ID: 1034925740

View in Genome Browser
Species Human (GRCh38)
Location 7:155120062-155120084
Sequence GGTTTTAAAGGGATCATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034925740_1034925753 13 Left 1034925740 7:155120062-155120084 CCCTCCATGATCCCTTTAAAACC No data
Right 1034925753 7:155120098-155120120 TCCTCAGGGAGACAAATTTGAGG No data
1034925740_1034925748 -1 Left 1034925740 7:155120062-155120084 CCCTCCATGATCCCTTTAAAACC No data
Right 1034925748 7:155120084-155120106 CCCCCAGCCAGAACTCCTCAGGG No data
1034925740_1034925746 -2 Left 1034925740 7:155120062-155120084 CCCTCCATGATCCCTTTAAAACC No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925740_1034925755 14 Left 1034925740 7:155120062-155120084 CCCTCCATGATCCCTTTAAAACC No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034925740 Original CRISPR GGTTTTAAAGGGATCATGGA GGG (reversed) Intergenic
No off target data available for this crispr