ID: 1034921963

View in Genome Browser
Species Human (GRCh38)
Location 7:155090789-155090811
Sequence TCACATTAGGTGATGTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034921963_1034921969 8 Left 1034921963 7:155090789-155090811 CCTTTACACATCACCTAATGTGA No data
Right 1034921969 7:155090820-155090842 GCCCACAGCTGCTGAGACCCCGG No data
1034921963_1034921974 26 Left 1034921963 7:155090789-155090811 CCTTTACACATCACCTAATGTGA No data
Right 1034921974 7:155090838-155090860 CCCGGAAGCCACCTAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034921963 Original CRISPR TCACATTAGGTGATGTGTAA AGG (reversed) Intergenic
No off target data available for this crispr