ID: 1034936383

View in Genome Browser
Species Human (GRCh38)
Location 7:155203271-155203293
Sequence AGGCCAGGAAATGCACCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1034936383_1034936390 19 Left 1034936383 7:155203271-155203293 CCTGTGGGTGCATTTCCTGGCCT No data
Right 1034936390 7:155203313-155203335 AGTGGCTCCTCCTGCTTTTGTGG No data
1034936383_1034936389 1 Left 1034936383 7:155203271-155203293 CCTGTGGGTGCATTTCCTGGCCT No data
Right 1034936389 7:155203295-155203317 GGGCTTTGTGGAGTGAACAGTGG No data
1034936383_1034936391 20 Left 1034936383 7:155203271-155203293 CCTGTGGGTGCATTTCCTGGCCT No data
Right 1034936391 7:155203314-155203336 GTGGCTCCTCCTGCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1034936383 Original CRISPR AGGCCAGGAAATGCACCCAC AGG (reversed) Intergenic
No off target data available for this crispr