ID: 1034919910

View in Genome Browser
Species Human (GRCh38)
Location 7:155071147-155071169
Sequence GGCCACCAGGACATCCGAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034919910_1034919917 19 Left 1034919910 7:155071147-155071169 CCGTCTCGGATGTCCTGGTGGCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1034919917 7:155071189-155071211 GCCTGGTGCACGAGCTGTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 126
1034919910_1034919919 28 Left 1034919910 7:155071147-155071169 CCGTCTCGGATGTCCTGGTGGCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1034919919 7:155071198-155071220 ACGAGCTGTCCGGGCGCCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 43
1034919910_1034919916 18 Left 1034919910 7:155071147-155071169 CCGTCTCGGATGTCCTGGTGGCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1034919916 7:155071188-155071210 AGCCTGGTGCACGAGCTGTCCGG 0: 1
1: 0
2: 1
3: 6
4: 100
1034919910_1034919914 2 Left 1034919910 7:155071147-155071169 CCGTCTCGGATGTCCTGGTGGCC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1034919914 7:155071172-155071194 GCTGGTCATGCCGCTGAGCCTGG 0: 1
1: 0
2: 0
3: 21
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034919910 Original CRISPR GGCCACCAGGACATCCGAGA CGG (reversed) Exonic
901683669 1:10931297-10931319 TGGCACCAGGACATTCGTGAGGG - Intergenic
902347395 1:15828491-15828513 GGCCACCAGGGCTTTGGAGATGG - Intergenic
904901584 1:33861934-33861956 GGCCCTCAGGAGATCAGAGATGG - Intronic
905413711 1:37790536-37790558 GGCTCCCAGGACATCAGAGAAGG - Intergenic
906294546 1:44641369-44641391 AGCCCCCAGGACCTCCAAGATGG - Intronic
917143108 1:171857584-171857606 AGTCATCAGGACATCTGAGAAGG - Intronic
917830001 1:178872470-178872492 GGCCACAAGCACAGCTGAGAAGG - Intronic
922071956 1:222203675-222203697 GGGGACCAGGACATCAGAGACGG - Intergenic
1063013253 10:2047824-2047846 GGCCAGCAGGAAAACAGAGATGG - Intergenic
1069598363 10:69687204-69687226 GGCCACCAGGACCACCAAGCTGG - Intronic
1070574466 10:77667072-77667094 TGCCATCAGGACCTCCGACATGG + Intergenic
1071203825 10:83251821-83251843 GGGCACCATGCCATCTGAGAGGG + Intergenic
1073093979 10:100969124-100969146 GGCCAGAAGGCCCTCCGAGAGGG + Intergenic
1077011916 11:382611-382633 GGTCAGCAGGACACCAGAGAAGG + Intergenic
1077606652 11:3616929-3616951 GGCCAACAGCACATCGGTGAGGG - Intergenic
1081259964 11:40947630-40947652 GGTCACCAGAACAGCTGAGAAGG + Intronic
1084313435 11:68330167-68330189 GGCCACCAGGGCTCCCCAGAAGG - Intronic
1099143803 12:79013411-79013433 GGGCACCAGGAACTCCAAGAGGG + Intronic
1101041131 12:100756964-100756986 TGCCTGCAGGACATCCCAGATGG - Intronic
1102217454 12:111171401-111171423 GGCCAGAAGGACAGACGAGAGGG + Intronic
1107174027 13:37379222-37379244 GGCCACAAGGACATCTGGTAGGG - Intergenic
1109426721 13:62174099-62174121 AGCCTCCAGGACATCCAGGAAGG - Intergenic
1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG + Intergenic
1115524610 14:34267269-34267291 GGCCACCAGGAATTCTAAGAAGG + Intronic
1119407394 14:74407258-74407280 GCCCACCAGGCCATCCCAGCAGG - Exonic
1121228769 14:92341134-92341156 GGCCACCAGGCCACCAAAGAAGG - Intronic
1121231816 14:92364000-92364022 GGATACCAGGACAGACGAGATGG - Intronic
1122697192 14:103562015-103562037 GGCCTCCAGGACATCCGCCGGGG - Exonic
1127730241 15:61794404-61794426 AGCCACCAGGCCAGCAGAGATGG + Intergenic
1128287168 15:66446811-66446833 GGCCTCCATGGCATCCAAGATGG + Intronic
1128331424 15:66757950-66757972 GGCCACCAGCAGAGCCCAGAGGG + Intronic
1128558060 15:68645151-68645173 GGACGCCAGGACATCTGTGAGGG - Exonic
1131430286 15:92382527-92382549 GGCCATCAGGAACTCCAAGATGG + Intergenic
1132608297 16:802583-802605 GGCCACCAGGACAGGTGAGACGG + Intergenic
1132914030 16:2332472-2332494 GGCCACCAGGGCTTTGGAGATGG + Intronic
1134504006 16:14790822-14790844 GGCCAGCAGGCCATCAGGGAAGG + Intronic
1134576566 16:15338086-15338108 GGCCAGCAGGCCATCAGGGAAGG - Intergenic
1134725873 16:16418413-16418435 GGCCAGCAGGCCATCAGGGAAGG + Intergenic
1134941560 16:18293446-18293468 GGCCAGCAGGCCATCAGGGAAGG - Intergenic
1137607403 16:49795865-49795887 GCCCCCCAGGACTTCAGAGATGG - Intronic
1143615090 17:8044937-8044959 GGCCACCATGGCATCAGTGACGG - Exonic
1145741757 17:27280741-27280763 GGCCACCAGGGCTTTGGAGATGG - Intergenic
1147371527 17:39996174-39996196 GGCCTGCAGGCCATCCGGGATGG + Exonic
1148830123 17:50425896-50425918 AGCCAGCAGCACATCCGTGAGGG - Intergenic
1149779109 17:59382224-59382246 GGCCACCAGGACAGCCCTGAGGG + Intronic
1150213103 17:63452324-63452346 TGCCAACAGGCCATCAGAGAGGG + Intergenic
1152404118 17:80086834-80086856 AGGCAGCAGGACCTCCGAGAAGG - Intronic
1155092262 18:22523507-22523529 GGGCACCAGGATAGCCAAGAGGG - Intergenic
1157472704 18:48002367-48002389 GGCCTCCAGCACTTCCGAGATGG + Intergenic
1157705214 18:49800057-49800079 GGCAACCACGCCATCCGGGAGGG + Intronic
1163338625 19:16689797-16689819 GGTCACCAGGATGTCTGAGAGGG + Exonic
1165854024 19:38869439-38869461 GGCGACCAGGGAAGCCGAGAGGG - Intronic
1165944479 19:39433535-39433557 GGCCACCAGGGCTTTGGAGATGG + Exonic
1168305458 19:55433006-55433028 GTCTGCCAGGACATCCCAGAAGG + Exonic
1168701456 19:58442027-58442049 GGCCAGCAGCACCTCCCAGAGGG - Intergenic
925073167 2:987418-987440 GGCCACAAGATCATCCCAGAAGG - Intronic
927144765 2:20155777-20155799 GGCCACCAGGGCTTTGGAGATGG + Intergenic
932073987 2:68646135-68646157 GGCCACCAGGAAGTCAGAGATGG - Exonic
932137301 2:69242543-69242565 GGCCACCAGGCTGGCCGAGAGGG - Intronic
937300000 2:120833206-120833228 GGCCTCCAGGGCCTACGAGATGG + Intronic
937363957 2:121247335-121247357 GGACACCAGGACATTAGAGAGGG - Intronic
940790519 2:158025996-158026018 GGCCACCAGGACATAAGAGGTGG + Intronic
944423676 2:199557372-199557394 CTCCACCAGGCCAGCCGAGAGGG - Intergenic
944676863 2:202040667-202040689 GGGCTCCAGGAAATCCTAGAAGG + Intergenic
947744571 2:232500908-232500930 GGCCACTGGGACATCTGGGAAGG + Intergenic
947792611 2:232876723-232876745 GGCCGCCAGGGCATCGGAGCGGG + Intronic
1168995790 20:2132232-2132254 GGCCACCAGGAGCTCAGAAAAGG + Intronic
1169404712 20:5314061-5314083 GGCCACCAGGAAGTCGGAGATGG + Exonic
1172778789 20:37423481-37423503 GGGCAGGAGGACATCAGAGAGGG + Intergenic
1173732059 20:45335877-45335899 GACCCCCAGGACCTCCTAGAAGG - Exonic
1173846881 20:46193853-46193875 GGCCAAGAGGACATCTGAGTTGG - Intronic
1174252981 20:49233387-49233409 GGCCACCATGACAGACGAGGTGG + Exonic
1179056926 21:37944911-37944933 GACCACCAGGAGATCTGAGGAGG - Intergenic
1179623505 21:42633837-42633859 GGCCACCAGGACCTGAAAGAAGG + Intergenic
1181049643 22:20232455-20232477 GGCCACCAGGACGTCCTAGGAGG + Intergenic
1181808133 22:25387360-25387382 GGCCACCAGGGCTCCCCAGAAGG + Intronic
1182301436 22:29339461-29339483 TCCCTCCAGGACATCAGAGAAGG + Intronic
1185063340 22:48618563-48618585 TGCCTCCAGGACTTCCCAGACGG - Intronic
1185171418 22:49296755-49296777 GGACAGCAGGACAGCCCAGAGGG + Intergenic
949871440 3:8593098-8593120 GGCCACCAGGCCAGCAGACATGG + Intergenic
950115886 3:10450167-10450189 GGACACAAGGACATGCCAGAAGG - Intronic
950316366 3:12004832-12004854 GTCCACCAGGCCAGCCGAGGCGG - Exonic
950345373 3:12287975-12287997 GGCCTCGAGGACACCGGAGAGGG + Intronic
953022081 3:39121061-39121083 GGCCACATGGACATACGAGGGGG - Exonic
955741934 3:62100404-62100426 GGCCACAAGGAAATCCCAGGAGG - Intronic
958632821 3:96703448-96703470 GGCCACCAGAGCTTCAGAGATGG + Intergenic
960887413 3:122410224-122410246 GTACACCAGGACATTTGAGAAGG - Exonic
961317565 3:126050914-126050936 GGACACCTGGACATTCGAGGCGG - Intronic
961718211 3:128873333-128873355 GGAAACCAGGACAGCAGAGATGG - Intergenic
967812799 3:193774685-193774707 GTCCACCAGGCCATCCATGAGGG - Intergenic
969675801 4:8613756-8613778 AGCCACCTGGCCAGCCGAGAAGG - Intronic
971298115 4:25418414-25418436 GGCCAAAAGGACATAGGAGATGG + Exonic
984842398 4:184080579-184080601 GGCCACCAGGACAGCTCAGGAGG - Intergenic
986345510 5:6831595-6831617 GACCTCCAGGAGATCTGAGAGGG - Intergenic
988111418 5:26827086-26827108 AGCCACCAGAACCTACGAGAAGG + Intergenic
999256081 5:150210655-150210677 GGCCACCAGGACAAGGGAGATGG - Exonic
1002819013 6:706314-706336 GGCCACCAGAACATTCCACAAGG + Intergenic
1007113331 6:39326357-39326379 GGCCACAGGGACGTCTGAGATGG + Intergenic
1018102538 6:160453947-160453969 GGCCACCAGCACACCCCAGGAGG + Intergenic
1018124176 6:160665951-160665973 GGCCACCGGGACACCCCAGGAGG + Intergenic
1018133250 6:160752511-160752533 GGCCACCAGCACACCCCAGGAGG - Intronic
1018244183 6:161806029-161806051 GGGCACCAGTTCATCCCAGAAGG - Intronic
1019282558 7:207764-207786 GGCCTCCAGGTCGCCCGAGATGG - Intronic
1023181021 7:37483871-37483893 GACAACCAGGACATCTGAAAGGG - Intergenic
1026439826 7:70434430-70434452 GGCCACCTGGACATGGGAGTTGG - Intronic
1026511874 7:71034175-71034197 AGACACCAGGACCTCCAAGATGG + Intergenic
1026512006 7:71035170-71035192 AGACACCAGGACTTCCAAGATGG + Intergenic
1029204822 7:98863321-98863343 GGCCACCAGGCTGGCCGAGATGG + Exonic
1029346252 7:99980827-99980849 GTCCTCCAGGAGACCCGAGATGG + Intergenic
1033586870 7:142780612-142780634 GGCCACCAGGGCTTCTGAGCAGG - Intergenic
1034919910 7:155071147-155071169 GGCCACCAGGACATCCGAGACGG - Exonic
1034968203 7:155404228-155404250 GGTCACCAGCACCTCCCAGAAGG + Intergenic
1037604388 8:20425236-20425258 GGGCTCCAGTACATCCGAGGAGG + Intergenic
1040604424 8:48916433-48916455 GCCAACCAGAACATCCAAGAAGG + Intergenic
1048162099 8:132030982-132031004 GGCAACCATACCATCCGAGAAGG + Intronic
1049529765 8:143148377-143148399 TCCCACCAGGACCTCCCAGATGG + Intergenic
1052979515 9:34437968-34437990 GGCCACCTGGAGTTCCGAGTGGG + Intronic
1056581298 9:87889420-87889442 CCCCACCAGGACATCTGAGAAGG - Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060931519 9:127492202-127492224 TGCCATCAGGCCATCGGAGAAGG + Intronic
1061420177 9:130469169-130469191 GGCCACCAGGACATCTCTGCTGG + Intronic
1061858767 9:133457207-133457229 GCCCCCCAGGACAACCGAGAGGG - Intronic
1190221619 X:48515747-48515769 GGTGACCAGCACAGCCGAGAAGG - Exonic
1190687356 X:52887220-52887242 GTCCACCAGGGAATCAGAGATGG + Intergenic
1190698626 X:52968572-52968594 GTCCACCAGGGAATCAGAGATGG - Intronic
1196525712 X:116725761-116725783 GCCCACCAGAAAATCAGAGAAGG + Intergenic