ID: 1034929913

View in Genome Browser
Species Human (GRCh38)
Location 7:155153483-155153505
Sequence CCATTCTTCCCACCAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034929902_1034929913 12 Left 1034929902 7:155153448-155153470 CCCCACCTACAACACTGTCACCA No data
Right 1034929913 7:155153483-155153505 CCATTCTTCCCACCAGCCCTGGG No data
1034929904_1034929913 10 Left 1034929904 7:155153450-155153472 CCACCTACAACACTGTCACCAGC No data
Right 1034929913 7:155153483-155153505 CCATTCTTCCCACCAGCCCTGGG No data
1034929903_1034929913 11 Left 1034929903 7:155153449-155153471 CCCACCTACAACACTGTCACCAG No data
Right 1034929913 7:155153483-155153505 CCATTCTTCCCACCAGCCCTGGG No data
1034929906_1034929913 -8 Left 1034929906 7:155153468-155153490 CCAGCCCTGCCCGCTCCATTCTT No data
Right 1034929913 7:155153483-155153505 CCATTCTTCCCACCAGCCCTGGG No data
1034929905_1034929913 7 Left 1034929905 7:155153453-155153475 CCTACAACACTGTCACCAGCCCT No data
Right 1034929913 7:155153483-155153505 CCATTCTTCCCACCAGCCCTGGG No data
1034929901_1034929913 13 Left 1034929901 7:155153447-155153469 CCCCCACCTACAACACTGTCACC No data
Right 1034929913 7:155153483-155153505 CCATTCTTCCCACCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034929913 Original CRISPR CCATTCTTCCCACCAGCCCT GGG Intergenic
No off target data available for this crispr