ID: 1034925746

View in Genome Browser
Species Human (GRCh38)
Location 7:155120083-155120105
Sequence CCCCCCAGCCAGAACTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034925736_1034925746 18 Left 1034925736 7:155120042-155120064 CCCACTTTTCCAACTCCTCGCCC No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925735_1034925746 30 Left 1034925735 7:155120030-155120052 CCAATCAACGAACCCACTTTTCC No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925741_1034925746 -3 Left 1034925741 7:155120063-155120085 CCTCCATGATCCCTTTAAAACCC No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925739_1034925746 3 Left 1034925739 7:155120057-155120079 CCTCGCCCTCCATGATCCCTTTA No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925740_1034925746 -2 Left 1034925740 7:155120062-155120084 CCCTCCATGATCCCTTTAAAACC No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925737_1034925746 17 Left 1034925737 7:155120043-155120065 CCACTTTTCCAACTCCTCGCCCT No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925742_1034925746 -6 Left 1034925742 7:155120066-155120088 CCATGATCCCTTTAAAACCCCCC No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
1034925738_1034925746 9 Left 1034925738 7:155120051-155120073 CCAACTCCTCGCCCTCCATGATC No data
Right 1034925746 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034925746 Original CRISPR CCCCCCAGCCAGAACTCCTC AGG Intergenic
No off target data available for this crispr