ID: 1034924237

View in Genome Browser
Species Human (GRCh38)
Location 7:155108109-155108131
Sequence GTTATAATAAAATAACCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034924237_1034924239 4 Left 1034924237 7:155108109-155108131 CCCGGCGGTTATTTTATTATAAC No data
Right 1034924239 7:155108136-155108158 AAATCCAATGTTCATGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034924237 Original CRISPR GTTATAATAAAATAACCGCC GGG (reversed) Intergenic