ID: 1034924236

View in Genome Browser
Species Human (GRCh38)
Location 7:155108098-155108120
Sequence ATAACCGCCGGGTTTTCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034924236_1034924239 15 Left 1034924236 7:155108098-155108120 CCTCGGGAAAACCCGGCGGTTAT No data
Right 1034924239 7:155108136-155108158 AAATCCAATGTTCATGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034924236 Original CRISPR ATAACCGCCGGGTTTTCCCG AGG (reversed) Intergenic
No off target data available for this crispr