ID: 1034936246

View in Genome Browser
Species Human (GRCh38)
Location 7:155202749-155202771
Sequence GATTCTGCACAGGCGGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034936234_1034936246 18 Left 1034936234 7:155202708-155202730 CCAGAGGACGCCAGGTAGACTCA No data
Right 1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG No data
1034936236_1034936246 8 Left 1034936236 7:155202718-155202740 CCAGGTAGACTCAGTGGCCAGAG No data
Right 1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG No data
1034936242_1034936246 -9 Left 1034936242 7:155202735-155202757 CCAGAGGTTAGGGGGATTCTGCA No data
Right 1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG No data
1034936229_1034936246 29 Left 1034936229 7:155202697-155202719 CCGCACCTTCCCCAGAGGACGCC No data
Right 1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG No data
1034936231_1034936246 24 Left 1034936231 7:155202702-155202724 CCTTCCCCAGAGGACGCCAGGTA No data
Right 1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG No data
1034936233_1034936246 19 Left 1034936233 7:155202707-155202729 CCCAGAGGACGCCAGGTAGACTC No data
Right 1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG No data
1034936232_1034936246 20 Left 1034936232 7:155202706-155202728 CCCCAGAGGACGCCAGGTAGACT No data
Right 1034936246 7:155202749-155202771 GATTCTGCACAGGCGGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034936246 Original CRISPR GATTCTGCACAGGCGGCTCA GGG Intergenic
No off target data available for this crispr