24 Left 1034918820 7:155062236-155062258 CCTAGCCAGGTAATGCTACAACT No data
Right 1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG No data
1034918824_1034918836 -2 Left 1034918824 7:155062262-155062284 CCCTGGGTTCTTTCCTGAAGCCA No data
Right 1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034918836 Original CRISPR CAGGAGAAGGGGAGGGAGGA GGG Intergenic
No off target data available for this crispr