ID: 1034925755

View in Genome Browser
Species Human (GRCh38)
Location 7:155120099-155120121
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034925739_1034925755 19 Left 1034925739 7:155120057-155120079 CCTCGCCCTCCATGATCCCTTTA No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925742_1034925755 10 Left 1034925742 7:155120066-155120088 CCATGATCCCTTTAAAACCCCCC No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925749_1034925755 -9 Left 1034925749 7:155120085-155120107 CCCCAGCCAGAACTCCTCAGGGA No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925743_1034925755 3 Left 1034925743 7:155120073-155120095 CCCTTTAAAACCCCCCAGCCAGA No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925738_1034925755 25 Left 1034925738 7:155120051-155120073 CCAACTCCTCGCCCTCCATGATC No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925750_1034925755 -10 Left 1034925750 7:155120086-155120108 CCCAGCCAGAACTCCTCAGGGAG No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925741_1034925755 13 Left 1034925741 7:155120063-155120085 CCTCCATGATCCCTTTAAAACCC No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925747_1034925755 -8 Left 1034925747 7:155120084-155120106 CCCCCAGCCAGAACTCCTCAGGG No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925740_1034925755 14 Left 1034925740 7:155120062-155120084 CCCTCCATGATCCCTTTAAAACC No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925745_1034925755 -7 Left 1034925745 7:155120083-155120105 CCCCCCAGCCAGAACTCCTCAGG No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data
1034925744_1034925755 2 Left 1034925744 7:155120074-155120096 CCTTTAAAACCCCCCAGCCAGAA No data
Right 1034925755 7:155120099-155120121 CCTCAGGGAGACAAATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034925755 Original CRISPR CCTCAGGGAGACAAATTTGA GGG Intergenic
No off target data available for this crispr