ID: 1034929906

View in Genome Browser
Species Human (GRCh38)
Location 7:155153468-155153490
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034929906_1034929913 -8 Left 1034929906 7:155153468-155153490 CCAGCCCTGCCCGCTCCATTCTT No data
Right 1034929913 7:155153483-155153505 CCATTCTTCCCACCAGCCCTGGG No data
1034929906_1034929911 -9 Left 1034929906 7:155153468-155153490 CCAGCCCTGCCCGCTCCATTCTT No data
Right 1034929911 7:155153482-155153504 TCCATTCTTCCCACCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034929906 Original CRISPR AAGAATGGAGCGGGCAGGGC TGG (reversed) Intergenic
No off target data available for this crispr