ID: 1034929902 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:155153448-155153470 |
Sequence | TGGTGACAGTGTTGTAGGTG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1034929902_1034929913 | 12 | Left | 1034929902 | 7:155153448-155153470 | CCCCACCTACAACACTGTCACCA | No data | ||
Right | 1034929913 | 7:155153483-155153505 | CCATTCTTCCCACCAGCCCTGGG | No data | ||||
1034929902_1034929911 | 11 | Left | 1034929902 | 7:155153448-155153470 | CCCCACCTACAACACTGTCACCA | No data | ||
Right | 1034929911 | 7:155153482-155153504 | TCCATTCTTCCCACCAGCCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1034929902 | Original CRISPR | TGGTGACAGTGTTGTAGGTG GGG (reversed) | Intergenic | ||