ID: 1034924239

View in Genome Browser
Species Human (GRCh38)
Location 7:155108136-155108158
Sequence AAATCCAATGTTCATGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034924238_1034924239 3 Left 1034924238 7:155108110-155108132 CCGGCGGTTATTTTATTATAACG No data
Right 1034924239 7:155108136-155108158 AAATCCAATGTTCATGCACTAGG No data
1034924237_1034924239 4 Left 1034924237 7:155108109-155108131 CCCGGCGGTTATTTTATTATAAC No data
Right 1034924239 7:155108136-155108158 AAATCCAATGTTCATGCACTAGG No data
1034924233_1034924239 22 Left 1034924233 7:155108091-155108113 CCTCTAACCTCGGGAAAACCCGG No data
Right 1034924239 7:155108136-155108158 AAATCCAATGTTCATGCACTAGG No data
1034924236_1034924239 15 Left 1034924236 7:155108098-155108120 CCTCGGGAAAACCCGGCGGTTAT No data
Right 1034924239 7:155108136-155108158 AAATCCAATGTTCATGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034924239 Original CRISPR AAATCCAATGTTCATGCACT AGG Intergenic