ID: 1034924238

View in Genome Browser
Species Human (GRCh38)
Location 7:155108110-155108132
Sequence CGTTATAATAAAATAACCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034924238_1034924239 3 Left 1034924238 7:155108110-155108132 CCGGCGGTTATTTTATTATAACG No data
Right 1034924239 7:155108136-155108158 AAATCCAATGTTCATGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034924238 Original CRISPR CGTTATAATAAAATAACCGC CGG (reversed) Intergenic